A non-viral gene carrier and a preparation method and application thereof
The BA-PEI polymer formed by cross-linking baicalin and PEI serves as a non-viral gene carrier, solving the problems of immunogenicity of viral vectors and cytotoxicity of PEI. This achieves safe and efficient gene delivery and anti-tumor effects, especially showing significant inhibitory effects in the treatment of lung cancer.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-15
- Publication Date
- 2026-03-31
AI Technical Summary
Existing viral vectors pose immunogenicity, genetic burden, and cancer risk in gene therapy, and polyethyleneimine (PEI) has significant cytotoxicity. Therefore, there is a need to develop a biocompatible non-viral gene vector to achieve safe and efficient gene delivery.
BA-PEI polymer, formed by baicalin and polyethyleneimine (PEI), was prepared by EDC/NHS cross-linking reaction. It was used as a non-viral gene carrier to load miR-34a for gene delivery, and the antibacterial, antiviral, anti-inflammatory and anticancer functions of baicalin were used to enhance the therapeutic effect.
BA-PEI polymer exhibits low cytotoxicity, high transfection efficiency, and can effectively deliver miR-34a to lung cancer cells, significantly inhibiting lung tumors and enhancing anti-tumor efficacy. Moreover, the preparation method is simple, environmentally friendly, and pollution-free.
Smart Images

Figure QLYQS_1 
Figure BDA0004289320590000021 
Figure BDA0004289320590000051
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical materials technology, specifically relating to a non-viral gene vector, its preparation method, and its application. Background Technology
[0002] Currently, cancer treatments mainly include surgery, radiotherapy, and anti-tumor drugs. Surgery and radiotherapy are the primary treatments for localized, non-metastatic tumors, while anti-tumor drugs such as chemotherapy, hormones, and biotherapy are preferred for treating metastatic tumors. However, chemotherapy drugs can induce the destruction of normal cells and are toxic. Therefore, there is an urgent need to find another effective targeted treatment for cancer, namely gene therapy. The success of cancer gene therapy depends not only on a good molecular strategy, which includes designing specific genetic material that is specifically expressed in tumor cells, but also on safe, efficient, and controllable vector preparation.
[0003] Viral vectors were the first proposed vectors for gene therapy. The properties and characteristics of viruses make them suitable for delivering RNA and DNA into human cells, and numerous clinical trials have been conducted, resulting in the approval of several gene therapy drugs. However, immunogenicity, limitations in genetic load, the risk of cancer due to the insertion of therapeutic payloads near genes controlling cell growth, and the limited mass production of viral vectors have spurred the development and engineering of non-viral vectors supported by nanomedicine.
[0004] Non-viral gene vectors, as gene therapy carriers, are among the most promising technologies in biomedical research due to their ease of synthesis and functionalization, and low immunogenicity and toxicity. A successful non-viral delivery system must have a good circulation time to allow the vector to penetrate target tissues with low toxicity, and possess biocompatibility and biodegradability. Polyethyleneimine (PEI), with its stable molecular structure, can serve as a scaffold for further modification to improve its performance in vivo, and is considered one of the most effective drug carriers. However, PEI exhibits significant cytotoxicity, and this cytotoxicity is molecularly dependent. Therefore, it is essential to find a cationic polymer with better biocompatibility as a gene delivery carrier. Summary of the Invention
[0005] In view of the problems and shortcomings of the existing technology, the purpose of this invention is to provide a non-viral gene vector, its preparation method and application.
[0006] The first aspect of this invention provides a non-viral gene vector, the structural formula of which is as follows:
[0007]
[0008] Where n represents the number of repeating polymer units.
[0009] According to the above-described non-viral gene vector, preferably, the non-viral gene vector is prepared by a cross-linking reaction of baicalin and polyethyleneimine. More preferably, the non-viral gene vector is prepared by an EDC / NHS cross-linking reaction of baicalin and polyethyleneimine.
[0010] According to the above-mentioned non-viral gene vector, preferably, the molecular weight of the polyethyleneimine is 25,000.
[0011] According to the above-mentioned non-viral gene vector, preferably, the value of n is 59 to 61.
[0012] The second aspect of the present invention provides a method for preparing the non-viral gene vector described in the first aspect above, specifically: adding EDC and NHS to a baicalin solution, mixing evenly, then adding polyethyleneimine, stirring and reacting, and after the reaction is completed, dialyzing the reaction product to remove unreacted PEI, EDS and NHS, and lyophilizing the dialyzed reaction product to obtain the non-viral gene vector.
[0013] According to the above preparation method, preferably, the preparation method of the baicalin melt is as follows: baicalin is added to MES buffer, the pH of the MES buffer is adjusted to 6-7, and the solution is stirred to dissolve, thereby obtaining a baicalin solution. More preferably, the pH of the MES buffer is adjusted using a 1 mol / L NaOH solution.
[0014] According to the above preparation method, preferably, the molar ratio of baicalin to EDC and NHS is 1:1-10:1.2-12.
[0015] According to the above preparation method, preferably, the molar ratio of amino groups in baicalin to amino groups in polyethyleneimine is 1:1.
[0016] According to the above preparation method, preferably, the dialysis molecular weight cutoff is 3500-12000.
[0017] The third aspect of the present invention provides the application of the non-viral gene vector described in the first aspect above in gene delivery, that is, the non-viral gene vector is used as a gene delivery vector to load the target gene.
[0018] The fourth aspect of the present invention provides the use of the non-viral gene vector described in the first aspect above in the preparation of a medicament for gene therapy.
[0019] The fifth aspect of the present invention provides a nanocomposite composed of the non-viral gene carrier and nucleic acid described in the first aspect above.
[0020] According to the above-described nanocomposite, preferably, the nucleic acid is DNA, siRNA, or miRNA.
[0021] According to the above-described nanocomposite, preferably, the nucleic acid is miR-34a. The mass ratio of the non-viral gene vector to miR-34a in the nanocomposite is 10:1.
[0022] The sixth aspect of the present invention provides a method for preparing the nanocomposite described in the fifth aspect above. The method includes: adding the non-viral gene vector and nucleic acid described in the first aspect above to a basal culture medium and incubating for 4-8 minutes, and then mixing the non-viral gene vector-basal culture medium mixture with the nucleic acid-basal culture medium mixture and incubating for 15-25 minutes to obtain the nanocomposite.
[0023] The seventh aspect of this invention provides the application of the nanocomposite described in the fifth aspect in gene delivery (i.e., the non-viral gene vector as a gene delivery vector, loaded with a target gene) or in the preparation of a medicament for gene therapy. Further, the medicament is a lung cancer treatment drug.
[0024] An eighth aspect of the present invention provides a gene delivery system. The gene delivery system includes a vector and a therapeutic gene loaded on the vector, wherein the vector is the non-viral gene vector described in the first aspect above.
[0025] Compared with the prior art, the present invention achieves the following positive and beneficial effects:
[0026] (1) The non-viral gene vector of the present invention is a BA-PEI polymer synthesized from baicalin and PEI via an EDC / NHS cross-linking reaction. The polyamine molecules in the BA-PEI polymer retain secondary and tertiary amines, thus enabling them to form stable and soluble complexes with the target gene via charge linkage, effectively delivering the target gene into the cell and then releasing it efficiently. Compared to PEI25K, the BA-PEI polymer of the present invention exhibits better biocompatibility, lower cytotoxicity, and higher transfection efficiency, showing broad application prospects in the field of gene delivery.
[0027] (2) The non-viral gene vector BA-PEI of the present invention can effectively mediate the delivery of miR-34a to lung cancer cells and / or lung tumor model animals, and significantly inhibit lung tumors; moreover, baicalin has antibacterial, antiviral, anti-inflammatory and anticancer functions. Baicalin in the non-viral gene vector BA-PEI works synergistically with miR-34a to exert anti-tumor effects, which greatly enhances the efficacy of anti-tumor treatment.
[0028] (3) The method for preparing non-viral gene vectors in this invention is simple, easy to operate, low in raw material cost, and has no organic solvent residue, making it environmentally friendly and pollution-free. Attached Figure Description
[0029] Figure 1 This is the proton NMR spectrum of the BA-PEI polymer of this invention;
[0030] Figure 2 The graph shows the toxicity results of CCK-8 cells treated with different concentrations of BA-PEI and PEI25K.
[0031] Figure 3 For the study of transfection efficiency of PEI / miR-34a nanocomposite (** indicates statistical difference);
[0032] Figure 4 The inhibitory effects of different concentrations of BA-PEI / miR-34a on tumor proliferation (# indicates no statistical difference; * indicates a statistical difference);
[0033] Figure 5 Image showing the staining results of BA-PEI / miR-34a on A549 live and dead cells. Detailed Implementation
[0034] The following detailed description is exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0035] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of exemplary embodiments according to the invention. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, components, and / or combinations thereof.
[0036] Unless otherwise specified, the experimental methods in the following examples all employ conventional techniques in this technical field or follow the conditions recommended by the manufacturer; reagents or instruments whose manufacturers are not specified are all commercially available products.
[0037] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0038] Example 1: Preparation of BA-PEI polymer
[0039] The preparation method of BA-PEI polymer includes the following specific steps:
[0040] (1) Add 0.94g BA (baicalin, purchased from Sigma, catalog number 572667) to 100mL MES buffer (purchased from MCE, catalog number HY-D0858), add 1mol / L NaOH solution dropwise and stir until baicalin is completely dissolved to obtain baicalin solution.
[0041] (2) Add EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, purchased from Sigma, catalog number 39391) and NHS (N-hydroxysuccinamide, purchased from Sigma, catalog number 130672) to the baicalin solution, with a molar ratio of baicalin to EDC and NHS of 1:1:1.2. Stir at room temperature for 15-30 min (to activate the carboxyl groups on the baicalin), and then add PEI (molecular weight 25000) (…). The molar ratio of amino groups in baicalin to amino groups in polyethyleneimine was 1:1. The reaction was stirred for 30 min (the activated carboxyl groups on the baicalin molecule coordinate with the amino groups of polyethyleneimine). After the reaction, the reaction product was dialyzed in pure water for 6 h using a dialysis bag with a molecular weight cutoff of 3500-12000 to remove unreacted PEI, EDS, and NHS. The dialyzed reaction product was then freeze-dried to obtain the BA-PEI polymer, which was stored at -20℃. The reaction formula for the reaction between baicalin and PEI is shown below:
[0042]
[0043] The NMR analysis of the prepared BA-PEI polymer in this invention is as follows: Figure 1 As shown.
[0044] Depend on Figure 1 It can be seen that new peaks appeared at positions such as 1.75 and 3.75-4.0, proving that baicalin was successfully coupled to the PEI polymer.
[0045] Example 2: Preparation of BA-PEI polymer
[0046] The preparation method of BA-PEI polymer includes the following specific steps:
[0047] (1) Add 0.94g BA (baicalin, purchased from Sigma, catalog number 572667) to 100mL MES buffer (purchased from MCE, catalog number HY-D0858), and add 1mol / L NaOH solution dropwise while stirring until baicalin is completely dissolved to obtain baicalin solution.
[0048] (2) Add EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, purchased from Sigma, catalog number 39391) and NHS (N-hydroxysuccinamide, purchased from Sigma, catalog number 130672) to the baicalin solution. The molar ratio of baicalin to EDC and NHS is 1:2:2.4. Stir at room temperature for 15-30 min, then add PEI (molecular weight 25000) (the molar ratio of amino groups in baicalin to amino groups in polyethyleneimine is 1:1), and stir for 30 min. After the reaction is completed, dialyze the reaction product in pure water for 6 h using a dialysis bag with a molecular weight cutoff of 3500-12000 to remove unreacted PEI, EDS and NHS. Freeze-dry the dialyzed reaction product to obtain BA-PEI polymer, and store at -20℃.
[0049] Example 3: Preparation of BA-PEI polymer
[0050] The preparation method of BA-PEI polymer includes the following specific steps:
[0051] (1) Add 0.94g BA (baicalin, purchased from Sigma, catalog number 572667) to 100mL MES buffer (purchased from MCE, catalog number HY-D0858), and add 1mol / L NaOH solution dropwise while stirring until baicalin is completely dissolved to obtain baicalin solution.
[0052] (2) Add EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, purchased from Sigma, catalog number 39391) and NHS (N-hydroxysuccinamide, purchased from Sigma, catalog number 130672) to the baicalin solution. The molar ratio of baicalin to EDC and NHS is 1:5:6. Stir at room temperature for 15-30 min, then add PEI (molecular weight 25000) (the molar ratio of amino group in baicalin to amino group in polyethyleneimine is 1:1), and stir for 30 min. After the reaction is completed, dialyze the reaction product in pure water for 6 h using a dialysis bag with a molecular weight cutoff of 3500-12000 to remove unreacted PEI, EDS and NHS. Freeze-dry the dialyzed reaction product to obtain BA-PEI polymer, and store at -20℃.
[0053] Example 4: Preparation of BA-PEI polymer
[0054] The preparation method of BA-PEI polymer includes the following specific steps:
[0055] (1) Add 0.94g BA (baicalin, purchased from Sigma, catalog number 572667) to 100mL MES buffer (purchased from MCE, catalog number HY-D0858), and add 1mol / L NaOH solution dropwise while stirring until baicalin is completely dissolved to obtain baicalin solution.
[0056] (2) Add EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, purchased from Sigma, catalog number 39391) and NHS (N-hydroxysuccinamide, purchased from Sigma, catalog number 130672) to the baicalin solution. The molar ratio of baicalin to EDC and NHS is 1:10:12. Stir at room temperature for 15-30 min, then add PEI (molecular weight 25000) (the molar ratio of amino group in baicalin to amino group in polyethyleneimine is 1:1), and stir for 30 min. After the reaction is completed, dialyze the reaction product in pure water for 6 h using a dialysis bag with a molecular weight cutoff of 3500-12000 to remove unreacted PEI, EDS and NHS. Freeze-dry the dialyzed reaction product to obtain BA-PEI polymer, and store at -20℃.
[0057] Example 5: Biosafety assessment of BA-PEI polymer
[0058] 1. Cell selection and culture:
[0059] The cells used in the experiment were non-small cell lung cancer A549.
[0060] The cell culture method is as follows:
[0061] Cells were cultured in RPMI 1640 medium containing 10% fetal bovine serum, with 100 U / ml penicillin and 100 μg / ml streptomycin added, under general conditions of 37°C, 5% CO2, and saturated humidity.
[0062] 2. Experimental methods:
[0063] The cytotoxicity of the vector to A549 cells was detected using the CCK-8 assay. The specific experimental method is as follows:
[0064] BA-PEI polymer (prepared using the method described in Example 1) and PEI25000 (PEI25K) were dissolved in water to prepare BA-PEI polymer solutions and PEI25K solutions of different concentrations. A549 cells were then incubated at 5.0 × 10⁻⁶ cells / mL. 3Cells were seeded at a density of 100 μL / well in 96-well plates. After 24 h, cells were treated with different concentrations (10-160 μg / mL) of BA-PEI polymer solution and PEI25000 (PEI25K) solution, with 100 μL added to each well. A blank control group (containing only culture medium) and a negative control group (containing only culture medium and cells) were also included, with three replicates per group. The plates were incubated at 37°C with 5% CO2 for 48 h. 10 μL of CCK-8 solution was added to each well, and the plates were incubated for another 2-4 h. The absorbance at 450 nm was measured using a microplate imager, and cell viability was calculated as follows: Cell viability = (OD value of experimental wells - OD value of blank control wells) / (OD value of negative control wells - OD value of blank control wells) × 100%.
[0065] 3. Experimental Results:
[0066] The results of the experiment using the CCK-8 assay to detect the toxicity of the vector to A549 cells are as follows: Figure 2 As shown.
[0067] Depend on Figure 2 It can be seen that the BA-PEI vector still has excellent biocompatibility at a concentration of 40 μg / mL, with cell viability >80%, while only 30% cell viability can be obtained at a concentration of 20 μg / mL of PEI25K, indicating that the BA-PEI vector has lower cytotoxicity compared with PEI25K.
[0068] Example 6: Preparation of BA-PEI / miR-34a nanocomposite
[0069] miR-34a was synthesized by Suzhou Genomics Co., Ltd. The nucleotide sequence of miR-34a is as follows:
[0070] miR-34a: 5'-UGGCAGUGUCUUAGCUGGUUGU-3',
[0071] 3'-AACCAGCUAAGACACUGCCAUU-5'.
[0072] The preparation method of the BA-PEI / miR-34a nanocomposite is as follows: Taking 6-well plate cell transfection as an example, BA-PEI polymer (prepared according to the method described in Example 1) and miR-34a are added to 250 μl of basal culture medium respectively and incubated at room temperature for 5 minutes to obtain BA-PEI polymer-basal culture medium mixture and miR-34a-basal culture medium mixture. The BA-PEI polymer-basal culture medium mixture and the miR-34a-basal culture medium mixture are then mixed and incubated at room temperature for 20 minutes to obtain the BA-PEI / miR-34a nanocomposite.
[0073] Example 7: Determination of transfection efficiency
[0074] 1. Experimental Methods
[0075] (1) Five BA-PEI / miR-34a nanocomposites with different BA-PEI to miR-34a mass ratios were prepared according to the BA-PEI / miR-34a nanocomposite preparation method described in Example 6. The mass ratios of BA-PEI polymer to miR-34a in the five BA-PEI / miR-34a nanocomposites were 1:1, 2:1, 5:1, 10:1 and 20:1, respectively, and the amount of miR-34a was 2 μg.
[0076] (2) A549 cells were inoculated at 3.0 × 10⁻⁶. 5 Cells were seeded at a density of 100 cells / well in 6-well plates. Once cell confluence was greater than 80%, the old culture medium was carefully aspirated. Five prepared BA-PEI / miR-34a nanocomposites were added to the 6-well plates, with 2 μg of miR-34a added. The vector was added according to the mass ratio. After 48 hours, cells were collected, and RNA was extracted using Trizol reagent (ambion) according to the manufacturer's instructions. The RNA was then tailed using the Poly(A) tailing enzyme kit (Novozymes, catalog number DD4111) according to the manufacturer's instructions. Reverse transcription was performed using the specific primer CAGGTCCAGTTTTTTTTTTTTTTTVN (Reverse transcription kit purchased from Thermo, catalog number K1691).
[0077] The following primers were used for qPCR detection (U6-F was used as an internal reference gene):
[0078] miR34a-F: gcagtggcagtgtcttag,
[0079] miR34a-R:ggtccagtttttttttttttttacaac,
[0080] U6-F: CTCCGCTTCGGCAGCACA,
[0081] U6-R:AACGCTTCACGAATTTGCGT;
[0082] The qPCR reaction system is as follows:
[0083]
[0084] The solution was prepared according to the qPCR reaction system. The amplification program was: 95℃ for 5 minutes; 40 cycles: 95℃ for 15 seconds, 65℃ for 45 seconds. U6 was used as the internal control gene. (Following step 2...)-△△CT The relative expression level of miR-34a was calculated to assess its transfection efficiency.
[0085] 2. Experimental Results
[0086] The amplification results of qPCR for 5 different BA-PEI / miR-34a nanocomplexes are as follows: Figure 3 As shown.
[0087] Depend on Figure 3 The results showed that the transfection effect of BA-PEI vector to miR-34a was better than that of PEI at mass ratios of 1:1, 2:1, 5:1, 10:1 and 20:1, and the transfection effect was best at a mass ratio of 10:1.
[0088] Example 8: Effect of BA-PEI / miR-34a on the inhibition of A549 proliferation
[0089] 1. CCK-8 assay for cell proliferation
[0090] (1) Experimental method:
[0091] Seven BA-PEI / miR-34a nanocomposites with different BA-PEI to miR-34a mass ratios were prepared according to the BA-PEI / miR-34a nanocomposite preparation method described in Example 6. The BA-PEI polymer to miR-34a mass ratios in the seven BA-PEI / miR-34a nanocomposites were 0.5:1, 1:1, 2:1, 5:1, 10:1, 20:1, and 40:1, respectively.
[0092] In addition, for comparison, a miR-34a control NC was also included in this experiment. The NC was synthesized by Suzhou Gemma Gene Co., Ltd., and its nucleotide sequence is as follows:
[0093] NC: 5'-UUCUCCGAACGUGUCACGUdTdT-3'
[0094] 3'-ACGUGACACGUUCGGAGAAdTdT-5'.
[0095] Seven BA-PEI / NC nanocomposites with different BA-PEI to NC mass ratios were prepared. The preparation method of the BA-PEI / NC nanocomposites was basically the same as that of the BA-PEI / miR-34a nanocomposites described in Example 6, except that miR-34a was replaced with NC in the preparation method. The BA-PEI to NC mass ratios of the seven BA-PEI / NC nanocomposites were 0.5:1, 1:1, 2:1, 5:1, 10:1, 20:1, and 40:1, respectively.
[0096] A549 cells were seeded in 96-well plates and replaced with 200 μL of fresh culture medium when the cells reached 50-80% confluence. Then, the seven prepared BA-PEI / miR-34a nanocomposites were added to the cell culture dishes, with miR-34a added at 0.2 μg and the carrier added according to the mass ratio. After 6 hours, fresh culture medium was added, and after 48 hours, CCK-8 was added to detect cell proliferation. The experiment also included a Control group and a PEI25K group. The Control group did not use any transfection reagents; instead, the BA-PEI / miR-34a nanocomposite was replaced with miR-34a and NC. The PEI25K group replaced the BA-PEI / miR-34a nanocomposite with the PEI25K / miR-34a nanocomposite (0.2 μg of miR-34a was used, and the carrier was added according to the mass ratio). The PEI25K / miR-34a nanocomposite was prepared as follows: PEI25K and miR-34a were added to 25 μl of basal medium, respectively, and incubated at room temperature for 5 minutes to obtain a PEI25K-basal medium mixture and a miR-34a-basal medium mixture. The PEI25K-basal medium mixture and the miR-34a-basal medium mixture were then mixed and incubated at room temperature for 20 minutes to obtain the PEI25K / miR-34a nanocomposite.
[0097] (2) Experimental results:
[0098] The experimental results of CCK-8 detection of A549 cell proliferation are as follows: Figure 4 As shown.
[0099] Depend on Figure 4It was found that, compared with the NC group, the BA-PEI to miR-34a mass ratio of 10:1 showed a significant difference between the two groups after transfection (P<0.05), and the BA-PEI to miR-34a mass ratio of 10:1 also showed a statistically significant difference compared with the control group (P<0.05). Compared with the 25.5% cell proliferation inhibition effect of the PEI25K / miR-34a group, the cell proliferation inhibition effect of the BA-PEI to miR-34a mass ratio of 10:1 group reached 63.8% (P<0.05).
[0100] 2. Live and dead cell staining assays confirmed that successful transfection of the vector with miR-34a induced apoptosis and produced proliferation inhibition.
[0101] The live and dead cell staining assay was used to detect the effect of successful transfection of miR-34a vector in inducing apoptosis and producing proliferation inhibition.
[0102] (1) Experimental method:
[0103] a. Experimental Groups: The experiment was set up as follows: NC group (control NC with only miR-34a added, the nucleotide sequence of NC is the same as that of CCK-8 in Example 8 for cell proliferation detection), miR-34a (2 μg / mL) group, control group PEI25k / NC (mass ratio of PEI25k to NC is 1.33:1), BA-PEI / NC group (mass ratio of BA-PEI to NC is 10:1), BA-PEI / miR-34a group (mass ratio of BA-PEI to miR-34a is 10:1), and control group PEI25k / miR-34a (mass ratio of PEI25k to miR-34a is 1.33:1).
[0104] b. Taking the BA-PEI / miR-34a group as an example, the experimental procedure was as follows: A549 cells were cultured at 2.5 × 10⁻⁶ cells per day. 5 Cells were seeded at a density of 100 cells / well in 6-well plates and incubated in a 5% CO2 incubator at 37°C for 24 h. Then, BA-PEI / miR-34a nanocomplex was added to the 6-well plates, and serum was added after 6 h of serum-free transfection. The cells were incubated at 37°C for 48 h. The old culture medium was aspirated, and the cells were washed once with PBS. 1 mL of Calcinam AM / PI detection working solution was added to each well of the 6-well plates, and the cells were incubated at 37°C in the dark for 30 min. The cells were washed once with 1 mL of PBS buffer and observed under a fluorescence microscope.
[0105] Preparation of Calceinam AM / PI detection working solution: Take an appropriate amount of Calcein AM (1000X), PI (1000X) and detection buffer, and mix them thoroughly according to 10 samples with 1 μL of Calcein AM (1000X), 1 μL of PI (1000X) and 1 mL of detection buffer.
[0106] (2) Experimental Results
[0107] Live and dead cell staining experiments, such as Figure 5 As shown.
[0108] Depend on Figure 5 The results showed that BA-PEI effectively delivered miR-34a and mediated apoptosis in A549 cells at the morphological level (live cells were stained green by Calcein AM, and dead cells were stained red by PI). This indicates that baicalin in the non-viral gene vector BA-PEI can synergistically work with miR-34a to exert anti-tumor effects and enhance the efficacy of tumor treatment.
[0109] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A non-viral gene carrier, having the following structural formula: wherein n represents the number of polymer repeating units, and n is 59-61.
2. The non-viral gene carrier according to claim 1, wherein The non-viral gene carrier is prepared by cross-linking reaction of baicalin and polyethyleneimine.
3. The method for preparing the non-viral gene vector according to claim 1 or 2, characterized in that, EDC and NHS are added to a baicalin solution, mixed uniformly, and then polyethyleneimine is added, followed by stirring and reaction. After the reaction is completed, the reaction product is dialyzed to remove unreacted PEI, EDS and NHS, and then the dialyzed reaction product is lyophilized to obtain the non-viral gene carrier.
4. The production method according to claim 3, characterized by, The molar ratio of baicalin to EDC and NHS is 1:1-10:1.2-12, and the molar ratio of the carboxyl in baicalin to the amino in polyethyleneimine is 1:
1. 5.The non-viral gene carrier of claim 1 or 2 is used in gene delivery or in the preparation of a drug for gene therapy. 6.A nanocomposite, which is composed of the non-viral gene carrier of claim 1 or 2 and nucleic acid.
7. The nanocomposite of claim 6, wherein, The nucleic acid is DNA, siRNA or miRNA.
8. The nanocomposite of claim 7, wherein, The nucleic acid is miR-34a. 9.The nanocomposite of any one of claims 6-8 is used in gene delivery or in the preparation of a drug for gene therapy. 10.A gene delivery system, comprising a carrier and a therapeutic gene loaded on the carrier, wherein the carrier is the non-viral gene carrier of claim 1 or 2.
Citation Information
Patent Citations
PMP complex for gene delivery
KR1020140073617A
Vitamin b6-coupled poly(ester amine) as gene carrier and application in cancer gene therapy
US20150030854A1