A method for detecting quality differences of immune adjuvants
The qPCR technology was used to establish a standard curve to detect the quality control fragments of BCG-CpG adjuvant, which solved the problem of tedious and time-consuming quality control in the existing technology and achieved efficient and low-cost detection of adjuvant quality differences.
Patent Information
- Application Number
- CN202310716954.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-15
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2043-06-15
AI Technical Summary
In the existing technology, quality control indicators in adjuvant production are cumbersome and time-consuming, making it difficult to detect differences between BCG-CpG adjuvant production batches.
qPCR technology was used to establish a logarithmic standard curve of CT and C. The quality control fragment of BCG-CpG adjuvant was detected by fluorescence quantitative detection. The C values of different batches were compared to detect quality differences.
It simplifies the operation process, reduces cost and time, provides an efficient quality control method, and improves detection efficiency.
Smart Images

Figure CN116814748B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of adjuvant production, and particularly relates to a method for detecting quality differences of immune adjuvants. Background Art
[0002] Adjuvants are auxiliary substances that, when injected into the body along with antigens or pre-injected, can enhance the body's immune response to antigens or alter the type of immune response. Their quality is crucial to the body's immune response to vaccines and the production of antibodies. In existing technologies, adjuvant quality control measures are limited to the content of unmethylated DNA motifs and nucleic acid purity during adjuvant production. Methylation quality control, however, has drawbacks such as cumbersome procedures, high technical requirements for operators, and a long production cycle. BCG-CpG-DNA is a DNA fragment extracted from disrupted BCG cells. The mechanical disruption used is random, making it difficult to detect differences between BCG-CpG adjuvant production batches.
[0003] Based on this, the present invention provides a method for detecting quality differences of immune adjuvants. Summary of the Invention
[0004] In response to the above problems, the present invention provides a method for detecting quality differences of immune adjuvants.
[0005] The purpose of the present invention is achieved through the following technical solutions:
[0006] A method for detecting quality differences of immune adjuvants, comprising:
[0007] A standard curve of the logarithmic values of CT and C was established based on the CT value and the logarithmic value of C of the qPCR reaction of a standard plasmid containing the quality control fragment of the target immune adjuvant, wherein qPCR reaction represents real-time fluorescent quantitative long-chain polymerase chain reaction, CT value represents the change in the content of the quality control fragment of the target immune adjuvant before and after amplification, and C represents the copy number of the quality control fragment;
[0008] Substitute the Ct values of the qPCR reactions of target immune adjuvants from different production batches into the standard curve to obtain the logarithmic values of Ct of target immune adjuvants from different production batches;
[0009] Comparing the logarithmic values of C or C of target immune adjuvants produced in different batches to obtain comparative results;
[0010] The quality differences of target immune adjuvants produced in different batches were obtained based on the comparison results.
[0011] Furthermore, the method of establishing a standard curve of the logarithmic values of CT and C based on the CT value and the logarithmic value of C of the qPCR reaction of the standard plasmid containing the quality control fragment of the target immune adjuvant comprises:
[0012] A standard plasmid is established based on the quality control fragment of the target immune adjuvant, and the copy number C of the quality control fragment contained in 1 μg / mL of the standard plasmid is obtained, that is, the logarithm value of C of the 1 μg / mL standard plasmid is obtained;
[0013] Determine the primer pair for the qPCR reaction based on the quality control fragment of the target immune adjuvant;
[0014] Using standard plasmid solutions of the same volume and different concentrations as the amplification template for qPCR reaction, and using primer pairs to form the reaction system, qPCR amplification was performed. After the amplification was completed, the CT values of the standard plasmid solutions of the same volume and different concentrations were measured.
[0015] The logarithmic values of C of the standard plasmid solutions of the same volume and different concentrations were calculated based on the logarithmic value of C of the 1 μg / mL standard plasmid.
[0016] A standard curve of the logarithmic values of CT and C was established based on the CT values and logarithmic values of standard plasmid solutions of the same volume and different concentrations.
[0017] Furthermore, the method of establishing a standard plasmid based on the quality control fragment of the target immune adjuvant and obtaining the copy number C of the quality control fragment contained in 1 μg / mL of the standard plasmid, that is, obtaining the logarithmic value of C of the 1 μg / mL standard plasmid, comprises:
[0018] According to the immunologically active motif of the target immune adjuvant, a gene fragment containing the immunologically active motif is selected as a quality control fragment;
[0019] A standard plasmid is established based on the quality control fragment, and the copy number C of the quality control fragment contained in 1 μg / mL of the standard plasmid is obtained, that is, the logarithmic value of C of the 1 μg / mL standard plasmid is obtained.
[0020] Furthermore, the CT values of the qPCR reactions of target immune adjuvants from different production batches are substituted into the standard curve to obtain the logarithmic values of the C values of target immune adjuvants from different production batches, including:
[0021] Using target immune adjuvants from different production batches as amplification templates for qPCR reactions, using primer pairs to form a reaction system, performing qPCR amplification, and measuring after the amplification to obtain CT values of target immune adjuvants from different production batches. When using target immune adjuvants from different production batches as amplification templates for qPCR reactions, ensure that the added mass of target immune adjuvants from different production batches is equal.
[0022] The CT values of target immune adjuvants from different production batches were respectively substituted into the standard curve to obtain the corresponding logarithmic values of C of target immune adjuvants from different production batches.
[0023] Furthermore, the reaction procedure of the qPCR reaction of the target immune adjuvants of different production batches is the same as the reaction procedure of the qPCR reaction of the standard plasmids of different concentrations and the same volume.
[0024] Furthermore, the reaction system for qPCR reaction of the target immune adjuvants of different production batches is the same as the reaction system for qPCR reaction of the standard plasmids of different concentrations and the same volume.
[0025] Furthermore, the target immune adjuvant is a BCG-CpG-DNA adjuvant, wherein BCG stands for Bacillus Calmette-Guérin.
[0026] Furthermore, the primer pairs for the qPCR reaction are any three or more primer pairs of primer pair 1, primer pair 2, primer pair 3, primer pair 4, primer pair 5, primer pair 6, primer pair 7, primer pair 8 and primer pair 9.
[0027] Furthermore, the primer pair 1 includes an upstream primer 1 and a downstream primer 1, the sequence of the upstream primer 1 is shown in Seq_1, and the sequence of the downstream primer 1 is shown in Seq_2;
[0028] The primer pair 2 includes an upstream primer 2 and a downstream primer 2, the sequence of the upstream primer 2 is shown in Seq_3, and the sequence of the downstream primer 2 is shown in Seq_4;
[0029] The primer pair 3 includes an upstream primer 3 and a downstream primer 3, the sequence of the upstream primer 3 is shown in Seq_5, and the sequence of the downstream primer 3 is shown in Seq_6;
[0030] The primer pair 4 includes an upstream primer 4 and a downstream primer 4, the sequence of the upstream primer 4 is shown in Seq_7, and the sequence of the downstream primer 4 is shown in Seq_8;
[0031] The primer pair 5 includes an upstream primer 5 and a downstream primer 5, the sequence of the upstream primer 5 is shown in Seq_9, and the sequence of the downstream primer 5 is shown in Seq_10;
[0032] The primer pair 6 includes an upstream primer 6 and a downstream primer 6, the sequence of the upstream primer 6 is shown in Seq_11, and the sequence of the downstream primer 6 is shown in Seq_12;
[0033] The primer pair 7 includes an upstream primer 7 and a downstream primer 7, the sequence of the upstream primer 7 is shown in Seq_13, and the sequence of the downstream primer 7 is shown in Seq_14;
[0034] The primer pair 8 includes an upstream primer 8 and a downstream primer 8, the sequence of the upstream primer 8 is shown in Seq_15, and the sequence of the downstream primer 8 is shown in Seq_16;
[0035] The primer pair 9 includes an upstream primer 9 and a downstream primer 9. The sequence of the upstream primer 9 is shown in Seq_17, and the sequence of the downstream primer 9 is shown in Seq_18.
[0036] Furthermore, the reaction procedure of the qPCR reaction was as follows: pre-denaturation: 95°C, 3 min, 1 cycle; cycling reaction: 95°C, 10 s; 60°C, 30 s; 40 cycles in total; melting curve: 95°C, 15 s; 60°C, 60 s; 95°C, 15 s.
[0037] Beneficial effects of the present invention:
[0038] The present invention uses qPCR technology to perform quality control on the immunologically active motifs of the target immune adjuvant, and provides a detection method for the quality differences of the target immune adjuvants produced in different batches. Compared with quality control studies based on unmethylated CpG, it eliminates the need for complex operations such as sample methylation treatment and high-performance liquid chromatography (HPLC), greatly reducing the cumbersome operation procedures of the entire test, while also reducing the cost of the test and saving time.
[0039] Other features and advantages of the present invention will be described in the following description, and in part will become apparent from the description, or will be understood by practicing the present invention. The purpose and other advantages of the present invention can be realized and obtained by the structures pointed out in the description, claims and drawings. BRIEF DESCRIPTION OF THE DRAWINGS
[0040] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following is a brief introduction to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0041] Figure 1 A flow chart of a method for detecting quality differences of immune adjuvants according to an embodiment of the present invention is shown. DETAILED DESCRIPTION
[0042] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts shall fall within the scope of protection of the present invention.
[0043] like Figure 1As shown, a method for detecting quality differences of immune adjuvants according to an embodiment of the present invention includes:
[0044] A standard curve of the logarithmic values of CT and C was established based on the CT value and the logarithmic value of C of the qPCR reaction of a standard plasmid containing the quality control fragment of the target immune adjuvant, wherein qPCR reaction represents real-time fluorescent quantitative long-chain polymerase chain reaction, CT value represents the change in the content of the quality control fragment of the target immune adjuvant before and after amplification, and C represents the copy number of the quality control fragment;
[0045] Substitute the Ct values of the qPCR reactions of target immune adjuvants from different production batches into the standard curve to obtain the logarithmic values of Ct of target immune adjuvants from different production batches;
[0046] Comparing the logarithmic values of C or C of target immune adjuvants produced in different batches to obtain comparative results;
[0047] The quality differences of target immune adjuvants produced in different batches were obtained based on the comparison results.
[0048] In this embodiment, the target immune adjuvant is a mycobacterium adjuvant, such as BCG-CpG-DNA adjuvant.
[0049] The method of establishing a standard curve of the logarithmic values of CT and C based on the CT value and the logarithmic value of C of the qPCR reaction of the standard plasmid containing the quality control fragment of the target immune adjuvant comprises:
[0050] A standard plasmid was established based on the quality control fragment of the BCG-CpG-DNA adjuvant, and the copy number of the quality control fragment contained in 1 μg / mL of the standard plasmid was obtained (C is the abbreviation for the copy number of the quality control fragment), that is, the logarithm of C of the 1 μg / mL standard plasmid was obtained;
[0051] Primer pairs for qPCR reactions were determined based on the quality control fragments of BCG-CpG-DNA adjuvant;
[0052] Using standard plasmid solutions of the same volume and different concentrations as the amplification template for qPCR reaction, and using primer pairs to form the reaction system, qPCR amplification was performed. After the amplification was completed, the CT values of the standard plasmid solutions of the same volume and different concentrations were measured.
[0053] The logarithmic values of C of the standard plasmid solutions of the same volume and different concentrations were calculated based on the logarithmic value of C of the 1 μg / mL standard plasmid.
[0054] A standard curve of the logarithmic values of CT and C was established based on the CT values and logarithmic values of standard plasmid solutions of the same volume and different concentrations.
[0055] Specifically, the standard plasmid is established based on the quality control fragment of BCG-CpG-DNA adjuvant, including:
[0056] According to the immunologically active motif of BCG-CpG-DNA adjuvant, a gene fragment containing the immunologically active motif was selected as a quality control fragment;
[0057] A standard plasmid is established based on the quality control fragment, and the copy number C of the quality control fragment contained in 1 μg / mL of the standard plasmid is obtained, that is, the logarithmic value of C of the 1 μg / mL standard plasmid is obtained.
[0058] In practice, the immunologically active motifs of the BCG-CpG-DNA adjuvant are obtained by methods well known to those skilled in the art. For example, by consulting a large number of published literature, it is found that the core dinucleotide (CpG) motif that exerts an immune effect is composed of a hexamer with a central unmethylated CpG, and is generally in the form of RRCGYY (where R represents purine and Y represents pyrimidine). Combining CpGODN (oligodeoxynucleotides) that have been approved for marketing or are in clinical trials at home and abroad, the immunologically active motifs of the BCG-CpG-DNA adjuvant are determined to be GTCGTT, GACGTT, and AACGTT, respectively.
[0059] In the completed BCG whole genome DNA sequence information, the GTCGTT, GACGTT, and AACGTT core motifs were searched, and DNA fragments containing the three immune core motifs of GTCGTT, GACGTT, and AACGTT with a length of about 100-150 bp (bp is the abbreviation for base pairs) were selected as quality control fragments. The quality control fragments are any three or more of the nine fragments of sequences such as Seq_19, Seq_20, Seq_21, Seq_22, Seq_23, Seq_24, Seq_25, Seq_26, and Seq_27 as quality control fragments.
[0060] Seq_19:
[0061] GTCGCCGAAACACCCCACACCCGGGCCCGGTCGGTGGAGAACGCGCTGTTGTCCATGGACAGTCGCGGAGGGGTTACGTAGCGGACTGGCGTCGTTCGTCGCGGGATATGGAAGCTGGTTTCAGGGTCAGGCG
[0062] Seq_20:
[0063] GATGCAAGTGCCACAATGCTGTCCACGATCTTCATGGTCTCGACGCTGACGGTGGTCACCTTCTTGATCAGGTCGACGATGTAGGTAGGGTTCGCGTGCTCGTCGCACCAGTCGTTGGGGTCGTTGACGATTCCGGACGCTTTGTCGGTGGTGACGC
[0064] Seq_21:
[0065] CGTAGTAGCGATGCACCCCATGACCGGGAGGCGGCGCCGCACCCACATACCGGCGCATACCGGCGTCGTTGACCAATGTCAGTGCCCCGCCCGGCAGTTCGCGGCCATCGCCGACACCCTCGGGCAACTCGGTGACGTTGGCAGGC
[0066] Seq_22:
[0067] AAATCGCCGGAGCAGTAGTGGAACACAAACGCTTCGCAGTCGCAGTGCACTATCGCAACGTTGCCGACGACAGCGTCGACAACCTGATTGCGGCGGTGCGCCGACTCGGACACGCAGCAGG
[0068] Seq_23:
[0069] ACACGCCCGCTGTCTTTCTCTACCCTACCGGTCAACACCAACGTT TCCCGGCCTAACCAGGCTTAGCGAGGCTCAGCGGTCAGTTGCTCTACCAGCTCCACGGCACTGT
[0070] Seq_24:
[0071] TAGGTTCACCCTGATGTCGGCTCCCGAACGGGTAACCGGCTTGTCCGGGCAACGTTACGGGGAAGTCCTTCTCGTAACACCCGGGGAGGCCGGTCCACAGGCCACCGTTTACAACAGCTT
[0072] Seq_25:
[0073] AGCTGCTTGTTCGGCGAAGGTGCGGCTGGTTCGGGTGTCGGTGACCGAGAGGTCCTCTTCGACGTTGAAGCCCGCGTTGTGGGCATCTTGAACGGCATAGATGACCCTGCGCTGGGCT
[0074] Seq_26:
[0075] CACCGGGTGCGACACTTACCGGCCGTCGTTCATGGGTGACGTTTCGAGGCTGTGCTGCTGCCAAGACCCCAGGAAGTCTCGGACGAGAGACTCGCTAGCCTCCGTG
[0076] Seq_27:
[0077] AGGTCAAGCCGGTCGAACCGGCGGGGCGTACGGTCGTGAAAGACTCCCCCGATCGACGTTCCGCTGACGGCAACCGTCATTTGCTTGACCGCCGGGGAGATCTCTCCGGCCACCTCTACGA
[0078] Specifically, establishing a standard plasmid based on the quality control fragment and obtaining the copy number C of the quality control fragment contained in 1 μg / mL of the standard plasmid, that is, obtaining the logarithmic value of C of the 1 μg / mL standard plasmid, includes:
[0079] Select nine fragments, Seq_19, Seq_20, Seq_21, Seq_22, Seq_23, Seq_24, Seq_25, Seq_26, and Seq_27, as quality control fragments. In this embodiment, nine fragments are exemplarily selected as quality control fragments. Alternatively, three, four, five, six, seven, or eight of the nine fragments can be selected as quality control fragments.
[0080] The above 9 fragments were used as quality control fragments. With reference to the gene sequences of the 9 fragments, after chemical synthesis, the oligonucleotides were further spliced into full-length or fragmented fragments through seamless cloning or enzyme digestion and inserted into the pUC57 vector. After ligation transformation, clone screening, sequencing verification and mutation repair, a recombinant vector with completely correct sequence was obtained as a standard plasmid. The full length of the standard plasmid is 3558 bp, the specific sequence is shown in Seq_28, and the relative molecular weight of the plasmid is 2.2×10 6 Da, the standard plasmid concentration was converted to copy number according to the following formula: plasmid copy number (copies / μL) = (plasmid concentration × 10 -9×6.02×10 23 ) / (660 Daltons / base × number of bases); the copy number of the quality control fragment in 1 μg / mL standard plasmid (i.e., C value) is 2.7×10 8 copies / μL, wherein the gene sequence chemical synthesis, seamless cloning or enzyme digestion assembly, full-length or fragment splicing, transformation, clone screening, sequencing verification and mutation repair operations used in this embodiment are all gene sequence synthesis, assembly and inspection methods well known to those skilled in the art and will not be described in detail here.
[0081] Seq_28:
[0082] SEQUENCE
[0083]
[0084]
[0085]
[0086]
[0087]
[0088] Specifically, the primer pair for determining the qPCR reaction based on the quality control fragment of the BCG-CpG-DNA adjuvant includes:
[0089] Primer pairs were designed based on the sequences of nine fragments, Seq_19, Seq_20, Seq_21, Seq_22, Seq_23, Seq_24, Seq_25, Seq_26, and Seq_27, using primer5.0 software. The sequences of the primer pairs are shown in Table 1, wherein primer pair 1 corresponds to the quality control fragment of the Seq_19 sequence, primer pair 2 corresponds to the quality control fragment of the Seq_20 sequence, primer pair 3 corresponds to the quality control fragment of the Seq_21 sequence, primer pair 4 corresponds to the quality control fragment of the Seq_22 sequence, primer pair 5 corresponds to the quality control fragment of the Seq_23 sequence, primer pair 6 corresponds to the quality control fragment of the Seq_24 sequence, primer pair 7 corresponds to the quality control fragment of the Seq_25 sequence, primer pair 8 corresponds to the quality control fragment of the Seq_26 sequence, and primer pair 9 corresponds to the quality control fragment of the Seq_27 sequence.
[0090] Table 1
[0091] Upstream primer sequence F (5'-3') Downstream primer sequence R (5'-3') Primer pair 1 Seq_1:GTCGCCGAAACACCCCACA Seq_2:CGCCTGACCCTGAAACCAG Primer pair 2 Seq_3: GATGCAAGTGCCACAATGC Seq_4: GCGTCACCACCGACAAAGCGT Primer pair 3 Seq_5:CGTAGTAGCGATGCACCCCATG Seq_6:GCCTGCCAACGTCACCGAGTT Primer pair 4 Seq_7:AAATCGCCGGAGCAGTAGT Seq_8: CCTGCTGCGTGTCCGAGTC Primer pair 5 Seq_9:ACACGCCCGCTGTCTTTCT Seq_10:ACAGTGCCGTGGAGCTGGT Primer pair 6 Seq_11:TAGGTTCACCCTGATGTCGG Seq_12:AAGCTGTTGTAAACGGTGGC Primer pair 7 Seq_13:AGCTGCTTGTTCGGCGAAGG Seq_14:AGCCCAGCGCAGGGTCATC Primer pair 8 Seq_15: CACCGGGTGCGACACTTAC Seq_16: CACGGAGGCTAGCGAGTCT Primer pair 9 Seq_17:AGGTCAAGCCGGTCGAACC Seq_18:TCGTAGAGGTGGCCGGAGA
[0092] The method uses standard plasmid solutions of the same volume and different concentrations as amplification templates for qPCR reaction, uses primer pairs to form a reaction system, performs qPCR amplification, and measures after the amplification to obtain CT values of standard plasmid solutions of the same volume and different concentrations, including:
[0093] A 1 μg / mL standard plasmid was diluted with TE buffer (composed of Tris (trishydroxymethylaminomethane) and EDTA (ethylenediaminetetraacetic acid)) to concentrations of 100 pg / μl, 50 pg / μl, 25 pg / μl, 12.5 pg / μl, 6.25 pg / μl, and 3.125 pg / μl. 4 μl of the above standard plasmid solutions at different concentrations was added to a 40 μl reaction system as an amplification template (DNA template) for the qPCR reaction.
[0094] The 40 μl reaction system includes: SYBR Green Master Mix (2×) 20 μl, upstream primer (10 μm) 0.8 μl, downstream primer (10 μm) 0.8 μl, and sterilized ultrapure water 14.4 μl, wherein the upstream primer and downstream primer are detailed in Table 1;
[0095] The reaction procedure of the qPCR reaction was as follows: pre-denaturation: 95°C, 3 min, 1 cycle; cycling reaction: 95°C, 10 s; 60°C, 30 s; 40 cycles in total; melting curve: 95°C, 15 s; 60°C, 60 s; 95°C, 15 s;
[0096] After the amplification is completed, the CT values of the standard plasmid solutions of different concentrations and the same volume are measured to obtain. In this embodiment, the CT values corresponding to the standard plasmid solutions of 6 concentrations are shown in Table 2.
[0097] Based on the logarithmic value of the C of the 1 μg / mL standard plasmid, the logarithmic values of the C of the standard plasmid solutions of the same volume and different concentrations were calculated, including:
[0098] The copy number of the quality control fragment contained in the 1 μg / mL standard plasmid is 2.7×10 8 The logarithmic values of C in 4 μl of standard plasmid solutions with concentrations of 100 pg / μl, 50 pg / μl, 25 pg / μl, 12.5 pg / μl, 6.25 pg / μl, and 3.125 pg / μl are shown in Table 2.
[0099] The method of establishing a standard curve of the logarithmic values of CT and C based on the CT values and the logarithmic values of C of standard plasmid solutions of the same volume and different concentrations comprises:
[0100] Based on the CT values and logarithmic values of the above 4 μl standard plasmid solutions with concentrations of 100 pg / μl, 50 pg / μl, 25 pg / μl, 12.5 pg / μl, 6.25 pg / μl, and 3.125 pg / μl, a standard curve of the logarithmic values of CT and C was established, as shown in Table 2. 2 To judge the quality of the standard curve.
[0101] Table 2
[0102]
[0103] In Table 2, y is the CT value and x is the logarithm of C.
[0104] As shown in Table 2, the CT value of the standard plasmid is linearly correlated with the logarithm of C, and R 2 =0.9988, the slope is -3.35, and the amplification efficiency is 99%.
[0105] Substituting the CT values of the qPCR reactions of target immune adjuvants from different production batches into the standard curve to obtain the logarithmic values of the C values of target immune adjuvants from different production batches comprises:
[0106] Using BCG-CpG-DNA of different production batches as amplification templates for qPCR reactions, and using primer pairs to form a reaction system, qPCR amplification is performed. After the amplification is completed, the CT values of the target immune adjuvants of different production batches are measured to obtain. When using BCG-CpG-DNA of different production batches as amplification templates for qPCR reactions, the added mass of the target immune adjuvants of different production batches is ensured to be equal;
[0107] The CT values of target immune adjuvants from different production batches were respectively substituted into the standard curve to obtain the corresponding logarithmic values of C of target immune adjuvants from different production batches.
[0108] Specifically, the method uses BCG-CpG-DNA of different production batches as an amplification template for qPCR reaction, uses primer pairs to form a reaction system, performs qPCR amplification, and measures after the amplification to obtain the CT values of the target immune adjuvants of different production batches, including:
[0109] Take 1 mg / mL of BCG-CpG-DNA adjuvant stock solution from two production batches (production batch A and production batch B), then dilute it 500-fold and use it as a PCR amplification template. At the same time, add 4 μl of it to a 40 μL reaction system as an amplification template (i.e., DNA template) for the qPCR reaction. In this example, only two production batches of BCG-CpG-DNA adjuvant stock solution are selected as an example. Three or more production batches of BCG-CpG-DNA adjuvant stock solution can also be selected;
[0110] The 40 μl reaction system includes: SYBR Green Master Mix (2×) 20 μl, upstream primer (10 μm) 0.8 μl, downstream primer (10 μm) 0.8 μl, and sterilized ultrapure water 14.4 μl, wherein the upstream primer and downstream primer are detailed in Table 1;
[0111] The reaction procedure of the qPCR reaction was as follows: pre-denaturation: 95°C, 3 min, 1 cycle; cycling reaction: 95°C, 10 s; 60°C, 30 s; 40 cycles in total; melting curve: 95°C, 15 s; 60°C, 60 s; 95°C, 15 s;
[0112] After the amplification was completed, the CT values of the target BCG-CpG-DNA adjuvants from different production batches were measured and obtained, as shown in Table 3.
[0113] Specifically, the logarithmic values of C or C of target immune adjuvants produced in different batches are compared to obtain a comparison result; and the quality difference of target immune adjuvants produced in different batches is obtained according to the comparison result, including:
[0114] Substitute the CT values of the two production batches of BCG-CpG-DNA adjuvant into the standard curve formula (1) in Table 2 to obtain the logarithmic values of the C values of the two production batches of BCG-CpG-DNA adjuvant, and then obtain the C values of the two production batches of BCG-CpG-DNA adjuvant;
[0115] The logarithmic values of C of the two production batches of BCG-CpG-DNA adjuvant were subtracted or compared. This example uses the ratio of the C values of the two production batches of BCG-CpG-DNA adjuvant, as shown in Table 3. This example only exemplifies the comparison using the C value, and the logarithmic value of C can also be used for direct comparison.
[0116] Table 3
[0117]
[0118] From the data in Table 3, we can see that the copy number of production batch A is 2.77×10 7 The number of copies in production batch B is 2.74×10 7 copies, all within the standard plasmid linear copy number (3.38×10 6 -1.08×10 7 copies), indicating that the production quality of production batch A and production batch B can be quantitatively measured within this range;
[0119] The copy number ratio between production batch A and production batch B is 1.01, which is within the range of uniformity index values of different production batches (0.8-1.2), indicating that production batches A and production batches B have good uniformity.
[0120] Specifically, each manufacturer that produces the target adjuvant can compare the logarithmic values of C or C of target immune adjuvants produced in different batches according to actual production requirements. The comparison can be done by subtraction or quotient method. The subsequent uniformity index value can also be set according to actual production. If the comparison result of the logarithmic values of C or the comparison result of C of target immune adjuvants produced in different batches is within the range of the uniformity index value, it means that the uniformity of target immune adjuvants produced in different batches is good.
[0121] Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A method for detecting quality differences of immune adjuvants, characterized in that: include: A standard curve of the logarithmic values of CT and C was established based on the CT value and the logarithmic value of C of the qPCR reaction of a standard plasmid containing the quality control fragment of the target immune adjuvant, wherein qPCR reaction represents real-time fluorescent quantitative long-chain polymerase chain reaction, CT value represents the change in the content of the quality control fragment of the target immune adjuvant before and after amplification, and C represents the copy number of the quality control fragment; Substitute the Ct values of the qPCR reactions of target immune adjuvants from different production batches into the standard curve to obtain the logarithmic values of Ct of target immune adjuvants from different production batches; Comparing the logarithmic values of C or C of target immune adjuvants produced in different batches to obtain comparative results; According to the comparison results, the quality difference of the target immune adjuvant produced in different batches is obtained; The standard plasmid is 3558 bp in length, and its specific sequence is shown in Seq_28.
2. The method for detecting the difference in quality of immune adjuvants according to claim 1, characterized in that: The method of establishing a standard curve of the logarithmic values of CT and C based on the CT value and the logarithmic value of C of the qPCR reaction of the standard plasmid containing the quality control fragment of the target immune adjuvant comprises: A standard plasmid is established based on the quality control fragment of the target immune adjuvant, and the copy number C of the quality control fragment contained in 1 μg / mL of the standard plasmid is obtained, that is, the logarithm value of C of the 1 μg / mL standard plasmid is obtained; Determine the primer pair for the qPCR reaction based on the quality control fragment of the target immune adjuvant; Using standard plasmid solutions of the same volume and different concentrations as the amplification template for qPCR reaction, and using primer pairs to form the reaction system, qPCR amplification was performed. After the amplification was completed, the CT values of the standard plasmid solutions of the same volume and different concentrations were measured. The logarithmic values of C of the standard plasmid solutions of the same volume and different concentrations were calculated based on the logarithmic value of C of the 1 μg / mL standard plasmid. A standard curve of the logarithmic values of CT and C was established based on the CT values and logarithmic values of standard plasmid solutions of the same volume and different concentrations.
3. The method for detecting the quality difference of immune adjuvant according to claim 2, characterized in that: The method of establishing a standard plasmid based on the quality control fragment of the target immune adjuvant and obtaining the copy number C of the quality control fragment contained in 1 μg / mL of the standard plasmid, that is, obtaining the logarithmic value of C of the 1 μg / mL standard plasmid, comprises: According to the immunologically active motif of the target immune adjuvant, a gene fragment containing the immunologically active motif is selected as a quality control fragment; A standard plasmid is established based on the quality control fragment, and the copy number C of the quality control fragment contained in 1 μg / mL of the standard plasmid is obtained, that is, the logarithmic value of C of the 1 μg / mL standard plasmid is obtained.
4. The method for detecting the quality difference of immune adjuvants according to any one of claims 1 to 3, characterized in that: Substituting the CT values of the qPCR reactions of target immune adjuvants from different production batches into the standard curve to obtain the logarithmic values of the C values of target immune adjuvants from different production batches comprises: Using target immune adjuvants from different production batches as amplification templates for qPCR reactions, using primer pairs to form a reaction system, performing qPCR amplification, and measuring after the amplification to obtain CT values of target immune adjuvants from different production batches. When using target immune adjuvants from different production batches as amplification templates for qPCR reactions, ensure that the added mass of target immune adjuvants from different production batches is equal. The CT values of target immune adjuvants from different production batches were respectively substituted into the standard curve to obtain the corresponding logarithmic values of C of target immune adjuvants from different production batches.
5. The method for detecting the quality difference of immune adjuvants according to claim 4, characterized in that: The reaction procedure of the qPCR reaction of the target immune adjuvants of different production batches is the same as the reaction procedure of the qPCR reaction of the standard plasmids of different concentrations and the same volume.
6. The method for detecting the quality difference of immune adjuvants according to claim 5, characterized in that: The reaction system for qPCR reaction of the target immune adjuvants of different production batches is the same as the reaction system for qPCR reaction of the standard plasmids of different concentrations and the same volume.
7. The method for detecting quality differences of immune adjuvants according to claim 5, characterized in that: The target immune adjuvant is BCG-CpG-DNA adjuvant, wherein BCG represents Bacillus Calmette-Guérin.
8. The method for detecting quality differences of immune adjuvants according to claim 7, characterized in that: The primer pairs for the qPCR reaction are any three or more primer pairs among primer pair 1, primer pair 2, primer pair 3, primer pair 4, primer pair 5, primer pair 6, primer pair 7, primer pair 8 and primer pair 9.
9. The method for detecting quality differences of immune adjuvants according to claim 8, characterized in that: The primer pair 1 includes an upstream primer 1 and a downstream primer 1, the sequence of the upstream primer 1 is shown in Seq_1, and the sequence of the downstream primer 1 is shown in Seq_2; The primer pair 2 includes an upstream primer 2 and a downstream primer 2, the sequence of the upstream primer 2 is shown in Seq_3, and the sequence of the downstream primer 2 is shown in Seq_4; The primer pair 3 includes an upstream primer 3 and a downstream primer 3, the sequence of the upstream primer 3 is shown in Seq_5, and the sequence of the downstream primer 3 is shown in Seq_6; The primer pair 4 includes an upstream primer 4 and a downstream primer 4, the sequence of the upstream primer 4 is shown in Seq_7, and the sequence of the downstream primer 4 is shown in Seq_8; The primer pair 5 includes an upstream primer 5 and a downstream primer 5, the sequence of the upstream primer 5 is shown in Seq_9, and the sequence of the downstream primer 5 is shown in Seq_10; The primer pair 6 includes an upstream primer 6 and a downstream primer 6, the sequence of the upstream primer 6 is shown in Seq_11, and the sequence of the downstream primer 6 is shown in Seq_12; The primer pair 7 includes an upstream primer 7 and a downstream primer 7, the sequence of the upstream primer 7 is shown in Seq_13, and the sequence of the downstream primer 7 is shown in Seq_14; The primer pair 8 includes an upstream primer 8 and a downstream primer 8, the sequence of the upstream primer 8 is shown in Seq_15, and the sequence of the downstream primer 8 is shown in Seq_16; The primer pair 9 includes an upstream primer 9 and a downstream primer 9. The sequence of the upstream primer 9 is shown in Seq_17, and the sequence of the downstream primer 9 is shown in Seq_18.
10. The method for detecting quality differences of immune adjuvants according to any one of claims 1 to 3, characterized in that: The reaction procedure of the qPCR reaction was as follows: pre-denaturation: 95°C, 3 min, 1 cycle; cycling reaction: 95°C, 10 s; 60°C, 30 s; 40 cycles in total; melting curve: 95°C, 15 s; 60°C, 60 s; 95°C, 15 s.
Citation Information
Patent Citations
Detection and quantification of target nucleic acid sequence of a microorganism
CN108603236A
Primer pair and application thereof in BCG-CpG-DNA adjuvant quality control method
CN115948525A