A DNA tetrahedron complex and its use in preparing a drug for treating psoriasis

Abstract

The present invention discloses a DNA tetrahedron complex and its use in preparing a drug for treating psoriasis, belonging to the field of medical technology. The present invention autonomously assembles TA, tFNA, and siRNA that silences NF-κB into a controllable composite (STT) for responsive and precise release of siRNA. The STT complex of the present invention has a simple synthesis process, ensures the stability of siRNA during delivery, has efficient transdermal delivery and efficient cellular uptake, and can control the release of siRNA drugs to successfully reach the cytoplasm to exert their effects, providing a new strategy for the treatment of psoriasis and having great potential to become a new psoriasis drug.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular relates to a DNA tetrahedron complex and use thereof in preparing a drug for treating psoriasis. Background Art

[0002] As a barrier between the internal and external environments, the skin is not only the core of the host's immune defenses but also the first line of defense against external threats. Dysfunction of the skin's immune system and its barrier function underlies common chronic immune-inflammatory diseases such as psoriasis and atopic dermatitis. Psoriasis can cause severe pain, disfigurement, and disability, making it one of the most debilitating skin diseases, affecting over 2-3% of the global population. Psoriasis results from the interaction between overproliferating keratinocytes (KCs) and immune cells, involving activation of innate immunity and subsequent adaptive immune responses. KCs help initiate skin inflammation, then release a large number of inflammatory mediators, activating dendritic cells (DCs) and T cells, causing immune dysregulation and amplifying inflammation. Psoriasis is characterized by its difficulty in treatment and frequent relapses. Currently, there is no medication that can completely cure psoriasis.

[0003] Traditional topical treatments, such as corticosteroids, have limited efficacy and side effects. Oral medications, such as methotrexate (MTX) and cyclosporine A (CSA), can be severely hepatotoxic and even teratogenic. The emergence of biologics has achieved remarkable results. Studies of immune-targeted biologic therapies have revealed that TNF-α, IL-23, and IL-17 play a more critical role in the pathogenesis of psoriasis than other cytokines, with a synergistic effect between TNF and IL-17 being particularly well-established. Biologic inhibitors of TNF-α and IL23 / IL17 have also become effective first-line interventions in recent years. Simultaneous blockade of TNF and IL-17 may offer greater efficacy than targeting either cytokine alone. NF-κB, a direct transcriptional activator of TNF and IL-17 and a key regulator of the immune response, could potentially expand the patient population. However, the associated risks of infection, high cost, and high immunogenicity of biologics have limited their development.

[0004] Nucleic acid-based RNAi therapies, due to their highly specific binding to molecular targets, offer promise as safer, more precise, and more personalized medicine. However, since RNAi's initial public disclosure, only four siRNAs have been approved by the USFDA, all of which are administered by injection. However, RNAi therapies have drawbacks, including rapid enzymatic degradation of siRNAs, rapid clearance from the circulation, poor cellular uptake, poor drug delivery targets, and the risk of pain and infection associated with injections.

[0005] To this end, transdermal gene therapy has been introduced, offering significant advantages due to its painlessness and avoidance of metabolic clearance, enzymatic degradation, and circulatory clearance. Furthermore, the skin is a highly immunogenic site, housing a large number of immune cells such as keratinocytes, dendritic cells, macrophages, and T cells, making it a natural target for immunotherapy. However, the skin's barrier function and unique "bricks-and-mortar" structure pose significant challenges to transdermal gene delivery. Various physical and chemical methods have been investigated for transdermal drug delivery, such as liposomes, peptides, microneedles, iontophoresis, and electroporation, all of which are currently commonly used. Chemical delivery is far less efficient than physical delivery. However, genes delivered by physical methods are still hindered by tight cell junctions and cannot diffuse. Furthermore, issues of cellular uptake and gene stability remain unresolved.

[0006] Therefore, developing smart nanocarriers that can be loaded / unloaded for transdermal delivery will minimize the drawbacks of RNAi therapy. Such smart carriers must face the following challenges: (1) ensuring the stability of siRNA during delivery; (2) efficient transdermal delivery; (3) efficient cellular uptake; and (4) controlled release of siRNA drugs to successfully reach the cytoplasm and exert their effects.

[0007] Functional nucleic acid nanomaterials (FNANs), with their sequence editability and high biocompatibility, offer advantages over other organic and inorganic carriers for gene and drug delivery. Genes and responsive structures can be successfully assembled into a single entity within the FNAN structure through unique covalent bonding or molecular recognition. This structural integrity enhances the stability of previously single gene fragments. The responsive structure allows for programmed gene release, increasing utilization.

[0008] However, compared to linear FNAs, framework-based FNAs can leverage their unique spatial structure to easily cross cell membrane barriers and possess high cellular uptake. Tetrahedral framework nucleic acids (tFNAs) have particularly attracted attention for their remarkable cellular uptake and tissue penetration abilities. Compared to other framework nucleic acids, tFNAs offer a simpler synthesis procedure and more stable structures. Studies have shown that drug size, charge, and morphology significantly influence transdermal penetration, with size dependence being greater than shape dependence. Compared to tFNAs with a side length of 37 bp and smaller, tFNAs with a side length of 21 bp exhibit the highest accumulation in cells and skin tissue, even penetrating the dermis. tFNAs can be loaded with microRNA or siRNA for therapeutic effects through simple sticky end conjugation and exhibit a certain degree of stability. However, they lack intelligent and controllable gene loading and unloading, providing only very limited protection and the risk of off-target effects. Furthermore, the size of the complexes synthesized in this manner increases, making cell and tissue penetration more challenging.

[0009] Lin Yunfeng and others have confirmed the anti-inflammatory, antioxidant and immune tolerance effects of tFNA.

[0010] Tannic acid (TA), a natural polyphenol, has attracted attention due to its anti-inflammatory, pro-apoptotic, and antioxidant effects.

[0011] The effects of DNA tetrahedral framework nucleic acids on psoriasis, as well as the effects of the complex of DNA tetrahedral framework nucleic acids, tannic acid, and siRNA that silences NF-κB, have not been reported yet. Summary of the Invention

[0012] The problem to be solved by the present invention is to provide a DNA tetrahedron complex and use thereof in preparing a medicine for treating psoriasis.

[0013] The present invention provides a DNA tetrahedron complex, which is a complex formed by mixing a DNA tetrahedron framework nucleic acid containing siRNA for silencing NF-κB and tannic acid;

[0014] The DNA tetrahedral framework nucleic acid containing siRNA for silencing NF-κB is formed by mixing the DNA tetrahedral framework nucleic acid and the siRNA for silencing NF-κB;

[0015] The molar ratio of the DNA tetrahedral framework nucleic acid to the siRNA for silencing NF-κB is 1:(1-4);

[0016] The mixing ratio of the DNA tetrahedral framework nucleic acid containing siRNA for silencing NF-κB and tannic acid is 1000 nM: (12.5-200) μg / mL.

[0017] The DNA tetrahedral framework nucleic acid is formed by four single-stranded DNAs through base complementary pairing, and the sequences of the four single-stranded DNAs are shown in SEQ ID NOs. 1 to 4;

[0018] The forward sequence of the siRNA that silences NF-κB is shown in SEQ ID NO.5, and its reverse sequence is shown in SEQ ID NO.6; or the forward sequence of the siRNA that silences NF-κB is shown in SEQ ID NO.7, and its reverse sequence is shown in SEQ ID NO.8.

[0019] The mixing ratio of the DNA tetrahedron of the siRNA silencing NF-κB and tannic acid is 1000 nM:50 μg / mL.

[0020] The DNA tetrahedral framework nucleic acid is prepared by the following method: four DNA single strands are added to TM buffer, pH = 8.0, maintained at 95°C for 10 minutes, and then rapidly cooled to 4°C and maintained for more than 20 minutes.

[0021] The DNA tetrahedral framework nucleic acid containing siRNA for silencing NF-κB is prepared by the following method: the DNA tetrahedral framework nucleic acid and the siRNA for silencing NF-κB are mixed and incubated at room temperature;

[0022] The mixed concentration ratio of the DNA tetrahedral framework nucleic acid and the siRNA for silencing NF-κB is 1:(1-5).

[0023] The incubation time is not less than 30 min;

[0024] The mixing concentration ratio of the DNA tetrahedral framework nucleic acid and the siRNA for silencing NF-κB is 1:4.

[0025] The present invention also provides a method for preparing the above-mentioned composite, which comprises the following steps:

[0026] Add tannic acid to the DNA tetrahedral framework nucleic acid containing siRNA silencing NF-κB and shake and mix evenly;

[0027] The mixing ratio of the DNA tetrahedral framework nucleic acid containing siRNA for silencing NF-κB and tannic acid is 1000 nM:50 μg / mL.

[0028] The present invention also provides use of the complex in preparing anti-inflammatory drugs.

[0029] The present invention also provides use of the complex in preparing a medicament for treating psoriasis.

[0030] The present invention also provides an anti-inflammatory drug, which is prepared by using the above-mentioned complex as an active ingredient and adding pharmaceutically acceptable auxiliary ingredients.

[0031] In summary, the purpose of the present invention is to prepare a DNA tetrahedron complex and its use in the preparation of a drug for treating psoriasis. The present invention autonomously assembles TA, tFNA, and siRNA that silences NF-κB into a controllable composite whole (STT) for responsive and precise release of siRNA. The STT complex of the present invention has a simple synthesis process, ensures the stability of siRNA during delivery, has efficient transdermal delivery and efficient cellular uptake, and can control the release of siRNA drugs to successfully reach the cytoplasm to exert their effects; the STT complex of the present invention has excellent anti-inflammatory effects. TA and tFNA in the STT complex of the present invention, and siRNA that silences NF-κB play a synergistic role, successfully blocking the inflammatory cycle of psoriasis, rebuilding the skin's normal immune defense, and benefiting more patients. It provides a new strategy for the treatment of psoriasis and has great potential to become a new drug for psoriasis.

[0032] Obviously, based on the above contents of the present invention, according to common technical knowledge and customary means in this field, without departing from the above basic technical ideas of the present invention, other various forms of modifications, replacements or changes can be made.

[0033] The following further describes the above content of the present invention in detail through specific embodiments in the form of examples. However, this should not be construed as limiting the scope of the above subject matter of the present invention to the following examples. All technologies implemented based on the above content of the present invention fall within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Schematic diagram of the synthesis and characterization of the siRNA-tFNA@TA(STT) complex. a, Schematic diagram of the synthesis; b, Encapsulation efficiency; c, PAGE gel results; d, UV spectroscopy analysis.

[0035] Figure 2 : Size and particle size of STT. a, Atomic force microscopy; b, Particle size analysis.

[0036] Figure 3 Cellular uptake and lysosomal escape analysis of tFNA, siRNA, ST, and STT. a, Flow cytometric analysis of material uptake; b, Confocal microscopy of material uptake; c, Colocalization analysis of material and lysosomes; d, Agarose gel analysis of the acid-responsive, step-by-step decomposition of STT; e, Schematic diagram showing the entire process of STT escaping from lysosomes after cytosolic entry.

[0037] Figure 4 : STT inhibits the expression of NF-κB p65 in keratinocytes and DCs. Student's t-test was used for statistical analysis. Statistical analysis: *p < 0.05, **p < 0.01, ***p < 0.001.

[0038] Figure 5 Figure 2: Expression of inflammatory factors. Data are expressed as mean ± SD (n = 3). Student's t-test was used for statistical analysis. Statistical analysis: *p < 0.05, **p < 0.01, ***p < 0.001.

[0039] Figure 6 : Animal experimental procedures, transdermal effects and treatment results.

[0040] Figure 7 Skin thickness analysis and NF-κB p65 inhibition effect. a, HE staining; b, IHE staining of NF-κB p65; cf, PASI score to evaluate the therapeutic effect of STT. DETAILED DESCRIPTION

[0041] The raw materials and equipment used in the present invention are all known products and are obtained by purchasing commercially available products.

[0042] Example 1 Synthesis and Identification of the Complex siRNA-tFNA@TA(STT) of the Present Invention

[0043] 1. Synthesis of siRNA-tFNA(ST)

[0044] Four single-stranded DNA strands with sticky ends (ssDNA: S1, S2, S3, and S4) were dissolved in TM buffer (10 mM Tris-HCl, 50 mM MgCl2, pH 8.0) to a final concentration of 1000 nM. After thorough mixing, the mixture was rapidly heated to 95°C for 10 minutes, then rapidly cooled to 4°C and maintained for at least 20 minutes to produce the tetrahedral framework nucleic acid (tFNA). The tFNA was then mixed with siRNA (siRNA) with sticky ends at a concentration ratio of 1:4 and incubated at room temperature for 30 minutes to obtain siRNA-tFNA (ST).

[0045] (1) The sequences of the four single-stranded DNAs (5′→3′) are as follows:

[0046] S1 (SEQ ID NO. 1):

[0047] TTGACCTGTGAATTATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA(SEQ ID NO.1)

[0048] S2 (SEQ ID NO. 2):

[0049] TTGACCTGTGAATTACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG(SEQ ID NO.2)

[0050] S3 (SEQ ID NO. 3):

[0051] TTGACCTGTGAATTACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC(SEQ ID NO.3)

[0052] S4 (SEQ ID NO. 4):

[0053] TTGACCTGTGAATTACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG(SEQ ID NO.4)

[0054] (2) The sequence of siRNA (5′→3′) is as follows:

[0055] siRNA1(mouse):

[0056] siRNA1 forward sequence:

[0057] SEQ ID NO.5: GCGACAAGGUGCAGAAAGAdTdT

[0058] siRNA1 reverse sequence:

[0059] SEQ ID NO.6: UUCACAGGUCAAUCUUUCUGCACCUUGUCGCdTdT siRNA2 (human):

[0060] siRNA2 forward sequence

[0061] SEQ ID NO.7: CCAUCAACUAUGAUGAGUUdTdT

[0062] siRNA1 reverse sequence:

[0063] SEQ ID NO.8:UUCACAGGUCAAAACUCAUCAUAGUUGAUGGdTdT

[0064] 2. Synthesis of the STT Complex

[0065] Tannic acid was added to ST (1000nM) to make the concentration of tannic acid (12.5, 25, 50, 100, 200) μg / mL and evenly vortexed at room temperature for a few seconds to synthesize STT. By measuring the encapsulation efficiency, it was found that at 50 μg / mL, the encapsulation efficiency had begun to saturate ( Figure 1 b).

[0066] Schematic diagram of the synthesis of complex STT Figure 1 As shown in a.

[0067] 3. STT Identification of Complexes and Identification Results

[0068] After the synthesis of tetrahedral backbone nucleic acid, 8% PAGE gel results showed that ssDNA was gradually loaded into tFNA, and finally siRNA was successfully loaded onto tFNA to form ST ( Figure 1c) Specifically, the increase in ST bp relative to tFNA bp is exactly the sum of the bp of the four siRNAs. The Cy5-labeled siRNA (red) and the Gelred-labeled DNA (blue) essentially overlap, demonstrating the successful loading of the siRNA onto the tFNA.

[0069] UV spectrum analysis shows that the formed STT has a significant peak shift relative to TA, from the black arrow to the purple arrow ( Figure 1 d), indicating that TA and ST form STT in the present invention, rather than existing as free TA alone.

[0070] Atomic force microscopy was used to measure the shape of the materials. It can be seen that the shape and size of STT and tFNA are consistent, showing uniformly distributed triangular particles ( Figure 2 a).

[0071] Further dynamic light scattering confirmed the size of the materials, which also showed that STT and ST had similar sizes of 10-20 nm ( Figure 2 b).

[0072] Example 2 Synthesis and Identification of the Complex siRNA-tFNA@TA(STT) of the Present Invention

[0073] 1. Synthesis of siRNA-tFNA(ST)

[0074] The synthesis of siRNA-tFNA (ST) was the same as that in Example 1.

[0075] 2. Synthesis of the STT Complex

[0076] Tannic acid was added to ST (1000 nM) to make the tannic acid concentration 50 μg / mL, and the mixture was evenly vortexed for a few seconds at room temperature to synthesize STT.

[0077] 3. STT Identification of Complexes and Identification Results

[0078] Same as Example 1.

[0079] Example 3 Synthesis of the siRNA-tFNA (ST) Complex

[0080] The synthesis method of siRNA-tFNA (ST) is the same as that in Example 1.

[0081] The present invention will be further described below in the form of experimental examples.

[0082] Experimental Example 1 Cell and Animal Model Experiments

[0083] 1. Experimental Methods (1) Construction of psoriasis cell and animal models and drug efficacy verification experiments

[0084] 1. Construction of a keratinocyte psoriasis inflammation model and drug efficacy verification experiments

[0085] Keratinocyte (HaCat) inflammation model: HaCat cells in the logarithmic growth phase were divided into 7 groups: According to literature review, in vitro models of psoriasis are mostly established by stimulating HaCat with cytokines. Currently, the most common method is to stimulate HaCat with TNF-α (tumor necrosis factor).

[0086] (1) Control: HaCat cells were cultured under conventional culture conditions;

[0087] (2) TNF-α: HaCat cells were incubated with 20 ng / mL TNF-α (tumor necrosis factor, the same below) for 12+24 h;

[0088] (3) tFNA: HaCat cells were incubated with 20 ng / mL TNF-α for 12 h, followed by culture with tFNA (250 nM) and TNF-α (20 ng / mL) for 24 h;

[0089] (4) siRNA: HaCat cells were incubated with 20 ng / mL TNF-α for 12 h, followed by incubation with siRNA (1000 nM) and TNF-α (20 ng / mL) for 24 h;

[0090] (5) ST: HaCat cells were incubated with 20 ng / mL TNF-α for 12 h, and then cultured with ST (250 nM) and TNF-α (20 ng / mL) for 24 h; ST was prepared according to the method of Example 3.

[0091] (6) TA: HaCat cells were incubated with 20 ng / mL TNF-α for 12 h, followed by culture with TA (12.5 μg / mL) and TNF-α (20 ng / mL) for 24 h;

[0092] (7) STT: HaCat cells were incubated with 20 ng / mL TNF-α for 12 h, and then cultured with STT (ST: 250 nM, TA: 12.5 μg / mL) and TNF-α (20 ng / mL) for 24 h; STT was prepared according to the method of Example 4 and diluted 4 times.

[0093] 2. Construction of a dendritic cell (DC) psoriasis inflammation model and drug efficacy verification experiments

[0094] Dendritic cell (DC) inflammation model: DC cells in the logarithmic growth phase were divided into 7 groups:

[0095] LPS is often used to establish DCs inflammation models in vitro to stimulate DCs maturation and can be used to analyze the effects of drugs on DCs anti-maturation.

[0096] (1) Control: DC cells were cultured under conventional culture conditions;

[0097] (2) LPS: DC cells were incubated with 100 ng / mL LPS (lipopolysaccharide, the same below) for 24 h;

[0098] (3) tFNA: DC cells were pre-incubated with tFNA (250 nM) for 4 h and then cultured with LPS (100 ng / mL) for 24 h;

[0099] (4) siRNA: DC cells were pre-incubated with siRNA (1000 nM) for 4 h and then cultured with LPS (100 ng / mL) for 24 h;

[0100] (5) ST: DC cells were pre-incubated with ST (250 nM) for 4 h and then cultured with LPS (100 ng / mL) for 24 h; ST was prepared according to the method of Example 3.

[0101] (6) TA: DC cells were pre-incubated with TA (12.5 μg / mL) for 4 h and then cultured with LPS (100 ng / mL) for 24 h;

[0102] (7) STT: DC cells were pre-incubated with STT (ST: 250 nM, TA: 12.5 μg / mL) for 4 h and then cultured with LPS (20 ng / mL) for 24 h; STT was prepared according to the method of Example 4 and diluted 4-fold.

[0103] 3. Construction of psoriasis animal model and drug efficacy verification experiment

[0104] All animal care and experiments were performed in accordance with the requirements of the National Laboratory Animal Use Law (China) and approved by the Institutional Animal Care and Ethics Committee of Sichuan University.

[0105] The hair on the back skin of male 5-6 week old Balb / c mice (Dashuo, Sichuan) was shaved with a razor (approximately 2 cm × 2 cm). After the mice were fed normally for 1 day to restore the stratum corneum, 80 mg of imiquimod IMQ cream (IMQ: 1 mg / cm2) was applied to the skin every day for 6 hours except for the blank control group (control: no special treatment). 2 ) and continue for 6 days. Gently massage the skin until the cream is absorbed. After 6 hours, wash the skin with saline and apply the medicine for treatment.

[0106] Blank control group (control): smear the mixture of normal saline and cream;

[0107] Except for the blank control group (control), the other groups were given IMQ cream 6 hours later every day.

[0108] IMQ control group: Apply a saline-cream mixture. siRNA group: Apply 100 μL of 4000 nM siRNA mixed with an equal volume of moisturizing petrolatum cream to the IMQ-treated skin. ST group: Apply 100 μL of 1000 nM ST mixed with an equal volume of moisturizing petrolatum cream to the IMQ-treated skin. (ST was prepared according to the method in Example 3).

[0109] DEX group: Medical dexamethasone cream containing 90 μg of dexamethasone was applied to IMQ-treated skin. tFNA group: 100 μL of 1000 nM tFNA was mixed with an equal volume of moisturizing petrolatum cream and applied to IMQ-treated skin. TA group: 100 μL of 50 μg / mL TA was mixed with an equal volume of moisturizing petrolatum cream and applied to IMQ-treated skin. STT group: 100 μL of 1000 nM STT (ST: 1000 nM, TA: 50 μg / mL) was mixed with an equal volume of moisturizing petrolatum cream and applied to IMQ-treated skin. STT was prepared according to the method in Example 2.

[0110] The above procedure was performed once a day for 6 consecutive days. The Psoriasis Area and Severity Index (PASI) scoring method was used to evaluate scaling, erythema, and epidermal thickening as indicators, and points were added to evaluate the improvement effect of the test preparation on psoriasis symptoms.

[0111] On day 7, blood was collected, and the animals were sacrificed and the skin at the treated sites was excised. The tissues were fixed with 4% paraformaldehyde, embedded in paraffin, sectioned, and stained with hematoxylin and eosin (H&E) and immunohistochemically. Pathological changes in the skin tissues were observed under a microscope.

[0112] (II) CCK8 cytotoxicity assay

[0113] HaCat cells were cultured in groups in 96-well plates (5×10 3 / hole), and group them according to the method of part 1 in part (I).

[0114] The culture medium was removed, and the cells were rinsed once with PBS. Serum-free DMEM culture medium and 10% (v / v) CCK-8 solution were then added. After incubation at 37° C. for 2 hours, the OD value of the samples was detected at a wavelength of 450 nm.

[0115] (III) Cellular uptake of tFNA, siRNA, ST, and STT

[0116] HaCat cells were seeded in 6-well plates (2×10 5 / well) and 12-well plates (2×10 5 The cells were cultured in 4% paraformaldehyde (4% paraformaldehyde) for 24 h, then incubated with 250 nM Cy5-tFNA, Cy5-siRNA, Cy5-ST, and Cy5-STT labeled with the fluorescent dye Cy5 for 24 h, rinsed with PBS in 6-well plates, and collected in flow tubes. Further flow cytometry analysis was used to obtain cell entry results of a flow cytometer (FC500 Beckman, IL, USA). The 12-well plate cells were washed 3 times with PBS and fixed with cold paraformaldehyde for 15 minutes. After washing again, they were stained with DAPI for 10 minutes. Finally, the cell slides were observed under an ultra-high resolution two-photon laser confocal microscope (N-SIM, Nikon, Tokyo, Japan).

[0117] (IV) Lysosomal escape experiment

[0118] Once HaCat cells were seeded into 12-well plates and reached stable attachment, they were incubated with culture medium containing 250 nM Cy5-tFNA, Cy5-siRNA, Cy5-ST, and Cy5-STT for 24 hours. The culture medium was aspirated, washed three times with PBS, and then the cells were incubated with a 1640 mL RPMI medium mixed with a 1000:1 ratio of LysoTracker Green DND-26, Invitrogen, Carlsbad, CA, USA, and incubated for 1 hour. After three washes with PBS, the cells were incubated with Hochest dye (Hochest 33342, KeyGEN Biotechnology, Jiangsu, China) diluted in culture medium (1:100) for 10 minutes. After 10 minutes, all cells were gently washed three times with cold PBS before confocal fluorescence imaging. Finally, the cell slides were observed under a super-resolution two-photon laser confocal microscope.

[0119] (5) Westrenblotting

[0120] Total protein was extracted by cell lysis, mixed with 5× loading buffer, and heated at 100°C for 10 minutes. Samples from each group were processed by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (PAGE) and transferred to polyvinylidene fluoride membranes. These membranes were soaked in 5% skim milk at 37°C for 1 hour and then immersed in primary antibodies at 4°C overnight. The membranes were washed three times with TBST (0.1% Tween-20, 10mM Tris-base, and 100mM NaCl; pH 7.5) and incubated with secondary antibodies (1:2000; Abcam) for 1 hour. Bands were then visualized using a gel-blot imaging system and quantified using ImageJ software.

[0121] 2. Experimental Results

[0122] (I) STT uptake by keratinocytes and lysosomal escape of STT

[0123] Figure 3 a and Figure 3 As shown in the results of b, siRNA is hardly taken up by keratinocytes, while other materials containing tFNA structures can be taken up by cells and show high cytosolic efficiency. Furthermore, in order to verify whether STT can escape in the acidic lysosomal environment as theoretically explored, co-localization analysis of lysosomes and materials was performed. Figure 3 As shown in c, all materials are labeled with Cy5, and the lysosomal probe is labeled with green fluorescence ( Figure 3 c (row 2) shows that the siRNA fluorescence completely overlaps with the lysosome, while some Cy5 fluorescence from tFNA does not overlap with the lysosome. ST also shows the same pattern. Meanwhile, STT shows that the majority of the fluorescence does not overlap with the lysosome, fully confirming its lysosomal escape.

[0124] pH-responsive decomposition is the basis for lysosomal escape. In addition, the acid response of STT was explored by agarose gel running (AGE). Figure 3 d(i) shows the gel images of STT after being kept in RNase H solution (500 U / mL, pH 5.5) for 0, 1, 3 and 6 hours ( Figure 3 d(i)) shows the decomposition of STT. Starting from 3 hours, STT showed significant decomposition. To more accurately confirm that the decomposition of STT originated from TA, further AGE analysis was performed. STT and ST were incubated with RNase H for 1 hour. When the concentration of RNase H reached 50 U / mL, ST began to decompose (arrows), while STT did not decompose even in 500 U / mL RNase H ( Figure 3 d(ii)). Therefore, the decomposition of STT is caused by the degradation of TA in an acidic environment. Under normal pH, the RNase H response sequence of STT is not directly exposed to RNase H under the wrapping of TA, so STT will not decompose. Figure 3 e. Lysosomal acid response is shown in the figure. After being taken up by cells through endocytosis, STT is more easily transported into the low-pH lysosomes. Then, in the acidic environment, TA is degraded. TA degradation products include gallic acid (GA), ellagic acid (EA), and pyrogallol (PG). This releases ST inside. After ST enters the cytoplasm, it releases siRNA in response to RNase H.

[0125] The experimental results show that the TA of the present invention, tFNA, and siRNA are autonomously assembled into a controllable composite whole (STT), which can be used for responsive and precise release of siRNA in an acidic environment.

[0126] (II) Results of in vitro and in vivo cellular psoriasis efficacy validation

[0127] 1. Inhibition of NF-κB by STT

[0128] Keratinocytes are a key and direct target of TNF signaling in human psoriasis. Anti-tumor necrosis factor (anti-TNF) therapy is currently one of the most effective treatments for psoriasis. NF-κB inhibition can successfully interfere with TNF-TNFR signaling, thereby altering skin inflammation. Many psoriasis-associated genes are also present in the TNF-NF-κB signaling pathway. Monitoring TNF signaling is crucial for maintaining normal physiological function, host defense, and tissue regeneration. Therefore, investigating the changes in HaCat inflammation caused by silencing NF-κB p65 is crucial for a better understanding of the pathogenesis of psoriasis.

[0129] Figure 4 Figures 4a and 4b demonstrate STT's superior silencing effect on NF-κB p65, visually observing the translocation of p65 to the nucleus following TNF activation via immunofluorescence. siRNA alone exhibited a low silencing effect. STT exhibited a stronger protein-specific inhibition of NF-κB p65 compared to ST. Based on the present research, STT demonstrated a more pronounced NF-κB p65 gene and protein silencing effect than ST through lysosomal escape and the synergistic anti-inflammatory effects of TA, thereby inhibiting the expression of TNF-α, IL-6, and IL-1β.

[0130] The use of STT helps to block the inflammatory signals transmitted to DC by HaCats, thereby avoiding DC differentiation and amplification of inflammation. Therefore, the present invention further verifies the silencing effect of STT on NF-κB p65 in DC. Figure 4 b and 4c, consistent with the keratinocytes above, we can see that STT inhibits NF-κBp65 protein.

[0131] The experimental results show that the STT of the present invention exhibits a silencing effect on NF-κB p65, avoids DC differentiation and amplification of inflammation, and exhibits a silencing effect of NF-κB p65 that is much higher than that of simple siRNA.

[0132] (3) STT reduces the expression of inflammatory factors

[0133] The above has confirmed that ST inhibits the NF-κB p65 signaling pathway. The present invention further verified the above results by western blotting. STT treatment reduces the secretion of TNF-α, IL-6, IL-1β and IL-12 by DC in the innate immune system. This is achieved by silencing the gene and protein of NF-κB p65 and reducing the phosphorylation of NF-κB p65. Figure 5 a and 5b).

[0134] Experimental results show that STT can inhibit the production of inflammatory factors by silencing the expression of NF-κB p65. STT can significantly reduce the release of inflammatory factors and has a significant anti-inflammatory effect.

[0135] (IV) Results of animal experimental efficacy verification

[0136] Psoriasis is a recurring and incurable skin disease that requires long-term treatment, with topical treatment being the preferred treatment. Although the skin's barrier structure creates obstacles for drug transport, the success of this invention demonstrates that STT has significant transdermal efficiency ( Figure 6 b).

[0137] In the IMQ control group, psoriasis symptoms in mice showed a parabolic progression over time. Lesions worsened from days 1 to 5, but began to subside by day 6, ultimately resolving over time. This confirmed the successful establishment of a mouse psoriasis model using IMQ.

[0138] By applying a cream containing therapeutic drugs to the skin surface every day and staining frozen sections on the sixth day, it can be clearly seen that Cy5 labeled with various materials enters the deep layer of the skin. Figure 5 As can be seen in b, STT has the best transdermal effect and the most uniform distribution.

[0139] Imiquimod (IMQ)-induced psoriasis in mice was used to investigate whether STT could improve the inflammatory microenvironment of psoriasis by inhibiting NF-κB p65 expression. IMQ-induced skin inflammation typically peaks on days 4-5 and remains elevated for 6-7 days.

[0140] like Figure 5 As shown in a, 80 mg of medical IMQ cream (1 mg / cm 2 , 2cm*2cm). Six hours later, after washing the skin, a cream containing 100µL of STT (ST: 1000nM, 100µL; TA: 50µg / mL) was applied (STT group) and covered with a medical dressing. Following IMQ application, the skin began to show noticeable erythema, wrinkles, desquamation, and thickening on the second day. PASI increased rapidly after IMQ application, reaching a peak on the fifth day.

[0141] STT has significantly reduced erythema and desquamation since the fourth day. Figure 6 c It can be seen that after 7 days of drug treatment, the skin of the STT group was very close to that of the blank control group, and the groups that applied siRNA, ST, tFNA, and TA alone had obvious skin wrinkles and thickening, indicating that the STT of the present invention has an excellent therapeutic effect on psoriasis, and the STT of the present invention has a synergistic effect relative to individual siRNA, tFNA, and TA.

[0142] At the same time, in the local treatment of psoriasis, glucocorticoids are widely considered to be the first-line anti-inflammatory drugs. Therefore, 90 μg dexamethasone (Dex) acetate cream was selected as the positive drug control group. After IMQ treatment, the skin began to show obvious erythema, wrinkles, desquamation and skin thickening on the second day. The severity of skin inflammation was recorded using the Psoriasis Area and Severity Index (PASI) for 6 consecutive days. After the application of IMQ, the PASI score increased rapidly and reached a peak on the fifth day. STT significantly reduced the formation of erythema and desquamation starting from the fourth day. There was a significant difference between the skin scores of the STT group and the ST group on the sixth day, and the effect of the Dex group was significantly worse than that of the STT group ( Figure 7 c-7f).

[0143] Then, hematoxylin and eosin (H&E) staining of the mouse skin showed that STT treatment reduced epidermal thickening, acanthosis, hyperkeratosis and club ridges ( Figure 7 a).

[0144] The mechanism by which STT treats psoriasis is to silence the NF-κB p65 gene, thereby affecting its transcription and ultimately reducing NF-κB p65 protein expression. In vitro studies have confirmed that STT can successfully inhibit the expression of NF-κB p65 in DCs and HaCats. Therefore, protein expression analysis of NF-κB p65 in psoriatic mice is essential for explaining the therapeutic effects of STT. Through IHC analysis of NF-κB p65, it was found that after IMQ successfully induced psoriasis, NF-κB p65 was translocated to the nucleus and showed high nuclear expression. However, only after using STT was a significant decrease in NF-κB p65 expression found ( Figure 7 b) After NF-κB p65 is activated, it is highly expressed in the nucleus. However, after STT, it can be clearly seen that the expression of NF-κB p65 in the nucleus is reduced and the color becomes lighter.

[0145] Therefore, the present invention confirmed through experiments that STT reduces the expression of inflammatory factors in vitro by inhibiting the activation of the NF-κB p65 signaling pathway, and also inhibits psoriasis symptoms such as skin thickening in psoriasis mice.

[0146] Can be obtained from Figure 7 The results of HE staining show that the skin thickness analysis and NF-κB p65 inhibition effect of the present invention have a lower skin thickening degree than the control group, and the present invention has the best effect in inhibiting psoriasis skin thickening. Figure 7 c- Figure 7 As can be seen from the results of the PASI score, the STT indexes were the lowest compared with the control group, indicating that STT has an excellent effect in treating psoriasis. Figure 7 As shown in Figure cf, on day 6, both the STT and ST groups showed significant statistical differences in skin thickness and scaly erythema. STT was superior to ST in efficacy. Furthermore, ST was more effective than siRNA alone, with statistically significant differences.

[0147] The experimental results show that the STT provided by the present invention has excellent transdermal efficiency. STT can improve the inflammatory microenvironment of psoriasis by inhibiting the expression of NF-κBp65. STT can significantly reduce the area and severity index (PASI) of psoriasis, and the effect of STT is much higher than that of the control group. This shows that the STT provided by the present invention inhibits the proliferation of keratinocytes and alleviates the skin thickening, scaling and erythema formation of psoriasis, and has an excellent therapeutic effect on psoriasis.

[0148] Compared with the single use of tFNA, TA or siRNA group, the STT complex of the present invention has excellent effect in improving the inflammatory environment of psoriasis. STT has excellent therapeutic effect on psoriasis and plays a synergistic role.

[0149] In summary, the purpose of the present invention is to prepare a DNA tetrahedron complex and its use in the preparation of a drug for treating psoriasis. The present invention autonomously assembles TA, tFNA, and siRNA that silences NF-κB into a controllable composite whole (STT) for responsive and precise release of siRNA. The STT complex of the present invention has a simple synthesis process, ensures the stability of siRNA during delivery, has efficient transdermal delivery and efficient cellular uptake, and can control the release of siRNA drugs to successfully reach the cytoplasm to exert their effects; the STT complex of the present invention has excellent anti-inflammatory effects. TA and tFNA in the STT complex of the present invention and siRNA that silences NF-κB play a synergistic role, providing a new strategy for the treatment of psoriasis and having great potential to become a new drug for psoriasis.

[0150] At the same time, the successful construction of STT provides new ideas and directions for gene delivery. STT's transdermal application shows great potential in the treatment of more immune diseases, skin diseases and the delivery of immune vaccines.

Claims

1. A DNA tetrahedron complex, characterized in that It is a complex formed by mixing DNA tetrahedral framework nucleic acid containing siRNA that silences NF-κB and tannic acid; The DNA tetrahedral framework nucleic acid containing siRNA for silencing NF-κB is formed by mixing the DNA tetrahedral framework nucleic acid and the siRNA for silencing NF-κB; The DNA tetrahedral framework nucleic acid is formed by four single-stranded DNAs through base complementary pairing, and the sequences of the four single-stranded DNAs are shown in SEQ ID NOs. 1 to 4; The forward sequence of the siRNA that silences NF-κB is shown as SEQ ID NO.5, and the reverse sequence thereof is shown as SEQ ID NO.6; or the forward sequence of the siRNA that silences NF-κB is shown as SEQ ID NO.7, and the reverse sequence thereof is shown as SEQ ID NO.8; The molar ratio of the DNA tetrahedral framework nucleic acid to the siRNA for silencing NF-κB is 1:(1-4); The mixing ratio of the DNA tetrahedral framework nucleic acid containing siRNA for silencing NF-κB and tannic acid is 1000 nM ： (12.5~200)μg / mL.

2. The composite according to claim 1, characterized in that: The mixing ratio of the DNA tetrahedron of the siRNA silencing NF-κB and tannic acid is 1000 nM:50 μg / mL.

3. The composite according to any one of claims 1 to 2, characterized in that: The DNA tetrahedral framework nucleic acid is prepared by the following method: four DNA single strands are added to TM buffer, pH = 8.0, maintained at 95°C for 10 minutes, and then rapidly cooled to 4°C and maintained for more than 20 minutes. The DNA tetrahedral framework nucleic acid containing siRNA for silencing NF-κB is prepared by the following method: the DNA tetrahedral framework nucleic acid and the siRNA for silencing NF-κB are mixed and incubated at room temperature; The concentration ratio of the mixture of the DNA tetrahedral framework nucleic acid and the siRNA for silencing NF-κB is 1: (1～5)。 4. The composite according to claim 3, characterized in that: The incubation time is not less than 30 min; The mixing concentration ratio of the DNA tetrahedral framework nucleic acid and the siRNA for silencing NF-κB is 1:

4.

5. A method for preparing the composite according to any one of claims 1 to 4, characterized in that: It includes the following steps: Add tannic acid to the DNA tetrahedral framework nucleic acid containing siRNA silencing NF-κB and shake and mix evenly; The mixing ratio of the DNA tetrahedral framework nucleic acid containing siRNA for silencing NF-κB and tannic acid is 1000 nM:50 μg / mL.

6. Use of the complex according to any one of claims 1 to 4 in the preparation of anti-inflammatory drugs.

7. Use of the complex according to any one of claims 1 to 4 in the preparation of a medicament for treating psoriasis.

8. An anti-inflammatory drug, characterized in that The anti-inflammatory drug is prepared by using the complex according to any one of claims 1 to 4 as an active ingredient and adding pharmaceutically acceptable auxiliary ingredients.

Images