A strain of Talaromyces fungus W10 and its application

Abstract

A strain of Talaromyces fungus W10 and its application belong to the field of agricultural microbial technology. In order to screen fungi with efficient phosphate-dissolving activity and salt tolerance, and then provide alternative strains for the application of phosphate-dissolving fungi in agriculture, the present invention screened a strain of efficient phosphate-dissolving fungus W10 from the rhizosphere soil of phosphate plants, and identified the strain W10 as a Talaromyces fungus through morphological identification and molecular biological identification. Through the study of phosphate-dissolving effect and growth-promoting effect, it was found that strain W10 has a good phosphate-dissolving effect on a variety of insoluble phosphorus, and can tolerate a salt concentration of up to 4%. It still has good phosphate-dissolving activity under a salt concentration of 4%, and has the potential to be developed as a saline-alkali land microbial fertilizer; in addition, strain W10 can promote the growth of corn seedlings, increase the effective phosphorus content and urease and sucrase activities in the rhizosphere soil of corn seedlings. It can be seen that strain W10 has broad application prospects in agricultural production.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural microorganisms, and specifically relates to a Talaromyces fungus W10 and an application thereof. Background Art

[0002] Phosphorus is one of the essential nutrients for plant growth. The phosphorus content in the soil directly affects the growth and quality of plants. Phosphorus fertilizer plays a pivotal role in agricultural production. The application of phosphorus fertilizer is an important measure to ensure grain production (Saber K, Nahla L, Ahmed D, et al. Effect of P on nodule formation and N fixation in bean [J]. Agron Sustain Dev, 2005, 25: 389-393.). However, phosphate fertilizer applied to the soil is usually quickly absorbed by Ca 2+ Mg 2+ 、Al 3+ , Fe 3+ Plasma solidification exists in the soil as insoluble metal chelates, resulting in the effective utilization rate of phosphate fertilizer not exceeding 20% ​​(Qin Lijun, Yang Yongzhu, Yang Xingyong. Research progress on the mechanism of phosphate dissolution and decomposition of soil phosphate-dissolving microorganisms [J]. Life Science Research, 2019, 23(01): 59-64+86.). If this continues, it will not only cause a serious waste of phosphorus resources, making the already scarce high-grade phosphate resources face challenges, but also excessive use of phosphate fertilizers will cause groundwater pollution and eutrophication of water bodies (Wen Weijia, Zhuang Yanhua, Zhang Liang et al. Preferred hierarchical control strategy of phosphorus from non-point source pollution at regional scale [J]. Environ Sci Pollut Res Int, 2021, 28: 60111-60121.). Therefore, the rational use of phosphate fertilizers, reducing the amount of phosphate fertilizers used, improving the utilization rate of phosphate fertilizers in the season, and extending the service life of phosphate resources are of great significance to the sustainable development of my country's agriculture.

[0003] Studies have shown that there is a microorganism in the soil that can convert insoluble phosphorus into effective phosphorus that can be absorbed by plants. Many scholars hope to obtain efficient phosphate-solubilizing microorganisms to improve the utilization rate of phosphate fertilizers in agricultural production. Phosphate-solubilizing microorganisms mainly include bacteria and fungi. Studies have shown that the phosphate-solubilizing performance of fungi is much greater than that of bacteria, while fungi are less used in actual agricultural production. Therefore, phosphate-solubilizing fungi have gradually become a research hotspot in recent years (Kucey RMN et al., Increased yields and phosphorous uptake by westar canola (Brassicanapus L.) inoculated with a phosphate-solubilizing isolate of Penicillium bilai. Canadian Journal of Soil Science, 1989, 69: 425-432.). At present, the phosphate-dissolving fungi that have been isolated include dozens of genera, among which the most studied are Penicillium and Aspergillus (Xu Changchao, Zhang Juntao, Ye Shaoping, et al. Isolation and identification of a phosphate-dissolving Penicillium in soil and its application effect [J]. Chinese Soil and Fertilizer, 2020, 290(06): 272-278.). Yue Sang et al. isolated 4 phosphate-dissolving fungi from poplar rhizosphere soil, all of which belong to the genus Mortierella. Among them, L4 had the best phosphate-dissolving effect, with the maximum phosphate-dissolving capacity of 180 mg / L (Sang Yue, Jin Long, Zhu Rui et al. Mortierella Phosphorus-Solubilizing Capacity of Species Isolated from Rhizosphere Soil of a Poplar Plantation. [J]. Microorganisms, 2022, 10: undefined.). Xue-Li Wang et al. obtained a strain of Paecilomyces lilacinus PSF7 from the soil of a phosphate tailings field. After culture medium optimization, the maximum phosphorus solubilizing capacity of the strain could reach 122.17 mg / L (Wang Xue-Li, Qiu Shu-Yi, Zhou Shao-Qi et al. Paecilomyces lilacinus Phosphate-Solubilizing Capacity of PSF7 and Optimization Using Response Surface Methodology. [J]. Microorganisms, 2023, 11: undefined.).Laura Bononi et al. isolated Trichoderma spp. from Amazon rainforest soil and found that 19.5% of the strains had a phosphate-solubilizing effect. In potted experiments, soybean phosphorus absorption increased by 2.1%-41.1% (Bononi Laura, Chiaramonte Josiane Barros, Pansa Camila Cristiane et al. Phosphorus-solubilizing Trichoderma spp. from Amazon soils improve soybean plant growth. [J]. Sci Rep, 2020, 10: 2858.). Wang Liyan et al. studied the degradation efficiency of Aspergillus niger on wheat straw and the release of phosphorus. The results showed that the glucanase and glucosidase released by Aspergillus niger contributed to the degradation of straw and the release of organic phosphorus, and the secreted oxalic acid promoted the release of inorganic phosphorus (Wang Liyan, Guan Hao, Hu Jun et al. Aspergillus niger Enhances Organic and Inorganic Phosphorus Release from Wheat Straw by Secretion of Degrading Enzymes and Oxalic Acid. [J]. J Agric Food Chem, 2022, 70: 10738-10746.). Vessey et al. inoculated peas with a strain of Penicillium bilaii in laboratory and field experiments. The root length, root weight and phosphorus content of the inoculated plants increased significantly, which can effectively promote the growth of peas. Currently, this strain has been commercialized in Canada (Vessey JK, Heisinger KG. Effect of Penicillium bilaii inoculation and phosphorus fertilization on root and shoot parameters of field growth pea[J]. Canadian Journal of Plant Science, 2001, 81(3):361-366.).Shang Xiaojing et al. screened out Phytophthora spp. G14 and Penicillium adamantium FG54 from blueberry endophytic fungi with phosphate-solubilizing and salt-tolerant functions. Under laboratory conditions, the highest available phosphorus content reached 587.315 μg / mL and 523.730 μg / mL, respectively, after 5 days (Shang Xiaojing, Hou Rui, Xu Fangling, et al. Screening, identification and evaluation of phosphate-solubilizing effects of two blueberry endophytic fungi [J]. Jiangsu Agricultural Science, 2022, 50(20): 246-252.). Li Jing et al. isolated a strain of Penicillium rubens with phosphate-dissolving effect from wheat field soil. The strain has a certain solubility for Ca3(PO4)2, AlPO4 and FePO4, with the maximum solubility of 382.79 mg / L, 95.99 mg / L and 75.39 mg / L, respectively. It also has obvious growth-promoting properties for wheat, and the plant height, root length, fresh weight, and chlorophyll content of wheat can be increased to 35.65%, 50.44%, 50.94%, and 19.57%, respectively (Li Jing, Ai Jiamin, Yu Tianfei, et al. Identification of a phosphate-dissolving fungus and its growth-promoting properties [J]. Journal of Fujian Agricultural Sciences, 2021, 36(10): 1224-1230.). Therefore, finding more types of phosphate-dissolving fungi can provide high-quality strain resources for the development of microbial fertilizers.

[0004] Talaromyces sp. is a type of saprophytic fungi widely distributed in nature. Except for a few that are conditionally pathogenic, most of them are beneficial to human production activities. It has been found that Talaromyces has the functions of producing antibacterial substances, plant disease resistance and stress resistance, degrading lignocellulose, and producing natural colorants (Sun Jianqiu, Ruan Yongming, Jin Shiyu, etc. The importance of the genus Talaromyces and an overview of its taxonomic research [J]. Fungal Research, 2021, 19(02): 83-93.). Li Hong-Lei et al. isolated Talaromyces islandicus EN-501 from marine red algae tissue, and isolated 5 anthraquinone derivatives with antibacterial and antioxidant activities from the culture extract of this strain (Li Hong-Lei, Li Xiao-Ming, Li Xin et al. Antioxidant Hydroanthraquinones from the Marine Algal-Derived Endophytic Fungus Talaromyces islandicus EN-501. [J]. J Nat Prod, 2017, 80: 162-168.). Madi L et al. found that Talaromyces flavus can reduce bean stem rot caused by Staphylococcus aureus and secrete antifungal substances against Verticillium dahliae (Madi L, Katan T, Katan J et al. Biological Control of Sclerotiumrolfsii and Verticillium dahliae by Talaromyces flavus Is Mediated by Different Mechanisms. [J]. Phytopathology, 1997, 87: 1054-60.).There are many cellulase-producing fungi in Talaromyces, such as Talaromyces pinophilus, Talaromyces funiculosus, Talaromyces purpureogenus, Talaromyces verruculosus, etc., which can secrete a large amount of cellulase to degrade lignocellulose in plant residues, thereby enhancing soil fertility (Fujii T, Hoshino T, Inoue H, et al. Taxonomic revision of the cellulose-degrading fungus Acremonium cellulolyticus nomen nu dum to Talaromyces based on phylogenetic analysis [J]. FEMS Microbiology Letters, 2014, 351: 32-41.) (Morozova VV, Gusakov AV, Andrianov RM, et al. Cellulases of Penicillium verruculosum[J].Journal of Biotechnology, 2010, 5:871-880.). Most of the talaromyces produce yellow and red pigments. Among them, some strains such as dark rose talaromyces (Talaromyces atroroseus) and white double wheel talaromyces (Talaromyces bobiverticillius) can produce pigments without producing any mycotoxins, and may be applied to the food pigment industry (Frisvad JC, Yilmaz N, Thrane U, et al. Talaromyces atroroseus, a new species efficiently producing industrially relevant red pigments [J]. PLoS One, 2013, 8 (12): e84102.). The phosphate solubilizing performance of talaromyces has been reported. Yin Xiaoman et al. isolated a yellow talaromyces (Talaromyces flavus) with phosphate solubilizing effect from the soil at the root of poplar, and its maximum phosphate solubilizing capacity was 660.9 mg / L.

[0005] At present, there are many reports on phosphate-dissolving fungi, but most of the fungi are mainly screened from the rhizosphere soil of various crops, and there are few studies on phosphate-dissolving fungi in the rhizosphere soil of phosphate mines and nearby vegetation. At present, the problem of soil salinization in coastal areas of my country is relatively serious, and there are few studies on efficient and salt-tolerant phosphate-dissolving fungi. If fungi with efficient phosphate-dissolving activity and salt tolerance can be screened from the rhizosphere soil of phosphate mines and nearby vegetation, it will be of great significance to the sustainable development of agriculture. Summary of the invention

[0006] In order to screen fungi with high phosphate-dissolving activity and salt tolerance from phosphate mines and the rhizosphere soil of nearby vegetation, and to provide alternative strains for the application of phosphate-dissolving fungi in agriculture, the present invention provides a fungus W10 of the genus Talaromyces sp. with phosphate-dissolving activity. The specific technical scheme is as follows:

[0007] The first object of the present invention is to provide a strain of Talaromyces sp. fungus W10, which is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with a deposit number of CGMCC NO.40621 and a deposit date of May 10, 2023. The address of the depository is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0008] The second object of the present invention is to provide the use of the above-mentioned Tularemella fungus W10 in improving the utilization rate of insoluble phosphorus in soil.

[0009] In one embodiment of the present invention, the soil has a salt content of less than 4%.

[0010] In one embodiment of the present invention, the sparingly soluble phosphorus is one or a combination of any two or more of Ca3(PO4)2, AlPO4 and FePO4.

[0011] The third object of the present invention is to provide the application of the above-mentioned Tularemella fungus W10 in promoting crop growth.

[0012] The fourth object of the present invention is to provide a phosphate-dissolving bacterial agent containing the above-mentioned Bacillaceae fungus W10.

[0013] The fifth object of the present invention is to provide the use of the above-mentioned phosphate-dissolving bacteria agent in dissolving sparingly soluble phosphorus in soil.

[0014] In one embodiment of the present invention, the soil is soil with a salt content of less than 4%; the insoluble phosphorus is one or a combination of any two or more of Ca3(PO4)2, AlPO4 and FePO4.

[0015] The sixth object of the present invention is to provide a biological fertilizer containing the above-mentioned Bacillaceae fungus W10.

[0016] The seventh object of the present invention is to provide the use of the above-mentioned biological fertilizer in dissolving insoluble phosphorus in soil and promoting crop growth.

[0017] Beneficial effects of the present invention:

[0018] The present invention uses an inorganic phosphorus solid culture medium with Ca3(PO4)2 as the only phosphorus source to separate a fungus W10 with high-efficiency phosphorus-dissolving activity from the rhizosphere soil of a phosphate rock plant. The strain W10 is identified as a Talaromyces sp. fungus through morphological identification and molecular biological identification. The strain has a strong dissolving ability for Ca3(PO4)2. The strain W10 is inoculated in a liquid culture medium with Ca3(PO4)2 as the only phosphorus source for culture. After 12 days, the effective phosphorus content in the culture medium can reach 843.05 mg / L. The strain also has the dissolving ability for AlPO4 and FePO4, but the phosphorus-dissolving effect is lower than that of Ca3(PO4)2. W10 can tolerate a salt concentration of up to 4%, belongs to a moderately salt-tolerant bacterium, and still has good phosphorus-dissolving activity under a salt concentration of 4%, and has the potential to be developed as a saline-alkali land microbial fertilizer. Corn pot experiments showed that strain W10 can promote the growth of corn seedlings (compared with CK2, plant fresh weight, dry weight, plant height, leaf area and plant total phosphorus increased by 23.21%, 27.08%, 9.62%, 21.59% and 20.07%, respectively), and can also significantly promote the plant's absorption of water, increase the available phosphorus content in the rhizosphere soil of corn seedlings (compared with CK2, the available phosphorus content in the soil of W10 increased by 44.74%-56.62%) and urease and sucrase activities (compared with CK2, soil urease and sucrase activities increased by 28.43% and 38.20%, respectively). It has the potential to be developed into a phosphate-dissolving microbial fertilizer and has broad application prospects in agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the colony image of strain W10 on PDA plate;

[0020] Figure 2 This is the structure diagram of conidiophores and ascocarps of strain W10 under an optical microscope; Figure 2 A in the figure is the conidiophore structure diagram of strain W10. Figure 2 B in the figure is the ascocarp structure diagram of strain W10;

[0021] Figure 3 Phylogenetic tree based on the ITS sequence of strain W10;

[0022] Figure 4This is a graph showing the changes in the effective phosphorus content and pH in the medium at different times after strain W10 was inoculated into an inorganic phosphorus liquid medium with Ca3(PO4)2 as the only phosphorus source;

[0023] Figure 5 The graph shows the effective phosphorus content in the culture medium after strain W10 was inoculated into inorganic phosphorus liquid culture medium with Ca3(PO4)2, AlPO4, and FePO4 as the only phosphorus source for 8 days;

[0024] Figure 6 This is a graph showing the variation of the effective phosphorus content and biomass of strain W10 in inorganic phosphorus liquid culture medium with different salt concentrations;

[0025] Figure 7 This is the result of the effect of strain W10 on the enzyme activity in the rhizosphere soil of corn seedlings. DETAILED DESCRIPTION

[0026] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific implementation methods and the accompanying drawings of the specification. The experimental methods used in the following examples are conventional methods unless otherwise specified, and the materials, reagents, methods and instruments used are conventional materials, reagents, methods and instruments in the art unless otherwise specified, and can be obtained by those skilled in the art through commercial channels.

[0027] The soil samples selected for the present invention were collected from the plant rhizosphere soil in the phosphate mine mountain area of ​​Jianping County, Chaoyang City, Liaoning Province (119.37.50 east longitude, 41.29.59 north latitude) in July 2021. The sampling was carried out using a 5-point sampling method. A shovel was used to deeply implant the sample 10 cm into the rhizosphere. The sample was put into a self-sealing bag and taken back to the laboratory and placed in a 4°C refrigerator for standby use.

[0028] The culture medium involved in the present invention is as follows:

[0029] PDA culture medium: 200 g / L potato, 20 g / L glucose, 2 g / L K2HPO4, 1 g / L MgSO4, 20 g / L agar, the balance is water, natural pH, sterilize at 115°C for 30 min, boil the potatoes with water, filter to obtain potato juice, boil again, add glucose and agar to dissolve, and then add water to make up to volume.

[0030] Inorganic phosphorus culture medium: glucose 10 g / L, FeSO4·7H2O 0.03 g / L, MgSO4·7H2O 0.3 g / L, NaCl0.3 g / L, KCl 0.3 g / L, (NH4)2SO40.5 g / L, MnSO4·7H2O 0.03 g / L, Ca3(PO4)25 g / L, agar 20 g / L, the remainder is water, pH 7.2-7.4, sterilization at 115°C for 30 min.

[0031] Example 1: Isolation and identification of Tularemia spp. W10

[0032] (I) Isolation of Bacillaceae W10

[0033] Take 10g of soil sample and place it in a 250mL conical flask containing 90mL of sterile water. Place a small amount of glass beads in the conical flask for full stirring. Shake the flask at 170rpm for 30min to prepare soil bacterial suspension. Dilute the soil bacterial suspension to 10 with sterile water. -2 , 10 -3 , 10 -4 Times, take 100 μL of soil bacteria suspension of different concentrations and evenly spread it on the inorganic phosphorus culture medium containing streptomycin (100 mg / mL, added at a ratio of 1 / 1000), set up three plates for each gradient, and culture at 28°C for 3-4 days. Select the strains with obvious phosphate-dissolving circles and transfer them to PDA culture medium for purification. After obtaining the purified single strain, inoculate it into PDA test tubes and store it in a 4°C refrigerator for later use.

[0034] The phosphate-dissolving fungus W10 with the ability to dissolve Ca3(PO4)2 was screened from the rhizosphere soil of phosphate plants by the gradient dilution method.

[0035] (II) Taxonomic study of Bacillaceae W10

[0036] (1) Morphological analysis of Bacillaceae W10

[0037] Strain W10 was inoculated into PDA medium and cultured in a 28°C incubator for 7 days. The colony diameter was 6.6 cm, the growth rate was fast, the colony surface was flat, the edges were neat, and concentric ring-shaped colonies were formed. The mycelium was white at the edge, yellow-green in the center, corn yellow in the middle of the concentric circles, and light yellow on the back of the colony (see Figure 1 The structure of conidiophores and ascocarps of strain W10 was observed under an optical microscope. Figure 2 During the sexual reproduction period, W10 produces ascocarps that resemble a "basketball net". The ascocarps are composed of a layer of tightly interwoven hyphae, which are covered with mature "fruits", which are ascospores. Broom-like conidiophores are produced on the surface of the hyphae, producing ellipsoidal conidia, which conform to the morphological characteristics of the genus Talaromyces.

[0038] (2) Molecular biological identification of Bacillaceae W10

[0039] The strain W10 was inoculated into PDA liquid culture medium and cultured in a shaker at 28°C and 170 rpm for 2 days. The mycelium was collected and the total DNA of the strain was extracted using a fungal extraction kit. The ITS fragment was amplified using ITS1 (SEQ ID NO.2) and ITS4 (SEQ ID NO.3) primers and then sent to Shanghai Bioengineering Co., Ltd. for sequencing. The sequencing results were submitted to NCBI for BLAST comparison. Sequences with more than 98% homology were selected and a phylogenetic tree was constructed using MAGA 11.0 software.

[0040] The total DNA of strain W10 was amplified using ITS rDNA specific primers to obtain a 555bp target fragment (see SEQ ID NO.1). The sequence was compared using BLAST in NCBI. The results showed that the sequence homology between strain W10 and Talaromyces sp. was as high as 99.94%. The Neighbor-Joining method in MEGA 11.0 was used to construct a phylogenetic tree for strain W10 and strains with sequences with homology of more than 98%. The results showed that strain W10 and Talaromyces sp. belonged to the same branch, and the credibility reached 100( Figure 3 ). Combining the morphological and ITS sequence identification results, strain W10 was identified as a fungus of the genus Tularemella. Strain W10 was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, with the deposit number CGMCC NO.40621 and the deposit date May 10, 2023. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences.

[0041] SEQ ID NO.1

[0042] AAACGGAAATGCGGGGACTCGCGGCCCACCTCCCACCCTTGTCTCTATACACCTGTTGCTTTGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGACGCACGTCCCCGGGCCCGCGCCCGCCGAAGCGCTCTGTGAA CCCTGATGAAGATGGGCTGTCTGAGTACTATGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAA TCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGTGGTCCCCCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCTG GTCCTCGAGCGTATGGGGCTCTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCACCATGTTTTTACCACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAA

[0043] ITS1:TCCGTAGGTGAACCTGCGG

[0044] ITS4:TCCTCCGCTTATTGATATGC

[0045] Example 2: Phosphate solubilizing activity of Bacillaceae W10

[0046] (1) Determination of phosphate solubilization ability of strain W10 on solid culture medium

[0047] The purified strain W10 was inoculated on an inorganic phosphorus medium and cultured at 28°C for 5 days. The diameter of the phosphorus dissolving zone (D) and the diameter of the colony (d) were detected and the D / d value was calculated. The results showed that the ratio of the phosphorus dissolving zone diameter (D) to the colony diameter (d) of strain W10 inoculated on an inorganic phosphorus solid medium with Ca3(PO4)2 as the only phosphorus source was 1.65, indicating that the strain W10 had significant phosphorus dissolving activity.

[0048] (2) Determination of the phosphate solubilization ability of strain W10 in liquid culture medium

[0049] The purified strain W10 was inoculated onto PDA medium and cultured at 28°C. When the spores grew all over the culture dish, 10 mL of sterile water was added. The spores were gently scraped with a coating stick and filtered with a sterilized cotton ball to obtain a spore suspension. The filter residue was rinsed repeatedly, and the number of spores was detected by a hemocytometer. The suspension was diluted to 1 × 10 7 cfu / mL for later use. Add 1 mL of the prepared spore suspension to a conical flask containing 100 mL of inorganic phosphorus liquid culture medium, and culture it in a shaker at 28 °C. Take the supernatant on the 2nd, 4th, 6th, 8th, 10th, 12th, and 14th day, and use the molybdenum antimony colorimetric method to detect the effective phosphorus content of the supernatant, and use a pH meter to detect the pH of the supernatant.

[0050] Strain W10 was inoculated into an inorganic phosphorus liquid medium with Ca3(PO4)2 as the only phosphorus source, and the effective phosphorus content and pH changes of the medium were tested every 2 days. Figure 4 It can be seen that the effective phosphorus content of strain W10 reached a peak of 823.15 mg / L on the 6th day and then decreased slightly, reaching a maximum value of 843.05 mg / L on the 12th day, showing a trend of first increasing, then decreasing, and then increasing again. The pH change reached a minimum value of 3.92 on the 4th day and then continued to increase slowly to 5.30.

[0051] The pH of strain W10 in the inorganic phosphorus liquid culture medium showed a trend of first decreasing and then increasing, and the effective phosphorus content reached a peak two days after it decreased to the lowest value, indicating that the dissolution mechanism of strain W10 was the acidolysis of organic acids. The effective phosphorus content of strain W10 reached a peak on the 6th day and then showed a trend of first decreasing, then increasing, and then decreasing again. It is speculated that this may be the effect of strain W10 absorbing part of the organic acid and then proliferating and dissolving again.

[0052] (3) Solubility of strain W10 on different phosphorus sources

[0053] Ca3(PO4)2, AlPO4, and FePO4 were used as the only inorganic phosphorus source in the inorganic phosphorus liquid culture medium, and the same mass of insoluble phosphorus was added to detect the solubility of the strains for different insoluble phosphorus. 1 mL of the prepared spore suspension was added to the liquid culture medium containing 100 mL of different insoluble phosphorus sources, and the culture was placed in a shaker at 28°C and 170 rpm. The supernatant was aspirated on the 8th day, and its effective phosphorus content was detected by the molybdenum antimony colorimetric method.

[0054] The experimental results are shown in Figure 5 The strain W10 had the strongest solubility for Ca3(PO4)2, with a solubility of 789.22 mg / L for Ca3(PO4)2, and 105.25 mg / L and 78.35 mg / L for AlPO4 and FePO4, respectively. It can be seen that the strain W10 has phosphate solubilizing activity for a variety of inorganic phosphorus.

[0055] (4) Determination of salt tolerance of Bacillaceae W10

[0056] Phosphate-dissolving bacteria W10 were inoculated into inorganic phosphorus liquid culture medium containing 0.5%, 1%, 2%, 4%, 6%, 8% and 10% NaCl, respectively. After culturing at 28°C and 170rpm for 8 days, the supernatant was taken to detect the effective phosphorus content and dry weight of mycelium. The results are shown in Figure 6. The phosphorus-dissolving ability and biomass of strain W10 decreased with the increase of NaCl content. Strain W10 still had strong phosphorus-dissolving activity when the NaCl content was 2% and 4%, and the effective phosphorus content was 684.22 mg / L and 645.52 mg / L, respectively, while the biomass decreased rapidly from 0.36 g when the NaCl content was 2% to 0.11 g when the NaCl content was 4%. When the NaCl content exceeded 4%, W10 had only a slight solubility for Ca3(PO4)2 and almost no mycelium was formed. It can be seen that strain W10 still has good phosphorus-dissolving activity when the NaCl content does not exceed 4%.

[0057] Example 3: Growth-promoting effect of Bacillaceae W10

[0058] Due to the complexity of the soil environment, many phosphate-dissolving bacteria have good phosphate-dissolving effects in laboratory environments, but the effects are not ideal after inoculation into the soil (Gyaneshwar P, Naresh Kumar G, Parekh LJ, et al. Role of soil microorganisms in improving P nutrition of plants [J]. Plant and Soil, 2002, 245 (1): 83-93.). Therefore, the present invention sets up a potted experiment to verify the growth-promoting effect of phosphate-dissolving fungi W10 on corn seedlings and its effect on soil available phosphorus.

[0059] The test soil was ordinary black soil in the Northeast field. After collecting the soil, it was divided into seedling pots (17 cm above the mouth × 14 cm high), 2 kg of black soil per pot. The test corn seeds were Huangjinnuo No. 1 purchased from Liaoyuan Quanyuan Seed Co., Ltd. The test phosphorus source was Ca3(PO4)2, 1g / kg soil. The strain W10 was inoculated into PDA liquid culture medium (with a few glass beads), and cultured at 28°C and 170rpm. After 3 days, samples were taken and counted using a hemocytometer until the number of spores reached 1×10 8 cfu / mL.

[0060] Experimental groups: (1) CK1: no inoculation, no addition of Ca3(PO4)2; (2) CK2: no inoculation, addition of Ca3(PO4)2; (3) W10: addition of Ca3(PO4)2, inoculation of phosphate-dissolving fungi W10.

[0061] Fungal culture medium was 1×10 9 cfu / kg was inoculated into the soil, and 4 relatively full corn seeds were sown in each pot, with 4 treatments in each group. Water was poured every 3 days after sowing, and soil samples were taken every 10 days to test the available phosphorus content. After 40 days, the plant height, leaf area, plant fresh weight, dry weight, total root fresh weight and dry weight, and soil moisture content of corn seedlings were tested. Statistical analysis and graphics were performed using Graphpad Prism 5.0 software.

[0062] Effects of phosphate-dissolving fungi W10 on growth-promoting effects of corn seedlings:

[0063] The results of the corn pot experiment are shown in Table 1. When the corn seedlings treated with the phosphate-dissolving strain W10 grew to 40 days old, their plant fresh weight, dry weight and leaf area were significantly higher than those of CK1 and CK2, and the soil moisture content was significantly lower than the two controls (p<0.05). Although CK2 was higher in fresh weight, dry weight and leaf area than CK1, there was no significant difference between the two. The fresh weight, dry weight, leaf area and total phosphorus of W10 plants increased by 0.86g, 0.21g and 11.25cm, respectively, compared with CK1. 3 , 0.93mg, an increase of 45.26%, 52.5%, 28.94% and 36.61%, compared with CK2 which increased by 0.52g, 0.13g and 8.9cm respectively 3 , 0.58mg, with increases of 23.21%, 27.08%, 21.59% and 20.07%. The soil moisture content of W10 was reduced by 2.21% and 1.37% compared with CK1 and CK2, respectively. The plant height of W10 had no significant difference compared with CK1 and CK2 due to the large variability within the CK2 group.

[0064] Table 1 Effects of strain W10 on the growth of corn seedlings

[0065]

[0066] Effects of phosphate-solubilizing fungus W10 on available phosphorus in the rhizosphere soil of corn seedlings:

[0067] The results of the available phosphorus test in the rhizosphere soil of corn seedlings are shown in Table 2. Under the condition of Ca3(PO4)2 as the phosphorus source, the available phosphorus content in the rhizosphere soil of all treatments increased with time. Compared with the two controls, the available phosphorus content in the treatment inoculated with phosphate-dissolving fungi increased significantly (p<0.05). The available phosphorus content in the soil of W10 treatment increased by 61.66%-97.66% compared with CK1, and increased by 44.74%-56.62% compared with CK2.

[0068] Table 2 Effect of strain W10 on available phosphorus content in rhizosphere soil of corn seedlings

[0069]

[0070] Effects of phosphate-solubilizing fungus W10 on enzyme activities in rhizosphere soil of corn seedlings:

[0071] Effects of phosphate-solubilizing fungi on urease and sucrase activities in rhizosphere soil of maize seedlings Figure 7 As shown in the figure, the soil urease activities of CK1, CK2 and W10 were 314.26μg / g, 359.65μg / g and 461.91μg / g, respectively. The strain W10 had significant differences compared with CK1 and CK2, increasing by 46.98% and 28.43%, respectively. The soil sucrase activities of CK1, CK2 and W10 were 197.53mg / g, 220.08mg / g and 304.16mg / g, respectively. The strain W10 had significant differences compared with CK1 and CK2, increasing by 53.98% and 38.20%, respectively.

[0072] Soil enzymes are important indicators of soil fertility and microbial activity, and participate in various material cycles and biochemical processes in the soil ecosystem. Soil urease activity is closely related to the number of microorganisms and nitrogen supply in the soil. Sucrase is an important hydrolase in the organic carbon conversion process. Its activity is closely related to the organic matter content, microbial number and soil respiration intensity in the soil. It is an important indicator for evaluating soil fertility (Ding Shaonan, Xue Ru, Liu Guobin. Effects of fertilization treatment on soil enzyme activity and water-soluble organic carbon and nitrogen in farmland in the Loess Hilly Region [J]. Journal of Agro-Environment Science, 2015, 34(11): 2146-2154.). Compared with CK2, strain W10 can significantly increase the activities of soil urease and sucrase, indicating that it can enhance soil fertility and promote crop growth.

[0073] Although the present invention has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. A strain of the genus Tularemia ( Talaromyces sp.) fungus W10, the deposit number is CGMCC NO.40621.

2. Use of the Talaromyces fungus W10 described in claim 1 in improving the utilization rate of insoluble phosphorus in soil.

3. The use according to claim 2, It is characterized in that The soil has a salt content of less than 4%.

4. The use according to claim 2, It is characterized in that The sparingly soluble phosphorus is Ca 3 (PO4) 2 、AlPO 4 and FePO 4 One or a combination of any two or more.

5. Use of the Talaromyces fungus W10 described in claim 1 in promoting crop growth.

6. A phosphate-dissolving bacterial agent containing the Talaromyces fungus W10 described in claim 1.

7. Use of the phosphate-dissolving bacteria agent according to claim 6 in dissolving sparingly soluble phosphorus in soil.

8. The use according to claim 7, It is characterized in that The soil has a salt content of less than 4%; the insoluble phosphorus is Ca 3 (PO4) 2 、AlPO 4 and FePO 4 One or a combination of any two or more.

9. A biological fertilizer containing the Talaromyces fungus W10 described in claim 1.

10. Use of the biological fertilizer according to claim 9 in dissolving insoluble phosphorus in soil and promoting crop growth.

Images