A Dual-Nuclease Single-Cell Lineage Tracing System and Its Application

Abstract

The present invention discloses a dual-nuclease single-cell lineage tracing system and its application. The system includes: a dual-nuclease expression vector, a guide RNA expression vector, and a target expression vector. The dual-nuclease expression vector contains a coding gene of a first Cas nuclease controlled by a TetON promoter and a coding gene of a second Cas nuclease controlled by an EF1α promoter. An ERT element gene is further fused after the coding gene of the second Cas nuclease. By using dual nucleases, the present invention flexibly controls two sets of variable DNA sequence (Barcode) generation systems independently for tracing through the addition of doxycycline (Dox) and tamoxifen (4-OHT), and can be used to trace two important biological processes. In addition, the two sets of Barcode generation systems can be started simultaneously for recording, and the accuracy of lineage recording can be verified with each other.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and relates to a dual nuclease single-cell lineage tracing system and its application. Background Art

[0002] Cell lineage refers to the relationship connection between parental cells and their progeny cells. Lineage tracing is an important research method in the field of developmental biology. Classical lineage tracing methods are mainly prospective lineage tracing, which specifically label certain types of cells of interest through dyes, fluorescent proteins, Cre recombinase, etc. Common prospective lineage tracing is difficult to achieve single-cell-level labeling and cannot obtain the gene expression of progeny cells. In recent years, retrospective lineage tracing technology has been continuously developed. Its main principle is to utilize the mutations accumulated in the cell genome or mitochondria, collect cells at a certain endpoint for sequencing, and construct a lineage development tree through the sharing of mutations to depict the lineage differentiation of cells. Most retrospective tracing reads the mutation information through single-cell-level sequencing technology. Therefore, this tracing technology that can achieve single-cell accuracy is called single-cell lineage tracing.

[0003] Currently, single-cell lineage tracing technology uses specific methods to edit specific positions of the genome to generate variable DNA sequences (hereinafter referred to as Barcode) for labeling specific cells. During cell division, Barcode can be continuously generated to label new cells. At the end time, Barcode is read through single-cell sequencing or other methods, and a lineage development tree is constructed based on the sharing of Barcode. The currently reported single-cell lineage tracing technologies mainly include the following: (1) Methods that use CRISPR-Cas9 to edit the target position to generate insertions or deletions (indels) for cell labeling, mainly including GESTALT, CARLIN, LINNAEUS, etc.; (2) Methods that use base editors or other deaminases to edit the target position to generate diverse tags for cell labeling, mainly including SMALT, etc.; (3) Methods that use Cre recombinase to delete or invert multiple tandem loxP sites to generate diverse tags for cell labeling, and the representative method is the Polylox system.

[0004] However, the above single-cell lineage tracing technology still has certain defects: (1) The time window for generating Barcodes in the existing single-cell lineage tracing technology is limited, and Barcodes will be depleted. The rate of fragment recombination and deletion by Cre in the Poly-Lox system is relatively fast, and generally all targets have reacted within 2 days; the method of generating indels for cell labeling based on CRISPR-Cas9 also has the situation that Cas9 cannot continuously generate new Barcodes for a long time; (2) The method based on CRISPR-Cas9 often requires multiple targets to be concatenated together. During the editing process, Cas9 will cause cross-target deletions, resulting in the loss of recorded information or a decrease in the number of available targets, affecting the accuracy of the final tree construction; (3) In the existing methods, only one recording system works. Therefore, the system can only be started for recording at one time point. If there are two or more important biological processes with time intervals during the entire development process that need to be recorded, the existing methods cannot cover them.

[0005] In summary, the development of a single-cell lineage tracing system is of great significance for the field of single-cell lineage tracing. Summary of the Invention

[0006] In view of the deficiencies of the prior art and the actual needs, the present invention provides a dual-nuclease single-cell lineage tracing system. By using dual nucleases, two sets of variable DNA sequence (Barcode) generation systems can be flexibly controlled independently for tracing through the addition of doxycycline (Dox) and tamoxifen (4-OHT), and can be used to trace two important biological processes.

[0007] To achieve the above object, the present invention adopts the following technical solutions:

[0008] In the first aspect, the present invention provides a dual-nuclease single-cell lineage tracing system, and the system includes:

[0009] A dual-nuclease expression vector, a guide RNA expression vector, and a target expression vector;

[0010] The dual-nuclease expression vector contains the coding gene of the first Cas nuclease controlled by the TetON promoter and the coding gene of the second Cas nuclease controlled by the EF1α promoter. The coding gene of the second Cas nuclease is also fused with an ERT element gene, and the ERT element gene is induced into the nucleus by tamoxifen for editing. The PAM sequences recognized by the first Cas nuclease and the second Cas nuclease are different; the guide RNA expression vector contains the coding gene of the guide RNA of the first Cas nuclease and the coding gene of the guide RNA of the second Cas nuclease; the target expression vector contains the DNA sequence of the target of the first Cas nuclease and the DNA sequence of the target of the second Cas nuclease.

[0011] In the present invention, a dual nuclease is used, and the TetON promoter is induced by Dox to control the expression of the first Cas nuclease. The nuclear editing of the second Cas nuclease is induced and controlled by 4-OHT, so as to flexibly control two sets of Barcode generation systems to independently trace, which can be used to trace two important biological processes without interfering with each other. In addition, when the two sets of Barcode generation systems are started simultaneously for recording, the accuracy of lineage recording can be verified with each other.

[0012] Preferably, each of the first Cas nuclease and the second Cas nuclease independently includes any one of Cas9, Cas12a or Cas12b.

[0013] It can be understood that in the present invention, as long as the PAM recognitions of the two nucleases are different, the target sites will not interfere with each other. On this basis, the first Cas nuclease and the second Cas nuclease can be freely selected. For example, in the specific embodiment of the present invention, the first Cas nuclease is a Cas12a nuclease and the second Cas nuclease is a Cas9 nuclease.

[0014] Preferably, a coding gene of a fluorescent protein is further fused after the coding gene of the first Cas nuclease.

[0015] In the present invention, the fused fluorescent protein gene can show the start of tracing.

[0016] In the present invention, the coding gene of the first Cas nuclease and the coding gene of the fluorescent protein can be connected by a P2A element.

[0017] Preferably, the fluorescent protein includes EGFP and / or YFP.

[0018] In the present invention, an ERT element gene is further fused after the coding gene of the second Cas nuclease, and is expressed under the initiation of the EF1a promoter and continuously expressed in cells. However, without 4-OHT induction, it will not enter the nucleus for editing. Only after adding 4-OHT, Cas9 will edit the target region, and the number of the ERT element genes can be 2.

[0019] In the present invention, the guide RNA refers to an RNA that guides a nuclease to target a specific target site.

[0020] In the present invention, two target sites can be used for each Cas nuclease, and a total of 4 target sites are arranged together and placed in the 3’UTR region of mCherry. A Poly(A) sequence is connected behind the target site, and the target site can be captured during single-cell sequencing.

[0021] Preferably, a random base sequence is independently fused in front of the DNA sequence of the first Cas nuclease target and the DNA sequence of the second Cas nuclease target, respectively.

[0022] Preferably, the length of the random base sequence is 8-20 bp, including but not limited to 9 bp, 10 bp, 11 bp, 12 bp, 13 bp, 14 bp, 15 bp, 16 bp, 17 bp or 18 bp.

[0023] In the present invention, a random base sequence is set in front of the target, which is called Integration Barcode. Through high-titer lentivirus infection, many copies of the target sequence can be inserted into one cell. Different inserted copies in the same cell can be distinguished by Integration Barcode, and the Integration Barcode combination of each cell can also be used to distinguish the ancestor cell population.

[0024] Preferably, the forms of the double nuclease expression vector, the guide RNA expression vector and the target expression vector are independently plasmid or lentivirus.

[0025] In the present invention, the double nuclease single-cell lineage tracing system can also be integrated into the genome of target cells through piggybac transposon vectors, lentivirus vectors, etc. to achieve stable expression.

[0026] Preferably, the nucleic acid sequence of the ERT element gene includes the sequence shown in SEQ ID NO.1.

[0027] Preferably, the nucleic acid sequences of the coding genes of the guide RNAs of the first Cas nuclease include the sequences shown in SEQ ID NO.2 and SEQ ID NO.3.

[0028] Preferably, the nucleic acid sequences of the coding genes of the guide RNAs of the second Cas nuclease include the sequences shown in SEQ ID NO.4 and SEQ ID NO.5.

[0029] Preferably, the nucleic acid sequences of the DNA sequences of the first Cas nuclease target include the sequences shown in SEQ ID NO.6 and SEQ ID NO.7.

[0030] Preferably, the DNA sequences of the second Cas nuclease target include the sequences shown in SEQ ID NO.8 and SEQ ID NO.9.

[0031] SEQ ID NO.1:

[0032] gctggagacatgagagctgccaacctttggccaagcccgctcatgatcaaacgctctaagaagaacagcctggccttgtccctgacggccgaccagatggtcagtgccttgttggatgctgagccccccatactctattccgagtatgatcctaccagacccttcagtgaagcttcgatgatgggcttactgaccaacctggcagacagggagctggttcacatgatcaactgggcgaagagggtgccaggctttgtggatttgaccctccatgatcaggtccaccttctagaatgtgcctggctagagatcctgatgattggtctcgtctggcgctccatggagcacccagtgaagctactgtttgctcctaacttgctcttggacaggaaccagggaaaatgtgtagagggcatggtggagatcttcgacatgctgctggctacatcatctcggttccgcatgatgaatctgcagggagaggagtttgtgtgcctcaaatctattattttgcttaattctggagtgtacacatttctgtccagcaccctgaagtctctggaagagaaggaccatatccaccgagtcctggacaagatcacagacactttgatccacctgatggccaaggcaggcctgaccctgcagcagcagcaccagcggctggcccagctcctcctcatcctctcccacatcaggcacatgagtaacaaaggcatggagcatctgtacagcatgaagtgcaagaacgtggtgcccctctatgacctgctgctggaggcggcggacgcccaccgcctacatgcgcccactagccgtggaggggcatccgtggaggagacggaccaaagccacttggccactgcgggctctacttcatcgcattccttgcaaaagtattacatcacgggggaggcagagggtttccctgccaca。

[0033] SEQ ID NO.2:

[0034] aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgaatttctactaagtgtagatctggtgggagagaaagcttatgatatcgcggctcgttggtctaggggtatgattctcgcttagggtgcgagaggtcccgggttcaaatcccggacgagccctttttttta。

[0035] SEQ ID NO.3:

[0036] aaggtcgggcaggaagagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgaatttctactaagtgtagatgtgccgtacgccggagccgacggtatcgcggctcgttggtctaggggtatgattctcgcttagggtgcgagaggtcccgggttcaaatcccggacgagccctttttttta。

[0037] SEQ ID NO.4:

[0038] gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaagccagaaacatgggaaagccacttgtgagtacggtttcagagctaagcacaagagtgcatagcaagttgaaataaggctagtccgtttacaacttgaaaaagtggcacccgagtcgggtgctttttttgacgt。

[0039] SEQ ID NO.5:

[0040] cagcacaaaaggaaactcaccctaactgtaaagtaattgtgtgttttgagactataagtatcccttggagaaccaccttgttggtcctttgtacgccgaaaaagtttgagagctaagcagaaagctgcatagcaagttcaaataaggctagtccgtacacaacttgaaaaagtggcagccgagtcggctgctttttttacgcgt。

[0041] SEQ ID NO.6:

[0042] tttgctggtgggagagaaagcttatga。

[0043] SEQ ID NO.7:

[0044] tttggtgccgtacgccggagccgacgg。

[0045] SEQ ID NO.8:

[0046] cctcgtactcacaagtggctttcc。

[0047] SEQ ID NO.9:

[0048] ccatttttcggcgtacaaaggac。

[0049] In a second aspect, the present invention provides a recombinant cell, which contains the dual nuclease single-cell lineage tracing system described in the first aspect.

[0050] In a third aspect, the present invention provides the application of the dual nuclease single-cell lineage tracing system described in the first aspect in single-cell lineage tracing.

[0051] In a fourth aspect, the present invention provides a method for single-cell lineage tracing, which includes:

[0052] Introducing the dual nuclease single-cell lineage tracing system described in the first aspect into target cells, inducing the TetON promoter and the EF1α promoter to start, and performing single-cell lineage tracing.

[0053] Compared with the prior art, the present invention has the following beneficial effects:

[0054] (1) The dual nuclease single-cell lineage tracing system of the present invention can start the system twice through sequential addition of inducers for sequential lineage recording, and can be used to trace consecutive important biological processes; (2) Dual nucleases can record more levels of information compared to single nucleases; (3) The arrangement of dual nuclease target sites and the sequential start method of the present invention can reduce the proportion of cross-target deletions and reduce the risk of loss of lineage recording information; (4) The present invention uses two different nucleases in the same system, and the indel preferences of different nucleases are different. Under the same target site conditions, more indel types can be generated, with higher diversity; (5) Starting the dual nucleases simultaneously for lineage recording can separately construct lineage trees for the recorded information, and compare the similarity of the constructed trees through algorithms; (6) The dual nuclease system can be extended for application in Perturb-Tracing, using one nuclease for gene knockout and the other nuclease for lineage information recording. Description of the Drawings

[0055] Figure 1 Schematic diagram of the expression cassette structure in the dual nuclease expression vector in Example 1;

[0056] Figure 2 Schematic diagram of the expression cassette structure in the target expression vector in Example 1;

[0057] Figure 3 Schematic diagram of the expression cassette structure in the guide RNA expression vector in Example 1;

[0058] Figure 4 Schematic working diagram of the dual nuclease composed of Cas9 and Cas12a;

[0059] Figure 5Schematic diagram of the method for constructing a dual-nuclease 293T cell line;

[0060] Figure 6 Schematic diagram for tracking using the dual-nuclease system during the clonal proliferation of 293T cells;

[0061] Figure 7 Result graph of the 293T cell lineage development tree constructed using dual nucleases;

[0062] Figure 8 Result graph of the advantage of dual nucleases over single nucleases in the tree-building level;

[0063] Figure 9 Result graph of the advantage of dual nucleases over single nucleases in the low cross-target deletion ratio;

[0064] Figure 10 Result graph of the proportion of target editing types when a single nuclease is used in combination with three tandem targets. Detailed implementation manners

[0065] To further illustrate the technical means and effects adopted by the present invention, the present invention will be further described below in conjunction with embodiments and drawings. It can be understood that the specific implementation manners described herein are only used to explain the present invention, rather than limiting the present invention.

[0066] For those not specifying specific techniques or conditions in the embodiments, follow the techniques or conditions described in the literature in this field or according to the product specifications. For reagents or instruments not indicating the manufacturer, they are all conventional products that can be obtained through regular channels.

[0067] Example 1

[0068] In this example, Cas12a and Cas9 are used as examples to construct a dual-nuclease single-cell lineage tracing system. The expression frame structures in the dual-nuclease expression vector, target expression vector, and guide RNA expression vector are respectively as follows Figures 1-3As shown, the dual nuclease plasmid composed of Cas9 and Cas12a. Cas12a is controlled by the TetON promoter (TRE). After exogenous addition of Dox (doxycycline), Cas12a starts transcription and lineage tracing can begin. The Cas12a protein is fused with the EGFP fluorescent protein through the P2A element, which can show the start of tracing. The Cas9 protein is fused with two ERT elements and is expressed under the EF1a promoter. In cells, Cas9-ERT2 will be constantly expressed, but it will not enter the nucleus for editing without 4-OHT induction. Only after adding 4-OHT, Cas9 will edit the target region to generate a Barcode. The dual nuclease plasmid is placed on the piggybac backbone and can be integrated into the cell genome through the piggybac transposon to achieve stable expression. The second element of the dual nuclease system is the target plasmid. The targets of 2 Cas9 (T3 and T4 in Figure 2 and 2 Cas12a (T1 and T2 in Figure 2 are arranged together and placed in the 3’UTR region of mCherry, followed by a Poly(A) sequence (131 bp in length). Therefore, the targets can be captured during single-cell sequencing. In front of different targets, we placed a 14-bp random base sequence (any random sequence synthesized by a sequence synthesis company), called integration Barcode ( Figure 2 intBC in Figure 2 ). Through high-titer lentiviral infection, we can insert many copies of the target sequence into a single cell. Through the integration Barcode, we can distinguish different inserted copies in the same cell, and the integration Barcode combination of each cell can also be used to distinguish the ancestor cell population. The third element of the dual nuclease system is the plasmid expressing the sgRNA and crRNA required to guide Cas9 and Cas12a to target specific targets. Since two Cas9 targets and two Cas12a targets are used, two sgRNAs ( Figure 3 G3 and G4 in Figure 3 ) and 2 crRNAs ( Figure 3 G1 and G2 in Figure 3 ) are needed. The sgRNA and crRNA plasmids are placed on the lentiviral plasmid backbone and can be integrated into cells for stable expression through lentiviral infection. The specific working principle of the dual nuclease can be referred to Figure 4 .

[0069] The nucleic acid sequence of the TetON promoter is:

[0070] gagtttactccctatcagtgatagagaacgtatgaagagtttactccctatcagtgatagagaacgtatgcagactttactccctatcagtgatagagaacgtataaggagtttactccctatcagtgatagagaacgtatgaccagtttactccctatcagtgatagagaacgtatctacagtttactccctatcagtgatagagaacgtatatccagtttactccctatcagtgatagagaacgtataagctttaggcgtgtacggtgggcgcctataaaagcagagctcgtttagtgaaccgtcagatcgcctggagcaattccacaacacttttgtcttataccaactttccgtaccacttcctaccctcgtaaa。

[0071] The nucleic acid sequence of Cas12a is:

[0072]

[0073] The nucleic acid sequence of P2A is as follows:

[0074] gctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacct。

[0075] The nucleic acid sequence of EGFP is as follows:

[0076] gtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagaccggttag。

[0077] The nucleic acid sequence of the EF1α promoter is as follows:

[0078]

[0079] The nucleic acid sequence of Cas9 is:

[0080]

[0081] The nucleic acid sequence of the random base sequence is:

[0082] NNNNNNNNNNNNNN.

[0083] Example 2

[0084] In this example, the dual nuclease lineage tracing system composed of the above-mentioned Cas9 and Cas12a was introduced into HEK293T cells. Ten HEK293T cells into which the lineage tracing system was introduced were sorted into a 96-well plate and grown for 28 days, and the cells proliferated to about 1 million. Within D1 - D22 days, Cas12a was activated by adding Dox to continue the lineage information, and from D22 - D28, Cas9 was activated to enter the nucleus by adding 4-OHT to record the second layer of lineage information. At the end of the experiment, the gene expression information of the cells and the lineage information recorded by the dual nuclease were obtained through single-cell sequencing and amplicon sequencing, and the lineage development tree was constructed using the corresponding algorithm.

[0085] Figure 5 The method for constructing the dual nuclease cell line is shown. First, the dual nuclease was introduced into HEK293T cells using the piggybac transposon system. The dual nuclease plasmid carried a puromycin (puro) selection marker. After plasmid transfection and culture in a medium containing puro for 4 - 6 days, a cell line with stable insertion of the dual nuclease element could be obtained. Based on this cell line, the gRNA plasmid and the target plasmid were then introduced by lentiviral infection, and a cell line stably expressing the above elements was obtained by fluorescence-activated cell sorting.

[0086] Figure 6 The experimental process of the dual nuclease system starting to record successively and finally reading the lineage information through single-cell sequencing and amplicon sequencing during the process of HEK293T cells with the dual nuclease tracing system proliferating from 10 cells to 1 million cells is shown. Figure 7 It is the lineage development tree of HEK293T cells reconstructed based on the information recorded by the dual nuclease system. Figure 8 It shows that the level of the lineage development tree recorded by the dual nuclease is higher than that recorded by a single nuclease, reflecting the advantage of the dual nuclease starting to record the lineage successively. Figure 9 It shows the deletion ratios of the dual nuclease editing within the target, across two targets, and across three targets. T1, T2, T3, and T4 represent that the editing occurs only within a single target, T1-2 represents the deletion between the first and second targets, T2-3 represents the deletion type between the second and third targets, and T1-3 represents the deletion type between the first and third targets. It can be seen that the T1-3 type of editing by the dual nuclease is less, and the cross-target deletion ratio is lower, reflecting the advantage of less loss of the lineage recording information. Figure 10Shown is the proportion of target editing types when a single nuclease is used in combination with three tandem targets. It can be seen that the proportion of T1-3 editing types exceeds 70%. Figure 9 And Figure 10 Comparing with Figure 9 and Figure 10 , it can be seen that sequential activation of the combined use of two nucleases can significantly reduce the proportion of cross-target deletions.

[0087] In summary, the present invention uses two nucleases to flexibly control two sets of variable DNA sequence (Barcode) generation systems independently for tracing through the addition of doxycycline (Dox) and tamoxifen (4-OHT), which can be used to trace two important biological processes. In addition, the two sets of Barcode generation systems can be activated simultaneously for recording, which can verify the accuracy of lineage recording with each other and significantly reduce the proportion of cross-target deletions.

[0088] The applicant declares that the present invention uses the above embodiments to illustrate the detailed method of the present invention, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvement of the present invention, the equivalent replacement of each raw material of the product of the present invention, the addition of auxiliary components, and the selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A dual nuclease single-cell lineage tracing system, characterized in that, The system includes: A dual nuclease expression vector, a guide RNA expression vector, and a target expression vector; The dual nuclease expression vector contains a coding gene of a first Cas nuclease controlled by a TetON promoter and a coding gene of a second Cas nuclease controlled by an EF1α promoter. The first Cas nuclease and the second Cas nuclease each independently include any one of Cas9, Cas12a, or Cas12b, and the first Cas nuclease and the second Cas nuclease are different; A coding gene of a fluorescent protein is further fused after the coding gene of the first Cas nuclease. The coding gene of the first Cas nuclease and the coding gene of the fluorescent protein are connected by a P2A element. Dox is used to induce the TetON promoter to control the expression of the first Cas nuclease; An ERT element gene is further fused after the coding gene of the second Cas nuclease. The nucleic acid sequence of the ERT element gene is shown by the sequence of SEQ ID NO.

1. The ERT element gene is induced to enter the nucleus for editing by 4-OHT. The PAM sequences recognized by the first Cas nuclease and the second Cas nuclease are different; The guide RNA expression vector contains a coding gene of a guide RNA of the first Cas nuclease and a coding gene of a guide RNA of the second Cas nuclease; The target expression vector contains a DNA sequence of a target of the first Cas nuclease and a DNA sequence of a target of the second Cas nuclease; there are 2 targets for each Cas nuclease, a total of 4 targets are arranged together and placed in the 3' UTR region of mCherry. A Poly(A) sequence is connected behind the target, and the target is captured during single-cell sequencing; a random base sequence is further integrated in front of the DNA sequences of the first Cas nuclease target and the second Cas nuclease target, and the length of the random base sequence is 8-20 bp.

2. The dual nuclease single cell lineage tracing system according to claim 1, wherein The fluorescent protein includes EGFP and / or YFP.

3. The dual nuclease single-cell lineage tracing system according to claim 1, wherein The forms of the dual nuclease expression vector, the guide RNA expression vector, and the target expression vector are each independently a plasmid or a lentivirus.

4. A recombinant cell, characterized in that, The recombinant cell contains the dual nuclease single-cell lineage tracing system according to any one of claims 1-3.

5. Use of the dual nuclease single-cell lineage tracing system according to any one of claims 1-3 in single-cell lineage tracing.

6. A method for single-cell lineage tracing, characterized in that, The method includes: Introducing the dual nuclease single-cell lineage tracing system according to any one of claims 1-3 into target cells, inducing the TetON promoter and the EF1α promoter to start, and performing single-cell lineage tracing.

Images