A kind of oil-producing yeast and its application

Abstract

The invention discloses an oil-producing yeast, yeast NYNU 1811166, and it is found that the strain can produce high oil and fat, and the content of unsaturated fatty acids beneficial to the human body in the produced oil and fat is high. In order to further improve the yield and content, a fermentation medium for high oil and fat production is developed, and through continuous optimization, a fermentation medium including 110.57 g / L of glucose, 0.32 g / L of calcium chloride dihydrate, 1.88 g / L of potassium dihydrogen phosphate, 8 g / L of yeast powder, 1 g / L of potassium nitrate, 0.3 g / L of magnesium sulfate heptahydrate, 3 mg / L of IAA, 0.015 g / L of ferric chloride hexahydrate, 0.0075 g / L of zinc sulfate heptahydrate, and 0.0005 g / L of copper sulfate pentahydrate is obtained. The total oil production of yeast cultured using the fermentation medium increased by 78.70%, while the oleic acid content in the oil increased by 6.45%, the linoleic acid content increased by 11.26%, the arachidonic acid content increased by 59.02%, and the eicosatrienoic acid content increased by 18.39%. The present invention further expands the microorganisms with high yield of unsaturated fatty acids and has great market development and application value.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to an oil-producing yeast capable of producing a high amount of unsaturated fatty acid oil and an application thereof. Background Art

[0002] Unsaturated fatty acids are a type of substance containing one or more double bonds whose carbon chains are not completely saturated with hydrogen atoms. They not only have physiological functions such as enhancing the relative fluidity of cell membranes, esterification of cholesterol, and reducing blood viscosity, but also participate in the synthesis of fat in the body. They are a type of substance essential to the human body.

[0003] At present, the commercial sources of unsaturated fatty acids mainly come from the extraction of fish and some crop raw materials. However, the production of unsaturated fatty acids from this source is easily limited by raw materials, and the extraction cost is high, resulting in high use costs. On the other hand, some microorganisms such as yeasts, molds, bacteria and algae can use carbohydrates, hydrocarbons and ordinary oils as carbon sources and nitrogen sources, supplemented by inorganic salts to produce and store oils during growth and metabolism, and microorganisms have the advantages of fast growth, high conversion efficiency, and easy production management, and have become an important way to obtain oils. Among them, oil-producing yeast, compared with other oil-producing microorganisms, has many advantages such as simple cultivation, large biomass, high oil content, wide substrate utilization spectrum, and strong adaptability in industrialization, and has become a research hotspot for oil-producing yeasts. After searching, patent CN112760242A discloses an oil-producing yeast Cryptococcus podzolicus OY-1 that produces oil and gluconic acid and its application, and its microbial oil content is 36%-52%. Patent CN112725208A discloses a yeast strain from Tibet that produces oil at low temperature and its application. The Curvibasidium yeast strain can use three different carbon sources, glucose, glycerol and xylose, to accumulate more oil, with the content of 54.7%, 34.1% and 67.76% of the cell dry weight respectively. Patent CN110885765A discloses a red yeast U13N3 and its culture method and application in the production of biological oils, with the intracellular oil content reaching 65% of the cell dry weight. However, the above research is mostly focused on the development and research of high-oil yeast resources, and relatively less attention is paid to increasing the content of unsaturated fatty acids in oils. In addition, different strains require different culture media, and the research and development optimization of the culture condition culture medium of the developed strains is also an important guarantee for improving the oil production and quality of the strains.

[0004] Therefore, it is an urgent need to continuously screen oil-producing yeasts that are highly rich in unsaturated fatty acids and develop corresponding culture media.

[0005] This study developed a high-oil-yielding yeast strain and, through culture medium optimization, ultimately increased oil yield while also significantly increasing the content of unsaturated fatty acids in the oil. Summary of the invention

[0006] The purpose of the present invention is to address the deficiencies of the prior art and to discover an oil-producing yeast that can produce high amounts of oil and has a high content of unsaturated fatty acids in the produced oil after being cultured with the developed high-yield oil fermentation medium.

[0007] To achieve the above purpose, the specific technical solution is as follows:

[0008] The first object of the present invention is to provide a yeast (Papiliotrema Tianchishanensis) NYNU1811166, which was deposited in the China Center for Type Culture Collection on December 30, 2021, with a deposit number of CCTCCNO: M20211667, and the deposit address is Wuhan University, Wuhan, China.

[0009] Furthermore, the strain was collected from roots, stems and fruits of different oil-producing plant samples in Tianchi Mountain area of ​​Luoyang, Henan Province.

[0010] Furthermore, the strain was sequenced by ITS sequence and 26SD1 / D2 sequence for molecular classification and identification.

[0011] Furthermore, the characteristic sequences of the strain are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0012] The second object of the present invention is to provide a high-yield oil fermentation medium for yeast NYNU1811166, wherein the components of the high-yield oil fermentation medium include: an organic nitrogen source, an inorganic nitrogen source, a carbon source, plant hormones, and inorganic salts.

[0013] Furthermore, the organic nitrogen source includes one or more of soy peptone, soybean cake powder, tryptone, yeast powder and gluten powder; the inorganic nitrogen source includes one or more of ammonium nitrate, ammonium sulfate, sodium nitrate, potassium nitrate and urea; the carbon source includes one or more of fructose, lactose, maltose, glucose, sucrose and dextrin; the plant hormone includes one or more of indoleacetic acid, indolebutyric acid, 6-benzyladenine, abscisic acid and kinetin; the inorganic salt includes calcium chloride dihydrate, potassium dihydrogen phosphate and magnesium sulfate heptahydrate.

[0014] Furthermore, the following components are included: glucose, calcium chloride dihydrate, potassium dihydrogen phosphate, yeast powder, potassium nitrate, magnesium sulfate heptahydrate, IAA, ferric chloride hexahydrate, zinc sulfate heptahydrate, and copper sulfate pentahydrate.

[0015] Furthermore, the high-yield oil fermentation medium includes the following components: 110.57 g / L glucose, 0.32 g / L calcium chloride dihydrate, 1.88 g / L potassium dihydrogen phosphate, 8 g / L yeast powder, 1 g / L potassium nitrate, 0.3 g / L magnesium sulfate heptahydrate, 3 mg / L IAA, 0.015 g / L ferric chloride hexahydrate, 0.0075 g / L zinc sulfate heptahydrate, and 0.0005 g / L copper sulfate pentahydrate.

[0016] The third object of the present invention is to provide the use of the yeast NYNU1811166 in the production of oils and fats, and to obtain oils and fats using the yeast NYNU1811166.

[0017] Furthermore, the yeast NYNU1811166 was cultured using a high-yield oil fermentation medium, and then oil was extracted from the bacteria.

[0018] Furthermore, the extraction method is an acid-heat method.

[0019] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0020] (1) The yeast NYNU1811166 screened by the present invention can produce high oil yield. When the strain biomass reaches about 15.81 g / L, the strain oil content reaches about 37.36%, which is far higher than the oil content of 20% of general strains. At the same time, the oil yield reaches 5.35 g / L, which also exceeds the oil yield of 3.5 g / L of general strains.

[0021] (2) The yeast NYNU1811166 selected by the present invention is cultivated with a high-yield oil fermentation medium, and the oil yield reaches 12.83g / L, which is increased to 78.70%; while increasing the total oil production, it can produce high-yield unsaturated fatty acids that are beneficial to the human body, and significantly increase the proportion of non-fatty acids such as oleic acid, linoleic acid, arachidonic acid and eicosatrienoic acid. The content of oleic acid, linoleic acid, arachidonic acid and eicosatrienoic acid accounts for 53.713% of the total fatty acid components, among which the oleic acid content is increased by 6.45%, the linoleic acid content is increased by 11.26%, the arachidonic acid content is increased by 59.02%, and the eicosatrienoic acid content is increased by 18.39%. The research and development of the yeast NYNU1811166 and the high-yield oil fermentation medium has great economic value for the industrial production of oils with high content of unsaturated fatty acids. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The cell morphology of yeast NYNU1811166;

[0023] Figure 2The effect of organic nitrogen sources on the fermentation oil production of yeast NYNU1811166;

[0024] Figure 3 The effect of inorganic nitrogen sources on the fermentation oil production of yeast NYNU1811166;

[0025] Figure 4 The effect of different carbon sources on the fermentation oil production of yeast NYNU1811166;

[0026] Figure 5 The effect of plant hormones on the fermentation oil production of yeast NYNU1811166;

[0027] Figure 6 The effect of the concentration of inorganic calcium chloride dihydrate on the oil production of yeast NYNU1811166;

[0028] Figure 7 The effect of the concentration of inorganic potassium dihydrogen phosphate on the fermentation oil production of yeast NYNU1811166;

[0029] Figure 8 This is the effect of the concentration of inorganic salt magnesium sulfate heptahydrate on the fermentation oil production of yeast NYNU1811166. DETAILED DESCRIPTION

[0030] The following reference Figure 1-8 The specific embodiments of the present invention are described in detail only to provide further explanation of the present invention, so as to better understand the present invention. However, it does not constitute a limitation of the present invention. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased on the market.

[0031] Example 1: Isolation and identification of yeast NYNU1811166

[0032] Different oil-producing plant samples were collected from Tianchi Mountain in Luoyang, Henan Province. The roots, stems and fruits of the plants were selected, rinsed with running water, air-dried, rinsed twice with sterile water, soaked in 75% ethanol for 30 seconds, 3% sodium hypochlorite solution for 3-5 minutes, and finally rinsed three times with sterile water and air-dried naturally. Use a sterile inoculation knife to cut the plant material into 1 cm 2 Tissue blocks of about 100 μg / mL were inoculated on YPD solid medium (containing 50 μg / mL chloramphenicol) and cultured upside down at 28°C. When colonies grew around the tissue blocks, single colonies were picked and transferred to new YPD medium. They were streaked and purified multiple times until a pure culture of a single colony was obtained. The culture was stored in a slant medium prepared with YPD solid culture for later use.

[0033] Example 2: Cultivation and identification of yeast NYNU1811166

[0034] (1) The medium of the present invention is formulated as follows (sterilization conditions are all 115° C., sterilization time 20 min), YPD solid medium: glucose 20 g / L, yeast powder 10 g / L, peptone 20 g / L, agarose 1.5%.

[0035] YPD liquid culture medium: yeast powder 10 g / L, peptone 20 g / L, glucose 20 g / L.

[0036] Seed culture medium: glucose 20g / L, yeast powder 5g / L, potassium dihydrogen phosphate 1g / L, magnesium sulfate heptahydrate 0.25g / L, potassium nitrate 10g / L, natural pH.

[0037] Basic fermentation medium: glucose 50g / L, yeast powder 5g / L, potassium dihydrogen phosphate 2.4g / L, magnesium sulfate heptahydrate 0.5g / L, potassium nitrate 1g / L, calcium chloride dihydrate 0.1g / L, ferric chloride hexahydrate 0.015g / L, zinc sulfate heptahydrate 0.0075g / L, copper sulfate pentahydrate 0.0005g / L, pH adjusted to 5.5.

[0038] The high-yield oil fermentation medium is: glucose 110.57g / L, calcium chloride dihydrate 0.32g / L, potassium dihydrogen phosphate 1.88g / L, yeast powder 8g / L, potassium nitrate 1g / L, magnesium sulfate heptahydrate 0.3g / L, IAA 3mg / L, ferric chloride hexahydrate 0.015g / L, zinc sulfate heptahydrate 0.0075g / L, and copper sulfate pentahydrate 0.0005g / L.

[0039] Cultivation method: The reserved yeast NYNU1811166 was inoculated into a YPD solid medium, and statically cultured at 28°C for 3 days. A single colony was picked and inoculated into a 50ml YPD liquid medium. After 3 days of shaking culture at 28°C, the inoculation amount was 5% and inoculated into a seed medium. After 3 days of shaking culture at 28°C, the seed liquid was transferred into 500ml of a basic fermentation medium and 500ml of a high-yield oil fermentation medium at an inoculation amount of 5%, respectively, and cultured at 28°C. Sampling was performed every day from the 2nd day, and the biomass, oil content and oil yield were measured respectively (the measurement method was the same as in Example 3). The culture was continuously cultured for 12 days. The measurement results showed that the strain NYNU1811166 entered the logarithmic growth phase on the 3rd day, the 6-8th day was the stable phase, and then entered the cell death phase. As time went on, the intracellular oil content began to accumulate from the 4th day, and then gradually increased. On the 8th day, the oil yield of the strain NYNU1811166 reached the maximum value.

[0040] The results showed that the oil yield of yeast NYNU1811166 fermented in the optimized fermentation medium (high oil-yield fermentation medium) was 12.83 g / L, an increase of 78.70% compared with the oil yield of 5.35 g / L before optimization (basic fermentation medium).

[0041] (2) Observation of the cell morphology of yeast NYNU1811166: The yeast was cultured on YPD solid medium and observed under a 100X microscope after culturing for 3 days at 28°C. The cells were round or oval in shape and the cell size was (3.58-5.09μm)×(3.65-4.96μm). The asexual reproduction method was budding. The colonies were milky white, round, raised, slightly transparent, smooth, moist, with neat edges and no pseudohyphae. After 3-5 days of liquid culture and standing for one month, obvious bacterial rings, bacterial films, and no sterile particles were observed, and there was precipitation at the bottom of the test tube.

[0042] (3) The results of observation of the strain under a 100X microscope are as follows Figure 1 shown.

[0043] (4) The genome of the strain was extracted, and the ITS sequence and 26SD1 / D2 sequence were sequenced for molecular classification identification. PCR amplification was performed using universal primers for fungal ITS sequence amplification (forward primer ITS1-F: 5'-TCCGTAGGTGAACCTGCGG-3'; reverse primer ITS4-R: 5'-TCCTCCGCTTATTGATATGC-3') and universal primers for 26SD1 / D2 sequence amplification (26SD1 / D2-F: 5'-GCATATCAATAAGCGGAGGAAAAG-3'; 26SD1 / D2-R: 5'-GGTCCGTGTTTCAAGACGG-3') with the genome as a template. The ITS sequence of 489 bp and the 26SD1 / D2 sequence of 597 bp were obtained. The sequences were placed in NCBI (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) for Blast comparison analysis. According to the analysis results, the strain was identified and named Papiliotrema Tianchishanensis.

[0044] (5) Among them, the NYNU1811166 ITS sequence, SEQ ID NO.1, is as follows: AAGGATCATTATTGATTGGTCGAAAGACCTTATCAGATTCTACCACCTCTGTGAACCGTTTGACCTCCGGGTCTAATATCAAACATCAGTGTAATGAACGTAAATCTTATAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCATGAAATCTCAATCCCTCTGGTTTTCTAACCGGTTGGATTGGACTTGGGCGTCTTGCCAGCAATGGCTCGCCTCAAATGACTTAGTGGAACATCCCACATCAGTGTTAGACGTAATAAGTTTCGTCTCTCCTTGTGGTGGTGACTGCTTAGAACCTGCCATCGCGCACTCTTTTGACTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAA

[0045] (6)NYNU181116626SrDNAD1 / D2 sequence, SEQ ID NO.2, as follows: AAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTGCTCAGTGCGTCCGAGTTGTAATCTATAGAAACGTTTTCCGTGCCGGACCGTGTCCAAGTCCCTTGGAACAGGGTA TCAAAGAGGGTGATAATCCCGTACTTGACACGACGACCGGTGCTCTGTGATACGTTTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTA CCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGACTGAGAGGCTCAGCCGGTTCTGCCGGTGTATTCCCTCAGTCGGGTCAACATCAGTTTTGTCC GGTGGATAAGGGCAGTTGGAAGGTAGCACCTTCGGGTGTGTTATAGCCAGCTGTCGCATACATTGGATGAGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACGTAATGGCTTTAAACGAC

[0046] Example 3: Determination method and results of indicators related to oil yield of yeast NYNU1811166

[0047] 1) Determination of biomass

[0048] Take 50mL of wet bacteria from the fermentation broth and place it in a glass culture dish with a weight of W0, place it in an oven at 100°C and dry it to constant weight, take it out and let it cool naturally, and weigh the total weight of the culture dish and dry bacteria, W1. The calculation of bacterial biomass is shown in formula 1:

[0049] Biomass (g / L) = (W1-W0) / (0.05) (Formula 1)

[0050] 2) Oil extraction and determination of oil yield of strains

[0051] In this study, the acid-heat method was used to extract microbial oil and determine its content: the fermentation broth was filtered to collect yeast cells, 0.1g of wet yeast cells was added with 600μL of 4mol / LHCl, vortexed for 1min, and then allowed to stand for 15min, and the vortexing was repeated 5 times. Boil in a boiling water bath for 30min, vortexed once during the period, ice bathed for 30min, 1.2mL of chloroform: methanol 1:1 solution was added, mixed and centrifuged at 8000rpm for 5min, on the one hand, the chloroform layer (bottom layer) was transferred to a 2mL centrifuge tube, an equal volume of 0.1% sodium chloride solution was added, vortexed for 10s, centrifuged at 5000rpm for 2min, and the chloroform layer was transferred to a 2mL centrifuge tube of known weight, chloroform was evaporated in a fume hood, and oil was collected. On the other hand, the bacteria were placed in an oven at 100℃ and dried to constant weight, taken out and cooled naturally, and the mass of dry bacteria was weighed. The calculation methods of oil content and oil yield are shown in formulas 2 and 3 respectively:

[0052] Oil content (%) = (weight of centrifuge tube with oil - net weight of centrifuge tube) / dry cell mass × 100% (Formula 2)

[0053] Oil yield (g / L) = biomass × oil content (Formula 3)

[0054] 3) Determination of residual sugar in fermentation broth

[0055] The SGD-IV reducing sugar analyzer was used to determine the residual sugar in the fermentation broth. First, the bubbles in the instrument pipeline were emptied and the blank sample and standard glucose sample were calibrated. Then the glucose content of the sample was determined: 500 μL of the appropriately diluted fermentation broth supernatant was drawn into the reaction pool, and the sample was automatically titrated with Fehling's A solution and Fehling's B solution. At this time, the transmittance of the solution changed, and the instrument calculated the glucose content in the sample based on the real-time change in transmittance.

[0056] (4) Results of determination of indicators related to oil production by yeast NYNU1811166

[0057] The yeast NYNU1811166 was fermented using the basic fermentation medium according to the culture method described in Example 2, and the residual sugar in the fermentation broth, the biomass of the strain, the oil content and the oil yield were detected. The results are shown in Table 1.

[0058] Table 1 Results of determination of lipid production related indicators of NYNU1811166 strain

[0059]

[0060] As can be seen from Table 1, the residual sugar in the fermentation broth in the culture medium is about 6%, indicating that the yeast NYNU1811166 has a high utilization rate of glucose in the basic culture medium. When the strain biomass reaches about 15.81 g / L, the strain oil content is measured to be about 37.36%, far exceeding the 20% oil content of general strains. At the same time, the oil yield reaches 5.35 g / L, which also exceeds the 3.5 g / L oil yield of general strains. It can be seen that the yeast NYNU1811166 is a high-oil-yielding yeast.

[0061] 4. Optimization of medium composition for high-yield oil fermentation

[0062] In this fermentation medium composition optimization, the fermentation culture method of yeast NYNU1811166 was carried out according to the culture method described in Example 2.

[0063] (1) Effects of different organic nitrogen sources on the oil production capacity of yeast NYNU1811166

[0064] The basic fermentation medium was used as the initial medium for optimization. The yeast powder in the basic fermentation medium was replaced with soy peptone, soybean cake powder, tryptone, yeast powder and gluten powder in turn. The effects of different organic nitrogen sources as the organic nitrogen source of the fermentation medium on the oil production capacity of yeast NYNU1811166 were investigated. The addition amount of organic nitrogen source was 10g / L. The results are as follows Figure 2 As shown, yeast powder can not only promote the growth of strains, but also facilitate the accumulation of oil by strains. At this time, the biomass of the strain is 14.58 g / L, the oil content is 37.01%, and the oil yield is 5.40 g / L. Therefore, yeast powder is selected as the organic nitrogen source of the fermentation medium.

[0065] (2) Effects of different inorganic nitrogen sources on oil production by yeast NYNU1811166

[0066] The optimized basic fermentation medium in (1) was used as the initial medium for optimization, wherein the yeast powder content in the basic fermentation medium was 10 g / L, and the potassium nitrate in the basic fermentation medium was replaced with ammonium nitrate, ammonium sulfate, sodium nitrate, potassium nitrate and urea in sequence, and the effects of different inorganic nitrogen sources as the inorganic nitrogen source of the fermentation medium on the oil production capacity of the yeast NYNU1811166 were investigated. The addition amount of inorganic nitrogen source was 2 g / L. The results are shown in Figure 3 As shown, the strain had the highest oil yield of 6.77 g / L when potassium nitrate was used as the fermentation medium, so potassium nitrate was selected as the inorganic nitrogen source for the fermentation medium.

[0067] (3) Effects of different carbon sources on lipid production by yeast NYNU1811166

[0068] The optimized basic fermentation medium in (2) was used as the initial medium for optimization, wherein the yeast powder content in the basic fermentation medium was 10 g / L, the potassium nitrate content was 2 g / L, and the glucose in the basic fermentation medium was replaced with fructose, lactose, maltose, glucose, sucrose and dextrin in turn. The effects of different types of carbon sources as the carbon source of the fermentation medium on the fermentation oil production of yeast NYNU1811166 were investigated. The carbon source addition amount was 100 g / L. The results are shown in Figure 4 As shown in the results, glucose can effectively promote the accumulation of intracellular lipids in the strain, making the lipid production of the strain reach 8.0 g / L. Therefore, glucose was selected as the carbon source of the fermentation medium.

[0069] (4) Effects of different plant hormones on oil production by yeast NYNU1811166

[0070] The optimized basic fermentation medium in (3) was used as the initial medium for optimization. The yeast powder content in the basic fermentation medium was 10 g / L, the potassium nitrate content was 2 g / L, and the glucose content was 100 g / L. The effect of adding different plant hormones on the fermentation oil production of yeast NYNU1811166 was investigated. This experiment investigated the effect of indoleacetic acid (IAA), indolebutyric acid (IBA), 6-benzyladenine (6-BA), abscisic acid (ABA), and kinetin (KT) at a final concentration of 2 mg / L on the oil production capacity of yeast NYNU1811166. The control group (CK) did not add any plant hormones. The results are as follows: Figure 5 As shown, the oil production of the yeast cultured with the addition of IAA was 8.94 g / L, which was 8.50% higher than that without the addition of plant hormones. Therefore, the addition of IAA was chosen to increase the oil production.

[0071] (5) Effects of inorganic salts on oil production by yeast NYNU1811166

[0072] The optimized basic fermentation medium in (4) was used as the initial medium for optimization, wherein the yeast powder content in the basic fermentation medium was 10 g / L, the potassium nitrate content was 2 g / L, the glucose content was 100 g / L, and 2 mg / L of indoleacetic acid (IAA) was added. On this basis, the effects of different concentrations of calcium chloride dihydrate, potassium dihydrogen phosphate, and magnesium sulfate heptahydrate on the oil accumulation of the yeast strain NYNU1811166 were investigated. The concentrations of calcium chloride dihydrate in the fermentation medium were set to 0.1 g / L, 0.2 g / L, 0.3 g / L, 0.4 g / L, and 0.5 g / L, respectively; the concentrations of potassium dihydrogen phosphate in the fermentation medium were set to 1 g / L, 2 g / L, 3 g / L, 4 g / L, and 5 g / L, respectively; and the concentrations of magnesium sulfate heptahydrate in the fermentation medium were set to 0.25 g / L, 0.5 g / L, 0.75 g / L, 1 g / L, and 1.25 g / L, respectively. The fermentation results are as follows: Figure 6 , Figure 7 , Figure 8 As shown, it was finally determined that the optimal concentrations of calcium chloride dihydrate, potassium dihydrogen phosphate and magnesium sulfate heptahydrate in the fermentation medium were 0.2 g / L, 2 g / L and 0.5 g / L, and the biomass of the yeast strain NYNU1811166 could reach 19.68 g / L, the oil content was 46.26%, and the oil yield was 9.10 g / L.

[0073] (6) Response surface analysis to optimize the interactive effects of the concentrations of various components of the fermentation medium on the lipid production of yeast NYNU1811166

[0074] The seven factors (yeast powder, glucose, potassium nitrate, IAA, potassium dihydrogen phosphate, magnesium sulfate heptahydrate, and calcium chloride dihydrate) identified in (1)-(5) were analyzed for significance with the help of Minitab16 software. Each factor was taken at two levels, high and low. The results were subjected to regression analysis using the Plackett-Burman test with N=12. The significance of the effects of various factors on the oil yield of yeast NYNU1811166 was compared, and the coefficients of each significant factor in the fitted regression equation were obtained. The steepest climbing experiment was designed based on this. The significant factors among the above seven factors were gradient designed according to the positive and negative effect values. The insignificant factors were selected at a high level if they had a positive effect in the Plackett-Burman test results, and at a low level if they had a negative effect. With the help of DesignExpert8.0 software, a 3-factor 3-level Box-Behnken experiment was designed with oil yield as the response value. The results were subjected to regression analysis to predict the level of each factor when the strain was at the maximum response value. The reliability of the predicted maximum oil yield was verified through shake flask fermentation experiments, and finally the optimal fermentation medium composition of the mutant strain was determined.

[0075] (7) Composition of fermentation medium

[0076] In summary, the results of the optimization experiment on the organic nitrogen source, inorganic nitrogen source, carbon source, plant hormone, inorganic salt type and the concentration of each component in the fermentation medium of yeast NYNU1811166 showed that the best oil-producing fermentation medium composition was: glucose 110.57g / L, calcium chloride dihydrate 0.32g / L, potassium dihydrogen phosphate 1.88g / L, yeast powder 8g / L, potassium nitrate 1g / L, magnesium sulfate heptahydrate 0.3g / L, IAA3mg / L, ferric chloride hexahydrate 0.015g / L, zinc sulfate heptahydrate 0.0075g / L, copper sulfate pentahydrate 0.0005g / L. The yeast NYNU1811166 was fermented and cultured with this optimized medium, and its oil yield was finally measured to be 12.83g / L, which was 78.70% higher than before optimization.

[0077] 5. Analysis of fatty acid composition of lipid-producing yeast

[0078] The strain NYNU1811166 was cultured in the basal medium and the high-yield oil fermentation medium according to the culture method described above for 8 days, and then its intracellular oil was extracted. The fatty acid composition and content of microbial oil were determined according to the third method of GB5009.168-2016. The results are shown in Table 2.

[0079] Table 2 Fatty acid composition of oil produced by fermentation of strain NYNU1811166

[0080]

[0081] As can be seen from Table 2, by detecting the fatty acid composition of strain NYNU1811166 in the basic medium and fermentation medium, the strain produces unsaturated fatty acids that have important health functions for the human body, and the content of oleic acid, linoleic acid, arachidonic acid and eicosatrienoic acid accounts for 53.713% of the total fatty acid composition, indicating that the strain can produce high-yield unsaturated fatty acids that are beneficial to the human body. Detection of the oil composition of yeast cells cultured in the fermentation medium showed that while the total oil production was increased, the proportion of fatty acids not containing oleic acid, linoleic acid, arachidonic acid and eicosatrienoic acid was significantly increased, among which the oleic acid content increased by 6.45%, the linoleic acid content increased by 11.26%, the arachidonic acid content increased by 59.02%, and the eicosatrienoic acid content increased by 18.39%.

[0082] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. Yeast Papiliotrema Tianchishanensis NYNU 1811166, characterized in that It was deposited in the China Center for Type Culture Collection on December 30, 2021, with the deposit number CCTCC NO: M 20211667, and the deposit address is Wuhan University, Wuhan, China.

2. The yeast Papiliotrema Tianchishanensis NYNU 1811166 according to claim 1, characterized in that The strain was identified by molecular classification through ITS sequence and 26S D1 / D2 sequence sequencing.

3. The yeast Papiliotrema Tianchishanensis NYNU 1811166 according to claim 1, characterized in that The characteristic sequences of the strain are shown in SEQ ID NO.1 and SEQ ID NO.

2.

4. Use of the yeast Papiliotrema Tianchishanensis NYNU 1811166 as claimed in claim 1 in producing oils and fats.

5. The use according to claim 4, characterized in that: The yeast Papiliotrema Tianchishanensis NYNU 1811166 according to any one of claims 1 to 3 is cultured using a high-yield oil fermentation medium, and then oil is extracted from the yeast NYNU 1811166.

Images