A recombinant VSV vector, a recombinant VSV virus, and a preparation method and application thereof

Abstract

The present invention relates to the field of biotechnology, and in particular to a recombinant VSV vector, a recombinant VSV virus, and a preparation method and application thereof. The present invention inserts a nucleic acid fragment encoding a CCHFV GPC sequence lacking 53 amino acids and a reporter gene into a VSV vector plasmid at the same time, thereby rescuing a recombinant virus expressing CCHFV GPC and EGFP at the same time. The recombinant VSV virus can be replicated to a higher titer, and multiple rounds of replication occur after infecting cells, with high sensitivity, and can efficiently and quickly evaluate the neutralizing antibody titer against CCHFV envelope glycoprotein GPC, vaccine immune effect, CCHFV invasion mechanism research, and efficient packaging of pseudovirus particles for single-round infection of CCHFV. Due to the inclusion of a reporter gene, the infection of pseudoviruses can be detected more sensitively, conveniently, intuitively, and efficiently, which is conducive to carrying out high-throughput research work and greatly reduces costs.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a recombinant VSV vector, a recombinant VSV virus, and a preparation method and application thereof. Background Art

[0002] Crimean-Congo hemorrhagic fever virus (CCHFV), also known as Xinjiang hemorrhagic fever virus, belongs to the order Bunyavirales, family Nairoviridae, genus Orthonairovirus, and is a segmented, enveloped, negative-strand RNA virus. The genome is divided into three segments, S, M, and L, encoding viral nucleocapsid protein, envelope glycoprotein, and RNA-dependent RNA polymerase, respectively. Crimean-Congo hemorrhagic fever (CCHF) caused by CCHFV infection is a virulent, highly pathogenic, and highly transmissible infectious disease prevalent in China, Russia, Europe, the Middle East, and Africa. Its clinical symptoms are fever, multi-organ hemorrhage, necrosis, and functional failure, and the mortality rate is extremely high, generally between 30% and 50%, and up to 80%. There is currently no specific drug or preventive vaccine for CCHFV.

[0003] CCHFV is a biosafety level 3 virus. All operations on live CCHFV viruses must be completed in a biosafety level 3 laboratory, which severely limits the research on CCHFV. Therefore, it is of great significance to establish a virus model that can be operated in and out of a biosafety level 2 laboratory for efficient and rapid evaluation of neutralizing antibodies, vaccine immune effects, invasion inhibitors, and invasion-related mechanisms against CCHFV.

[0004] Pseudovirus systems can simulate the invasion process of real viruses to a certain extent. Existing studies have established CCHFV pseudovirus model systems that can be operated in biosafety level 2 laboratories, such as the Vesicular stomatitis virus (VSV) single-round infection pseudovirus system and the replication-competent pseudovirus system that package the CCHFV envelope glycoprotein GPC. However, there are currently no reports of successfully rescuing the virus by simultaneously inserting the CCHFV envelope glycoprotein GPC sequence and the sequence containing EGFP or other reporter genes into the VSV virus vector. Summary of the invention

[0005] In view of this, the present invention provides a recombinant VSV vector, a recombinant VSV virus, and a preparation method and application thereof. The recombinant virus expressing CCHFV GPC and a reporter gene prepared by the present invention can be used for the evaluation of neutralizing antibody titer against CCHFV, vaccine immune effect, research on CCHFV invasion mechanism, as a candidate vaccine for preventing CCHFV infection, and can also be used for packaging efficient single-round infection CCHFV pseudovirus particles.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] A CCHFV envelope glycoprotein GPC mutant, which lacks the last 53 amino acids at the C-terminus in the sequence of the wild-type CCHFV envelope glycoprotein GPC and contains a single point mutation of R516K or L518V;

[0008] The amino acid sequence of the wild-type CCHFV envelope glycoprotein GPC is shown in SEQ ID NO.23.

[0009] The present invention also provides a nucleic acid fragment encoding a CCHFV envelope glycoprotein GPC mutant, comprising:

[0010] i), a nucleic acid fragment encoding the CCHFV envelope glycoprotein GPC mutant according to claim 1; and / or

[0011] ii) A nucleic acid fragment encoding the amino acid sequence shown in SEQ ID NO.2.

[0012] The nucleic acid fragment encoding the CCHFV envelope glycoprotein GPC mutant in the present invention is codon-optimized, and its sequence is:

[0013] 1), a sequence as shown in SEQ ID NO: 1; or

[0014] II), a sequence obtained by mutating the 1547th base from G to A in the sequence shown in SEQ ID NO: 1;

[0015] III), a sequence obtained by mutating the 1552nd base from C to G in the sequence shown in SEQ ID NO: 1;

[0016] IV), a nucleotide sequence obtained by replacing, deleting or adding one or more bases in the nucleotide sequence shown in I), II) or III), and the protein encoded by the nucleotide sequence has the same or similar function; or

[0017] V), a sequence having at least 90% homology with any of the sequences described in I) to IV).

[0018] Among them, the amino acid sequence of the CCHFV envelope glycoprotein GPC mutant lacking the last 53 amino acids at the C-terminus is shown in SEQ ID NO.2, and its encoding gene is codon optimized, and the optimized nucleotide sequence is shown in SEQ ID NO.1.

[0019] A mutant lacking the last 53 amino acids at the C-terminus and containing a R516K single point mutation amino acid sequence, the nucleic acid sequence of the gene encoding it is codon optimized, and the optimized sequence is a sequence obtained by mutating the 1547th base from G to A in the sequence shown in SEQ ID NO:1 (a mutant lacking the last 53 amino acids at the C-terminus).

[0020] The mutant lacks the last 53 amino acids at the C-terminus and contains the L518V single point mutation amino acid sequence, and the optimized sequence of the nucleic acid sequence of the encoding gene is: the sequence obtained by mutating the 1552nd base from C to G in the sequence shown in SEQ ID NO:1.

[0021] The present invention also provides a recombinant VSV vector, comprising: a VSV vector plasmid, a nucleic acid fragment encoding a CCHFV envelope glycoprotein GPC mutant according to the present invention, and a target gene;

[0022] The VSV vector plasmid is a plasmid containing a VSV genome sequence and encoding a G gene of a VSV envelope glycoprotein deleted.

[0023] In some embodiments, the target gene is a reporter gene; the reporter gene is GFP, EGFP, mCherry, RFP, YFP, mNeonGreen, TurboGFP, mGreenLantern, ZsGreen, mKate2, NanoLuc luciferase, Firefly luciferase, Gaussia luciferase, Renilla luciferase, etc.

[0024] In some specific embodiments, the target gene is the reporter gene EGFP. The present invention inserts the nucleic acid fragment encoding the CCHFV GPC mutant lacking 53 amino acids and the reporter gene into the VSV vector plasmid at the same time, and rescues the recombinant virus expressing CCHFV GPC and EGFP at the same time. The recombinant VSV virus can replicate to a higher titer, and multiple rounds of replication occur after infecting cells, with high sensitivity. The highest titers on BHK-21 cells and Vero E6 cells reach 10 7 PFU / mL, 10 6PFU / mL can be used to efficiently and quickly evaluate the neutralizing antibody effect against CCHFV envelope glycoprotein GPC, the vaccine immune effect, and the study of CCHFV invasion mechanism. Because it contains reporter genes, it is conducive to high-throughput research, such as screening host factors related to CCHFV infection and screening inhibitors of invasion.

[0025] The target gene is an antigen protein gene; the antigen protein gene includes a gene encoding a viral antigen, a tumor antigen, or an expression host and pathogenic microorganism antigen.

[0026] In the present invention, the nucleic acid fragment encoding CCHFV envelope glycoprotein GPC is:

[0027] A nucleic acid fragment having a nucleotide sequence as shown in SEQ ID NO.1, or a nucleic acid fragment in which one or more nucleotides are substituted, deleted or added in the sequence shown in SEQ ID NO.1 and the protein encoded has the same or similar function, or a nucleic acid fragment having at least 90% homology with the sequence shown in SEQ ID NO.1 and encoding a GPC protein having an amino acid sequence shown in SEQ ID NO.2.

[0028] In the present invention, the amplification primers for the nucleic acid fragment encoding the C-terminal deletion of 53 amino acids GPC include: an upstream primer pC-CCHFV-GPC-F (sequence such as SEQ ID NO.3) and a downstream primer pC-CCHFV-GPC-R (sequence such as SEQ ID NO.4).

[0029] In the present invention, the VSV vector plasmid is a vector plasmid comprising a VSV genome sequence and a plasmid encoding a G gene deletion of a VSV envelope glycoprotein. In some embodiments, the backbone of the VSV vector plasmid is a pBlueScript series vector, a pSMART series vector, or a bacterial artificial chromosome BAC series vector.

[0030] In the present invention, the reporter gene is GFP, EGFP, mCherry, RFP, YFP, mNeonGreen, TurboGFP, mGreenLantern, ZsGreen, mKate2, NanoLuc luciferase, Firefly luciferase, Gaussialuciferase, Renilla luciferase, etc. In some specific embodiments, the reporter gene is EGFP.

[0031] The present invention also provides a replicable pseudovirus system of vesicular stomatitis virus (VSV), comprising the recombinant virus plasmid of the present invention, an auxiliary plasmid containing VSV virus N, P, L, G genes, and a packaging cell.

[0032] In the present invention, the auxiliary plasmid containing VSV virus N, P, L, G genes includes auxiliary plasmid 1, auxiliary plasmid 2, auxiliary plasmid 3 and auxiliary plasmid 4, which express N, P, L, G proteins respectively. In some embodiments, the mass ratio of the recombinant virus plasmid to auxiliary plasmid 1, auxiliary plasmid 2, auxiliary plasmid 3 and auxiliary plasmid 4 is 10: (2-8): (3-6.5): (1-3): (1-8). In some specific embodiments, the ratio is specifically 10: 3: 3: 3: 3, 10: 5: 4: 2: 1, 10: 5: 3: 1: 2, 10: 2: 6.5: 1.25: 2, 10: 2.5: 6.5: 1.25: 2, 10: 8: 4: 1: 8, preferably 10: 3: 3: 3: 3.

[0033] In the present invention, the packaging cell is a 293T cell expressing T7 RNA polymerase.

[0034] The present invention also provides a recombinant VSV virus, which is formed by packaging the recombinant virus plasmid of the present invention via packaging cells.

[0035] In some embodiments, the packaging cell is a 293T cell expressing T7 RNA polymerase.

[0036] The present invention also provides a method for preparing the recombinant VSV virus, comprising:

[0037] The recombinant VSV vector of the present invention (named pBlue-VSV(ΔG)-CCHFV-GPCΔ53), auxiliary plasmid 1, auxiliary plasmid 2, auxiliary plasmid 3 and auxiliary plasmid 4 respectively containing VSV virus N gene, P gene, L gene and G gene are co-transfected into host cells expressing T7 RNA polymerase, the supernatant is collected, and the recombinant VSV virus is obtained by passage.

[0038] The mass ratio of the recombinant virus plasmid to auxiliary plasmid 1, auxiliary plasmid 2, auxiliary plasmid 3 and auxiliary plasmid 4 is 10:3:3:3:3.

[0039] In some embodiments, helper plasmid 1, helper plasmid 2, helper plasmid 3 and helper plasmid 4 respectively contain the full-length sequences of the open reading frames of the N, P, L and G genes of the VSV virus, and the primer sequences are shown in SEQ ID NO.5 to SEQ ID NO.12.

[0040] The host cells are 293T cells expressing T7 RNA polymerase; the co-transfection is performed after the host cells are cultured to a confluence of 80%-90%.

[0041] The cell line used for subculturing is BHK-21, and the number of subculturing times is 2 to 3 times.

[0042] In the present invention, the passaging also includes a step of adding a neutralizing antibody against VSV G protein to neutralize the VSV virus containing the G protein.

[0043] Further, in some embodiments, the construction process of the recombinant VSV recombinant virus provided by the present invention specifically comprises the following steps:

[0044] (1) Construction of pC-CCHFV-GPCΔ53 plasmid

[0045] Using the codon-optimized synthesized GPC nucleotide sequence as a template, primers pC-CCHFV-GPC-F and pC-CCHFV-GPC-R were designed to amplify GPC with 53 amino acids deleted at the C-terminus by PCR, and then the amplified GPC was ligated with a pCAGGS vector double-digested with restriction endonucleases EcoR I and Xho I to construct a GPC expression plasmid pC-CCHFV-GPCΔ53 with 53 amino acids deleted at the C-terminus; the nucleotide sequence and amino acid sequence of the envelope glycoprotein GPC of the plasmid are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0046] (2) Construction of recombinant plasmids pC-VSV-N, pC-VSV-P, pC-VSV-L and pC-VSV-G

[0047] Using pBlue-VSV-GFP plasmid as a template, primers pC-VSV-NF, pC-VSV-NR, pC-VSV-PF, pC-VSV-PR, pC-VSV-LF, pC-VSV-LR, pC-VSV-GF and pC-VSV-GR were designed to amplify the open reading frames of N, P, L and G genes of VSV, respectively. Then, the open reading frames were ligated with the pCAGGS vector double-digested with restriction endonucleases EcoR I and Xho I to construct the N, P, L and G expression plasmids pC-VSV-N, pC-VSV-P, pC-VSV-L and pC-VSV-G of VSV.

[0048] (3) Construction of recombinant plasmid pBlue-VSV(ΔG)-CCHFV-GPCΔ53 plasmid

[0049] Using pC-CCHFV-GPCΔ53 plasmid as a template, primers pBlue-VSV-GPC-F and pBlue-VSV-GPC-R were designed to amplify the target fragment CCHFV-GPCΔ53, which was then ligated with the pBlue-VSV-GFP plasmid double-digested with restriction endonucleases Mlu I and Xho I to construct the recombinant plasmid pBlue-VSV(ΔG)-CCHFV-GPCΔ53 lacking VSV G gene and expressing CCHFV-GPCΔ53 fragment;

[0050] (4) Rescue of VSV-CCHFV-GFP recombinant reporter virus

[0051] When 293T-T7 cells expressing T7 RNA polymerase were cultured to 80%-90% confluence, the recombinant plasmid pBlue-VSV(ΔG)-CCHFV-GPCΔ53 and auxiliary plasmids pC-VSV-N, pC-VSV-P, pC-VSV-L and pC-VSV-G were co-transfected into 293T-T7 cells by calcium phosphate transfection. The supernatant was collected 48 hours after transfection and passaged three times in BHK-21. Neutralizing antibodies against VSV G protein were added during the passages, and finally a reporter virus in which the recombinant VSV virus simultaneously expressed CCHFV GPC and the reporter gene EGFP was obtained, which was named VSV-CCHFV-GFP.

[0052] Furthermore, the gene sequences of the primers pC-CCHFV-GPC-F and pC-CCHFV-GPC-R in step (1) are shown as SEQ ID NO.3 and SEQ ID NO.4.

[0053] Furthermore, the sequences of the primers pC-VSV-NF, pC-VSV-NR, pC-VSV-PF, pC-VSV-PR, pC-VSV-LF, pC-VSV-LR, pC-VSV-GF, and pC-VSV-GR in step (2) are shown as SEQ ID NO.5 to SEQ ID NO.12, respectively.

[0054] Furthermore, the sequences of the primers pBlue-rVSV-GPC-F and pBlue-rVSV-GPC-R in step (3) are shown as SEQ ID NO.13 and SEQ ID NO.14.

[0055] The present invention also provides the use of the recombinant VSV vector, the replicable pseudovirus system, the recombinant VSV virus or the recombinant VSV virus prepared by the preparation method of the present invention in at least one of the following aspects:

[0056] I) Application in the evaluation of CCHFV neutralizing antibody titer;

[0057] II), application in the study of CCHFV invasion mechanism;

[0058] III), application in the preparation of CCHFV vaccine, or application in the evaluation of CCHFV vaccine immune effect;

[0059] IV) Application in packaging of pseudoviral particles for single-round infection of CCHFV.

[0060] The present invention also provides a CCHFV vaccine, comprising the recombinant VSV virus of the present invention, the recombinant VSV virus prepared by the preparation method of the present invention, or the recombinant VSV vector of the present invention.

[0061] The present invention also provides a reporter virus VSV-CCHFV-GFP prepared by the above method, which is based on a VSV vector and simultaneously expresses CCHFV GPC protein and EGFP protein.

[0062] The present invention also provides the use of the recombinant VSV virus (VSV-CCHFV-GFP for short) prepared above in the evaluation of neutralizing antibody titer of CCHFV, the study of invasion mechanism and the packaging of pseudoviral particles of CCHFV single-round infection.

[0063] The present invention inserts a nucleic acid fragment encoding a truncated sequence of CCHFV envelope glycoprotein GPC and a reporter gene into a VSV vector plasmid at the same time, thereby rescuing a recombinant virus that simultaneously expresses CCHFV envelope glycoprotein GPC and a reporter gene (EGFP). Compared with the prior art, the present invention has the following advantages:

[0064] 1. Compared with the single-round infection pseudovirus system, the replicable pseudovirus of the present invention can be replicated to a higher titer, and multiple rounds of replication occur after infecting cells, with high sensitivity, easy virus seed preparation, and low cost;

[0065] 2. Compared with the existing replicable pseudovirus, in addition to expressing the envelope glycoprotein gene GPC, the recombinant VSV vector and recombinant VSV virus of the present invention also insert a reporter gene expressing EGFP. The insertion of the reporter gene can detect the infection of the pseudovirus more sensitively, conveniently, intuitively and efficiently, reducing costs. It is more difficult to construct an envelope glycoprotein GPC and a reporter gene that simultaneously express a larger fragment, which is the advantage of this patent and the difference from the previous patent. Because it contains the EGFP reporter gene, the infection of the virus can be intuitively and quickly judged by instruments such as fluorescence microscopes, flow cytometers, and high-content scanning.

[0066] 3. Compared with the existing replicable pseudovirus, the sequence length and the sequence of the coding gene expressing the envelope glycoprotein GPC are different. The intracellular segment of the existing GPC protein lacks 14 amino acids. The present invention lacks 53 amino acids at the C-terminus of the GPC protein in the intracellular segment and optimizes the nucleotide sequence, which ultimately significantly improves the virus titration and rescue efficiency.

[0067] 4. Compared with the existing replicable pseudovirus, the rescue method is different. The prior art discloses that the rescue is completed with the assistance of poxvirus expressing T7 polymerase, while the present invention directly transfects the eukaryotic expression plasmid, which is more convenient and does not require the subsequent purification of the virus, thus reducing the occurrence of poxvirus contamination.

[0068] 5. The GPC protein of the rescued VSV-CCHFV-GPC recombinant virus contains the initially designed C-terminal 53 amino acid deletion and R516K mutation. The key point mutation R516K can significantly improve the efficiency of packaging CCHFV pseudovirus particles for a single round of infection, which is significantly higher than the existing GPC protein with a 14 amino acid deletion in the intracellular segment or containing the L518V point mutation. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] Figure 1 is the map of pBlue-VSV(ΔG)-CCHFV-GPCΔ53 plasmid;

[0070] Figure 2 Identification of VSV-CCHFV-GFP recombinant virus: Figure 2 A shows the mutation site R516K in VSV-CCHFV-GFP sequencing; Figure 2 B shows the plaque morphology of VSV-CCHFV-GFP virus and VSV-GFP virus;

[0071] Figure 3 The growth curve of VSV-CCHFV-GFP virus on BHK-21 cells and Vero E6 cells was detected by spot formation assay (FFA);

[0072] Figure 4 To detect the expression of Gc on the cell surface of A549 cells infected with VSV-CCHFV-GFP virus by flow cytometry;

[0073] Figure 5 To test the sensitivity of cells from different sources to infection with VSV-CCHFV-GFP: Figure 5 A is the flow cytometry detection of the infection efficiency of VSV-CCHFV-GFP after infecting cells from different sources; Figure 5 B is the fluorescence image of VSV-CCHFV-GFP infected cells from different sources detected by fluorescence microscopy;

[0074] Figure 6 Evaluation of the neutralization effect of different antibodies on VSV-CCHFV-GFP and VSV-GFP: Figure 6 A is the neutralization curve of anti-CCHFV-Gc and anti-VSV-G neutralizing antibodies against VSV-CCHFV-GFP; Figure 6 B is the neutralization curve of anti-CCHFV-Gc and anti-VSV-G neutralizing antibodies against VSV-GFP; Figure 6 C is the IC50 value of the neutralization titer of the antibody against VSV-CCHFV-GFP and VSV-GFP; Figure 6 D is the fluorescence image of VSV-CCHFV-GFP and VSV-GFP in the presence and absence of anti-CCHFV-Gc and anti-VSV-G neutralizing antibodies;

[0075] Figure 7 VSV-CCHFV-GFP was used to study the effect of heparan sulfate on endocytosis: Figure 7 A is the flow cytometry detection of the expression of heparan sulfate on the cell surface after knocking out B3GAT3 and B4GALT7; Figure 7 B Flow cytometry analysis of the infection efficiency of VSV-CCHFV-GFP and VSV-GFP in A549 cells infected with wild type or knockout B3GAT3 or B4GALT7.

[0076] Figure 8 The GPC protein of the VSV-CCHFV-GFP recombinant virus is used to package pseudoviral particles for single-round infection: Figure 8 A is the efficiency of pseudovirus infection of BHK-21 cells observed under a fluorescence microscope with different deletions or mutations of CCHFV GPC protein packaging; Figure 8 B is the flow cytometry detection of the efficiency of BHK-21 infection by pseudoviruses packaged with different deletions or mutations of CCHFV GPC protein. DETAILED DESCRIPTION

[0077] The present invention provides a recombinant VSV vector, a recombinant VSV virus, and a preparation method and application thereof. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters for implementation. It is particularly important to point out that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications of this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0078] The test materials used in the present invention are all common commercial products and can be purchased in the market.

[0079] In the present invention, the gene full length of CCHFV envelope glycoprotein GPC after human codon optimization is 5055bp, and the sequence is cloned into the plasmid vector pUC57. Then, the pUC57-GPC plasmid is used as a template to construct an expression plasmid pC-CCHFV-GPCΔ53 containing a GPC coding sequence with 53 amino acids missing from the C-terminus, and on this basis, the CCHFV GPC (Δ53) fragment is cloned into the pBlue-VSV-GFP plasmid to construct a pBlue-VSV (ΔG)-CCHFV-GPCΔ53 recombinant plasmid. The plasmid is co-transfected with VSV auxiliary plasmids pC-VSV-N, pC-VSV-P, pC-VSV-L and pC-VSV-G into 293T-T7 cells stably expressing T7 RNA polymerase, and a recombinant VSV virus expressing CCHFV envelope glycoprotein GPC and a reporter gene EGFP is rescued. This reporter virus can be used to evaluate the neutralizing antibody titer and vaccine immune effect against CCHFV envelope glycoprotein GPC, study the invasion mechanism of CCHFV, serve as a candidate vaccine to prevent CCHFV infection, and can also be used to package efficient single-round infection CCHFV pseudovirus particles.

[0080] The products and materials used in the present invention are from the following sources:

[0081] Escherichia coli Stbl3 competent cells and calcium phosphate transfection reagent were purchased from Thermo Fisher Scientific Inc.; pUC57-CCHFV-GPC plasmid was synthesized by Nanjing GenScript Co., Ltd.; pCAGGS vector was purchased from Addgene; pBlue-VSV-GFP plasmid was obtained by inserting the full-length sequence of VSV genome and GFP sequence using pBlueScript as the backbone according to conventional technical means in the field; 293T-T7 cells stably expressing T7 RNA polymerase were previously constructed and preserved by our research group; VSV-GFP virus and VSV (ΔG) / G single-round infection virus particle virus were prepared and preserved by our research group, and anti-CCHFV-Gc and anti-VSV-G neutralizing antibodies were prepared and preserved by our research group; mouse-anti-HS monoclonal antibody was purchased from USBio; goat-anti-mouse IgM conjugated with Alexa Fluor 647 and goat-anti-human IgG conjugated with Alexa Fluor 647 were purchased from Thermo Fisher Scientific Inc.; restriction endonucleases and Next Ultra IIQ5 high-fidelity DNA polymerase was purchased from NEB Biotechnology Co., Ltd.; MUL assembly cloning kit was purchased from Shanghai Langjing Biotechnology Co., Ltd.

[0082] The present invention will be further described below in conjunction with embodiments:

[0083] Example 1 Preparation of Crimean-Congo Hemorrhagic Fever Virus (CCHFV) Fluorescent Reporter Virus Based on Vesicular Stomatitis Virus (VSV) Vector

[0084] (1) Construction of pC-CCHFV-GPCΔ53 plasmid

[0085] The CCHFV envelope glycoprotein GPC used in this experiment is the envelope glycoprotein GPC (NP_950235) of the CCHFV IbAr10200 strain. After human codon optimization, it was synthesized by Nanjing GenScript and cloned into plasmid pUC57 to obtain plasmid pUC57-CCHFV-GPC. Then, using plasmid pUC57-CCHFV-GPC as a template, corresponding primers were designed to amplify GPC with 53 amino acids missing at the C-terminus, specifically including the following primers:

[0086] Upstream primer pC-CCHFV-GPC-F (sequence as SEQ ID NO.3) Downstream primer pC-CCHFV-GPC-R (sequence as SEQ ID NO.4)

[0087] SEQ ID NO.3:

[0088] GTCTCATCATTTTGGCAAAGAATTCGCCACCATGCACATCTCCCT GATGTACGCCATC

[0089] SEQ ID NO.4:

[0090] AGGGAAAAAGATCTGCTAGCTCGAGTCAGCCTCTGGTCCGTCTGCAGCACTTGAAAC

[0091] Next Ultra IIQ5 DNA polymerase was used to amplify the GPC fragment with a C-terminal deletion of 53 amino acids. The PCR reaction system was as follows: template (pUC57-CCHFV-GPC) 10 ng, upstream primer pC-CCHFV-GPC-F and downstream primer 2 μL each, enzyme 25 μL, water added to 50 μL, reaction conditions: 98°C 30 s, (98°C 10 s, 58°C 30 s, 72°C 3 min 30 s) 32 cycles, 72°C 10 min, and stored at 4°C.

[0092] After the PCR product was subjected to agarose gel electrophoresis, the target band was recovered using a gel recovery kit.

[0093] Plasmid pCAGGS was double-digested with restriction endonucleases EcoR I and Xho I. The digestion system was as follows: pCAGGS 3 μg, EcoR I 2 μL and Xho I 2 μL, 10xBuffer 5 μL, add water to 50 μL, digest at 37°C for 3 h, and the digestion product was subjected to agarose gel electrophoresis, and the target band was recovered using a gel recovery kit.

[0094] The PCR fragment recovered from the amplification and the double-enzyme-digested vector were connected by homologous recombination. The connection system was pCAGGS 50 ng, PCR product 50 ng, MUL enzyme 5 μL, and the total volume was 10 μL; the connection conditions were 50° C. for 1 h.

[0095] Take 5 μL of the ligation product and add it to the competent E. coli Stbl3. After mixing, place it in an ice bath for 25 minutes, heat stress at 42°C for 60 seconds, and place it in an ice bath for 90 seconds. Add 800 μL of LB medium without antibiotics, place it on a shaker for 45 minutes, centrifuge it, take a small amount of LB to resuspend the bacteria, evenly spread it on an LB plate with ampicillin resistance, and invert the plate for culture. After the colony is formed, pick a single clone colony, inoculate it in an LB medium containing ampicillin resistance, shake it overnight, extract the plasmid, and perform Sanger sequencing verification to obtain the plasmid pC-CCHFV-GPCΔ53.

[0096] (2) Construction of recombinant plasmids pC-VSV-N, pC-VSV-P, pC-VSV-L and pC-VSV-G

[0097] Using pBlue-VSV-GFP plasmid as a template, primers pC-VSV-NF, pC-VSV-NR, pC-VSV-PF, pC-VSV-PR, pC-VSV-LF, pC-VSV-LR, pC-VSV-GF, and pC-VSV-GR were designed to amplify the open reading frames of the N, P, L, and G genes of VSV, respectively. The primer sequences are shown in SEQ ID NO.5 to SEQ ID NO.12. The specific PCR reaction system and reaction conditions refer to the above method.

[0098] SEQ ID NO.5:

[0099] AGGGAAAAAGATCTGCTAGCTCGAGTCAGCCTCTGGTCCGTCT

[0100] GCAGCACTTGAAAC

[0101] SEQ ID NO.6:

[0102] AGGGAAAAAGATCTGCTAGCTCGAGTCATTTGTCAAATTCTG

[0103] ACTTAGCAT

[0104] SEQ ID NO.7:

[0105] GTCTCATCATTTTGGCAAAGAATTCGCCACCATGGATAATCTCA

[0106] CAAAAGTTCGTG

[0107] SEQ ID NO.8:

[0108] GAGGGAAAAAGATCTGCTAGCTCGAGCTACAGAGAATATTT

[0109] GACTCTCGCC

[0110] SEQ ID NO.9:

[0111] GTCTCATCATTTTGGCAAAGAATTCGCCACCATGGAAGTCCAC

[0112] GATTTTGAGACC

[0113] SEQ ID NO.10:

[0114] AGAGGGAAAAAGATCTGCTAGCTCGAGTTAATCTCTCCAAG

[0115] AGTTTTCCTCGTGTAGG

[0116] SEQ ID NO.11:

[0117] TTTTGGCAAAGAATTCGCCACCATGAAGTGCCTTTTGTACTTAG

[0118] SEQ ID NO.12:

[0119] GATCTGCTAGCTCGAGTTACTTTCCAAGTCGGTTCATCTC。

[0120] After agarose gel electrophoresis, the PCR product was cut from the gel to recover the target fragment, and the recovered target fragment was ligated with the pCAGGS vector after double digestion with restriction endonucleases EcoR I and Xho I. The ligation reaction and subsequent transformation were as described above. After Sanger sequencing, the expression plasmids pC-VSV-N, pC-VSV-P, pC-VSV-L and pC-VSV-G of VSV N, P, L and G were obtained.

[0121] (3) Construction of pBlue-VSV(ΔG)-CCHFV-GPCΔ53 recombinant plasmid

[0122] Using the pC-CCHFV-GPCΔ53 plasmid constructed above as a template, the upstream primer pBlue-VSV-GPC-F and the downstream primer pBlue-VSV-GPC-R were designed. The primer sequences are shown in SEQ ID NO.13 and SEQ ID NO.14. The target fragment CCHFV-GPC Δ The 53 fragment was recovered from the gel and ligated to the pBlue-VSV-GFP plasmid that had been double-digested with restriction endonucleases Mlu I and Xho I. The ligation reaction and subsequent transformation were as described above. After Sanger sequencing, the recombinant plasmid pBlue-VSV(ΔG)-CCHFV-GPCΔ53( Figure 1 );

[0123] SEQ ID NO.13:

[0124] TAACAGAGATCGATCTGTTTACGCGTCACTATGCACATCTCCCTGAT GTACGCCATCCTGTG

[0125] SEQ ID NO.14:

[0126] GCTAGCGCGCAATTGCCTCGAGCGTGATATCTGTTAGTTTTTTCAT ACCTAGCAGGATTTGAGTCAGCCTCTGGTCCGTCTGCAGCAC

[0127] 2. Rescue of VSV-CCHFV-GFP Recombinant Reporter Virus

[0128] 293T-T7 cells were inoculated in a 10 cm dish. When the cell confluence reached 80%-90%, pBlue-VSV(ΔG)-CCHFV-GPCΔ53 plasmid and auxiliary plasmids pC-VSV-N, pC-VSV-P, pC-VSV-L and pC-VSV-G were transfected by calcium phosphate transfection at an optimized mass ratio of 10:3:3:3:3. After 16 hours of transfection, the medium was replaced with DMEM containing 10% FBS, and the supernatant was collected after 48 hours. The supernatant was continuously passaged three times on BHK-21 cells, and neutralizing antibodies against VSV-G were added at the same time to finally obtain the VSV-CCHFV-GFP recombinant reporter virus, and the harvested supernatant was stored at -80°C.

[0129] 3. Identification and characterization of the VSV-CCHFV-GFP recombinant reporter virus

[0130] (1) Sanger sequencing to identify the VSV-CCHFV-GFP virus. After the RNA genome was extracted from the virus, the full genome of the VSV-CCHFV-GFP virus was amplified by RT-PCR and sent for full-length Sanger sequencing. The sequencing results showed that the 1547th base of the GPC protein of CCHFV mutated from "G" to "A", and the amino acid sequence changed from "R" to "K" at the 516th base. Figure 2 A. No nucleotide changes were found at other positions.

[0131] (2) Crystal violet staining was used to detect the plaque morphology of VSV-CCHFV-GFP and VSV-GFP viruses (VSV virus expressing green fluorescent protein EGFP, prepared and preserved by our research group and used as a control in subsequent applications).

[0132] VSV-CCHFV-GFP and VSV-GFP viruses were infected with Vero E6 cells at 10-fold gradient dilutions, and 1% methylcellulose was added 2 hours after infection. After 48 hours of infection, the cells were fixed with 4% PFA, washed with PBS three times, stained with 1% crystal violet for 15 minutes, and the crystal violet was washed off again to observe the virus plaque morphology. The results are shown in Figure 2 As shown in B, VSV-CCHFV-GFP forms smaller needle-shaped plaques, while VSV-GFP forms larger round plaques.

[0133] (3) Determination of the growth curve of VSV-CCHFV-GFP on BHK-21 and Vero E6 cells

[0134] VSV-CCHFV-GFP was used to infect BHK-21 and Vero E6 cells at an MOI of 0.01. The cell supernatants were collected at 2h, 6h, 12h, 24h, 48h, 60h and 72h, respectively, and stored at -80°C. Vero E6 cells were inoculated in a 96-well plate. When the cell confluence was close to 100%, the supernatants collected above were diluted 10 times and infected with Vero E6 cells, with 3 replicates for each dilution. The cells were infected at 37°C for 2h. After 2h of infection, 1% methylcellulose was added and cultured continuously. After 48h, 4% PFA was added to fix the cells. After washing 3 times with PBS, the cells were stained with 1% crystal violet for 15min, and the crystal violet was washed off again. The number of spots in the 96 wells was recorded, and the plaque-forming unit per milliliter (Plaque-forming unit per milliliter, PFU / mL) of the virus was calculated. The results are shown in Figure 3 As shown, the titer of VSV-CCHFV-GFP on BHK-21 cells can reach up to 10 7 PFU / mL, the highest titer on VeroE6 cells can reach 10 6 PFU / mL.

[0135] (4) Detection of Gc expression on cell surface after VSV-CCHFV-GFP infection

[0136] A549 cells were infected with VSV-CCHFV-GFP at an MOI of 0.01. After 24 hours of infection, the cells were digested with TrypLE, washed twice with ice-cold PBS, and anti-CCHFV-Gc antibody was used as the primary antibody. Human IgG1 isotype Control antibody was used as the isotype control antibody. The cells were incubated on ice for 30 minutes. After the incubation, the cells were washed once with pre-cold PBS. Goat-anti-human IgG conjugated with Alexa Fluor647 secondary antibody was added and incubated on ice for another 30 minutes. After the incubation, the cells were washed once with pre-cold PBS, and 2% PFA was added to fix the cells for 10 minutes. After fixation, the cells were washed twice with PBS, and the cells were resuspended in PBS with 1% FBS. The expression of Gc protein was detected by flow cytometry. The results are shown in Figure 2. Figure 4 As shown, the surface of A549 cells infected with VSV-CCHFV-GFP can express the Gc protein with the correct conformation.

[0137] 4. Application of VSV-CCHFV-GFP recombinant reporter virus in screening CCHFV susceptible cell lines

[0138] VSV-CCHFV-GFP was used to infect A549 cells, Hela cells, Huh7 cells, SW13 cells, 293T cells, Vero E6 cells, BHK-21 cells and MDCK cells at an MOI of 0.01. After 20 hours of infection, GFP fluorescence was observed under a fluorescence microscope, and then the cells were digested and fixed with 2% PFA for 10 minutes. After washing the cells once with PBS, the cells were resuspended in PBS with 1% FBS, and the virus infection efficiency was detected by flow cytometry. The results are shown in Figure 5 As shown, BHK-21 cells and Huh7 cells are highly susceptible cell lines to CCHFV; A549 cells, 293T cells and Vero E6 cells are moderately susceptible cell lines to CCHFV; Hela cells and MDCK cells are low susceptible cell lines to CCHFV.

[0139] 5. Application of VSV-CCHFV-GFP recombinant reporter virus in evaluating CCHFV neutralizing antibody titer

[0140] The anti-CCHFV-Gc antibody and anti-VSV-G antibody were diluted in a 5-fold ratio and then incubated with VSV-CCHFV-GFP and VSV-GFP viruses at 37°C for 1 h. After the incubation, the incubation mixture was added to a 96-well plate filled with A549 cells and cultured at 37°C for 16 h. After 16 h, GFP fluorescence was observed under a fluorescence microscope, and the cells were collected and fixed with 2% PFA for 10 min. After washing the cells once with PBS, the cells were resuspended in PBS containing 1% FBS, and the virus infection efficiency was detected by flow cytometry. The IC of the antibody was calculated by nonlinear regression in GraphPad Prism software. 50 The result is Figure 6 As shown, anti-CCHFV-Gc can well neutralize VSV-CCHFV-GFP virus but cannot neutralize VSV-GFP virus, while anti-VSV-G can well neutralize VSV-GFP virus but cannot neutralize VSV-CCHFV-GFP virus.

[0141] 6. Application of VSV-CCHFV-GFP recombinant reporter virus in studying CCHFV invasion mechanism

[0142] Used to study the important regulatory role of genes BAGAT3 or B4GALT7 in the heparan sulfate (HS) production pathway.

[0143] Using CRISPR / Cas9 technology, sgRNA targeting BAGAT3 and B4GALT7 was designed to construct A549 cells knocking out BAGAT3 and B4GALT7. The sgRNA sequences are shown in SEQ ID NO.15 and SEQ ID NO.16.

[0144] SEQ ID NO.15: CCAGAGCCCATACCTGGCAT;

[0145] SEQ ID NO. 16: CACTACAAGACCTATGTCGG.

[0146] sgRNA was cloned into the lentiviral vector lentiCRISPRv2 (Addgene#52961) and co-transfected with lentiviral packaging plasmids psPAX2 and pMD2G into 293T cells. A549 cells were transduced with the packaged lentivirus and selected with puromycin for 7 days to obtain A549 cells with BAGAT3 and B4GALT7 knockout.

[0147] Wild-type, BAGAT3 or B4GALT7 knockout A549 cells were digested with TrypLE, then washed twice with ice-cold PBS, and incubated on ice for 30 minutes using mouse-anti-HS monoclonal antibody as primary antibody and mouse IgM isotype control antibody as isotype control antibody. After incubation, the cells were washed once with pre-cold PBS, and goat-anti-mouse IgM conjugatedwithAlexa Fluor 647 secondary antibody was added, and incubated on ice for another 30 minutes. After incubation, the cells were washed twice with pre-cold PBS, resuspended in PBS containing 1% FBS, and HS expression on the cell surface was detected by flow cytometry. The results are shown in Figure 2. Figure 7 As shown in A, the expression of HS on the surface of A549 cells with BAGAT3 and B4GALT7 knocked out was significantly reduced.

[0148] VSV-CCHFV-GFP and VSV-GFP viruses were used to infect wild-type and BAGAT3 and B4GALT7 knockout A549 cells at an MOI of 1, respectively. Cells were collected 12 hours after infection, fixed with 2% PFA for 10 minutes, washed once with PBS, and resuspended in PBS containing 1% FBS. The virus infection efficiency was detected by flow cytometry. Figure 7As shown in B, the infection efficiency of the VSV-CCHFV-GFP reporter virus in A549 cells with BAGAT3 and B4GALT7 knocked out was significantly decreased, while the infection efficiency of the VSV-GFP virus did not change, indicating that HS plays an important role in the process of CCHFV virus invading cells, and the VSV-CCHFV-GFP reporter virus can be easily and quickly used in the study of virus invasion mechanism.

[0149] 7. Application of GPC protein of VSV-CCHFV-GFP recombinant reporter virus in packaging single-round infectious virus particles

[0150] The obtained VSV-CCHFV-GFP recombinant reporter virus GPC protein not only contains the designed C-terminal 53 amino acid deletion, but also has a mutation from "R" to "K" at position 516. Taking advantage of this feature, the GPC protein is used to package more efficient CCHFV single-round infection pseudovirus particles.

[0151] (1) Construction of CCHFV single-round infection pseudovirion plasmids (pC-CCHFV-GPCΔ14, pC-CCHFV-GPCΔ53-L518V, pC-CCHFV-GPCΔ53-R516K)

[0152] Using plasmid pUC57-CCHFV-GPC as a template, corresponding primers were designed to amplify GPC with 14 amino acids deleted at the C-terminus to construct plasmid pC-CCHFV-GPCΔ14. Specifically, the primers included are as follows:

[0153] Upstream primer pC-CCHFV-GPCΔ14-F (sequence as SEQ ID NO.17) Downstream primer pC-CCHFV-GPCΔ14-R (sequence as SEQ ID NO.18)

[0154] SEQ ID NO.17:

[0155] GTCTCATCATTTTGGCAAAGAATTCGCCACCATGCACATCTCCCTGAT GTACGCCATC.

[0156] SEQ ID NO.18:

[0157] AGGGAAAAAGATCTGCTAGCTCGAGTCAGTCGGCCAGTCTCTCCCCG TCCAGC.

[0158] Using plasmid pUC57-CCHFV-GPCΔ53 as a template, corresponding mutation primers were designed to construct plasmid pC-CCHFV-GPCΔ53-L518V containing the L518V mutation site. Specifically, the following primers were included:

[0159] Upstream primer pC-CCHFV-GPC-F (sequence such as SEQ ID NO.3) and downstream primer pC-CCHFV-GPCΔ53-L518V-R (sequence such as SEQ ID NO.19)

[0160] SEQ ID NO. 19: CAGACAGCACCCTTCTAGAGCCGGTGGAGGCCTTG.

[0161] The upstream primer is pC-CCHFV-GPCΔ53-L518V-F (sequence is SEQ ID NO.20) and the downstream primer is pC-CCHFV-GPC-R (sequence is SEQ ID NO.4).

[0162] SEQ ID NO. 20: CTCTAGAAGGGTGCTGTCTGAGGAACCCAGCGACG.

[0163] Using plasmid pUC57-CCHFV-GPCΔ53 as a template, corresponding primers were designed to construct plasmid pC-CCHFV-GPCΔ53-R516K containing the R516K mutation site. Specifically, the following primers were included:

[0164] The upstream primer is pC-CCHFV-GPC-F (sequence is SEQ ID NO.3) and the downstream primer is pC-CCHFV-GPCΔ53-R516K-R (sequence is SEQ ID NO.21).

[0165] SEQ ID NO.21:

[0166] CAGCAGCCTTTTAGAGCCGGTGGAGGCCTTGCCGAT.

[0167] The upstream primer is pC-CCHFV-GPCΔ53-R516K-F (sequence is SEQ ID NO.22) and the downstream primer is pC-CCHFV-GPC-R (sequence is SEQ ID NO.4).

[0168] SEQ ID NO. 22: CACCGGCTCTAAAAGGCTGCTGTCTGAGGAACCCAG.

[0169] The GPC fragment was amplified using Next Ultra IIQ5 DNA polymerase. The PCR reaction system was as follows: 10 ng template, 2 μL of upstream primer and downstream primer, 25 μL of enzyme, and water was added to 50 μL. The reaction conditions were: 98°C for 30 s, 32 cycles of (98°C for 10 s, 58°C for 30 s, and 72°C for 3 min 30 s), 72°C for 10 min, and stored at 4°C.

[0170] After the PCR product was subjected to agarose gel electrophoresis, the target band was recovered using a gel recovery kit.

[0171] Plasmid pCAGGS was double-digested with restriction endonucleases EcoR I and Xho I. The digestion system was as follows: pCAGGS 3 μg, EcoR I 2 μL and Xho I 2 μL, 10xBuffer 5 μL, add water to 50 μL, digest at 37°C for 3 h, and the digestion product was subjected to agarose gel electrophoresis, and the target band was recovered using a gel recovery kit.

[0172] The PCR fragment recovered from the amplification and the double-enzyme-digested vector were connected by homologous recombination. The connection system was pCAGGS 50 ng, PCR product 50 ng, MUL enzyme 5 μL, and the total volume was 10 μL; the connection conditions were 50° C. for 1 h.

[0173] Take 5 μL of the ligation product and add it to the competent E. coli Stbl3. After mixing, place it in an ice bath for 25 minutes, heat stress at 42°C for 60 seconds, and place it in an ice bath for 90 seconds. Add 800 μL of LB medium without antibiotics, place it on a shaker for 45 minutes, and take a small amount of LB to resuspend the bacteria after centrifugation. Spread it evenly on an LB plate with ampicillin resistance, and invert the plate for culture. After the colony is formed, pick a single clone colony, inoculate it in an LB medium containing ampicillin resistance, shake it overnight, extract the plasmid, and perform Sanger sequencing verification to obtain plasmids pC-CCHFV-GPCΔ14, pC-CCHFV-GPCΔ53-L518V, and pC-CCHFV-GPCΔ53-R516K.

[0174] (2) Packaging of pseudoviral particles in a single round of CCHFV infection

[0175] 293T cells were inoculated in a 12-well cell culture plate. When the cell confluence reached 80%-90%, 3 μL Fugene HD transfection reagent was used to transfect pC-CCHFV-GPCΔ14, pC-CCHFV-GPCΔ53, pC-CCHFV-GPCΔ53-L518V and pC-CCHFV-GPCΔ53-R516K respectively. After 24 hours of transfection, the medium was replaced with DMEM containing 10% FBS. VSV (ΔG) / G single-round infection virus particles trans-packaged with G protein were infected at a dose of MOI = 3. After 2 hours of infection, it was replaced with DMEM containing 10% FBS containing neutralizing antibodies against VSV-G. The supernatant collected after 24 hours was stored at -80°C.

[0176] (3) CCHFV single round infection with pseudovirion particles

[0177] BHK-21 cells were inoculated in a 96-well cell culture plate. When the cell confluence reached 80%-90%, the culture medium was discarded and 75 μL of 2% FBS DMEM and 25 μL of packaged single-round infection pseudovirus mixture were added. After 12 hours of infection, photos were taken under a fluorescence microscope. The cells were then digested and fixed with 2% PFA for 10 minutes. After washing the cells once with PBS, the cells were resuspended in 1% FBS PBS and the virus infection efficiency was detected by flow cytometry. The results are shown in Figure 2. Figure 8 As shown, the packaging efficiency of GPC protein is low when the last 14 amino acids or 53 amino acids of the C-terminus are missing; if L518V mutates based on the missing 53 amino acids, the infection efficiency is increased by about 15 times; if R516K mutates based on the missing 53 amino acids, the infection efficiency is increased by about 76 times.

[0178] Example 2 Rescue of VSV-CCHFV-GFP recombinant reporter virus

[0179] The rescue of VSV-CCHFV-GFP recombinant reporter virus was carried out according to the method of Example 1. The difference from Example 1 is that the pBlue-VSV(ΔG)-CCHFV-GPCΔ53 plasmid and the auxiliary plasmids pC-VSV-N, pC-VSV-P, pC-VSV-L and pC-VSV-G were transfected at a ratio of 10:5:4:2:1, 10:5:3:1:2, 10:2:6.5:1.25:2, 10:2.5:6.5:1.25:2, and 10:8:4:1:8, respectively, and only a small amount of GFP fluorescence was produced. The results show that although these transfection ratios can successfully rescue the VSV-CCHFV-GFP recombinant reporter virus, the rescue efficiency is low.

[0180] The above are only preferred embodiments of the present invention. It should be pointed out that, for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A CCHFV envelope glycoprotein GPC mutant, characterized in that: It lacks the last 53 amino acids of the C-terminus in the sequence of the wild-type CCHFV envelope glycoprotein GPC, and has a single point mutation of R516K; The amino acid sequence of the wild-type CCHFV envelope glycoprotein GPC is shown in SEQ ID NO.

23.

2. A nucleic acid fragment encoding the CCHFV envelope glycoprotein GPC mutant according to claim 1.

3. The nucleic acid fragment according to claim 2, characterized in that The sequence of the nucleic acid fragment is a sequence obtained by mutating the 1547th base from G to A in the sequence shown in SEQ ID NO:

1.

4. A recombinant VSV vector, characterized in that: include: VSV vector plasmid, the nucleic acid fragment according to claim 2 or 3 and the target gene; The VSV vector plasmid is a plasmid containing a VSV genome sequence and encoding a G gene deletion of a VSV envelope glycoprotein; The nucleic acid fragment is located at the position of the original G gene in the VSV genome sequence.

5. The recombinant VSV vector according to claim 4, characterized in that The target gene is a reporter gene; the reporter gene is GFP, EGFP, mCherry, RFP, YFP, mNeonGreen, TurboGFP, mGreenLantern, ZsGreen, mKate2, NanoLuc luciferase, Firefly luciferase, Gaussia luciferase or Renillaluciferase.

6. The recombinant VSV vector according to claim 4, characterized in that The target gene is an antigen protein gene; the antigen protein gene includes a gene encoding a viral antigen, a tumor antigen, or an expression host and pathogenic microorganism antigen.

7. The recombinant VSV vector according to claim 4, characterized in that The backbone of VSV vector plasmids includes pBlueScript series vectors, pSMART series vectors or bacterial artificial chromosome BAC series vectors.

8. A replicable pseudovirus system of vesicular stomatitis virus (VSV), characterized in that: include: The recombinant VSV vector according to any one of claims 4 to 7, a helper plasmid consisting of the VSV virus N gene, P gene, L gene and G gene, and a packaging cell; The packaging cells are 293T cells expressing T7 RNA polymerase.

9. The replicable pseudovirus system according to claim 8, characterized in that: The auxiliary plasmids containing the N, P, L, and G genes of the VSV virus include auxiliary plasmid 1, auxiliary plasmid 2, auxiliary plasmid 3, and auxiliary plasmid 4, which express N, P, L, and G proteins, respectively.

10. The replicable pseudovirus system according to claim 9, characterized in that: The mass ratio of the recombinant virus plasmid and auxiliary plasmid 1, auxiliary plasmid 2, auxiliary plasmid 3 and auxiliary plasmid 4 is 10:(2-8):(3-6.5):(1-3):(1-8).

11. The replicable pseudovirus system according to claim 10, characterized in that: The mass ratio of the recombinant virus plasmid to auxiliary plasmid 1, auxiliary plasmid 2, auxiliary plasmid 3 and auxiliary plasmid 4 is 10:3:3:3:

3.

12. A recombinant VSV virus, characterized in that: The recombinant VSV vector according to any one of claims 4 to 7 is packaged by packaging cells; The packaging cells are 293T cells expressing T7 RNA polymerase.

13. The method for preparing the recombinant VSV virus according to claim 12, characterized in that: include: Co-transfecting a host cell expressing T7 RNA polymerase with the recombinant VSV vector according to any one of claims 4 to 7 and a helper plasmid, collecting the supernatant, and passage to obtain a recombinant VSV virus; The auxiliary plasmids include: auxiliary plasmid 1, auxiliary plasmid 2, auxiliary plasmid 3, and auxiliary plasmid 4, which contain the N gene, P gene, L gene, and G gene of the VSV virus respectively; The host cell is a 293T cell expressing T7 RNA polymerase.

14. The preparation method according to claim 13, characterized in that: The mass ratio of the recombinant VSV vector, auxiliary plasmid 1, auxiliary plasmid 2, auxiliary plasmid 3 and auxiliary plasmid 4 is 10:3:3:3:

3.

15. The preparation method according to claim 13, characterized in that: The co-transfection is performed after the host cells are cultured to 80%-90% confluence.

16. The preparation method according to claim 13, characterized in that: The cell line used for subculturing is BHK-21, and the number of subculturing times is 2 to 3 times.

17. The preparation method according to any one of claims 13 to 16, characterized in that: The passaging also includes the step of adding neutralizing antibodies against VSV G protein.

18. Use of the CCHFV envelope glycoprotein GPC mutant according to claim 1, the nucleic acid fragment according to claim 2 or 3, the recombinant VSV vector according to any one of claims 4 to 7, the replicable pseudovirus system according to any one of claims 8 to 11, the recombinant VSV virus according to claim 12, or the recombinant VSV virus prepared by the preparation method according to any one of claims 13 to 17 in at least one of the following aspects: 1) Application in the evaluation of CCHFV neutralizing antibody titer; 2) Application in the study of CCHFV invasion mechanism; 3) Application in the preparation of CCHFV vaccines or in the evaluation of the immune effect of CCHFV vaccines; 4) Application in the packaging of pseudoviral particles for single-round infection of CCHFV.

19. A CCHFV vaccine, comprising the recombinant VSV virus according to claim 12 or the recombinant VSV virus prepared by any one of the preparation methods of claims 13 to 17.

Images