A low-cost rapeseed hybrid seed production method

By mixing and harvesting the Ogura CMS sterile line and the restorer line 9538R and spraying herbicides, the problems of high cost and difficulty in ensuring the purity of rapeseed hybrid seed production have been solved, and low-cost, high-purity rapeseed hybrid production has been achieved, which is suitable for mechanized seed production.

CN117397574BActive Publication Date: 2025-09-26HUAZHONG AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311522058.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-15
Publication Date
2025-09-26
Estimated Expiration
2043-11-15

AI Technical Summary

Technical Problem

Existing rapeseed hybrid seed production methods have problems such as high cost, difficulty in ensuring purity, and complex reproduction. Especially when using cytoplasmic male sterile lines, changes in light and temperature conditions affect the purity of hybrids, and different materials need to be harvested separately, which increases the cost of seed production.

Method used

The Ogura CMS sterile line and the restorer line 9538R containing sulfonylurea herbicide resistance sites were mixed and harvested. High-purity rapeseed hybrids were obtained by spraying herbicides at the seedling stage. The low fruit set rate of 9538R and environmental humidity regulation were used to improve the fruit set rate, saving the manpower and material resources of material drilling and male parent removal.

Benefits of technology

It reduces the cost of rapeseed hybrid seed production, simplifies the breeding process, ensures the purity of hybrid seeds, adapts to mechanized production, and reduces the investment of manpower, material and financial resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117397574B_ABST
    Figure CN117397574B_ABST
Patent Text Reader

Abstract

The present invention discloses a low-cost rapeseed hybrid seed production method, which relates to the field of utilizing hybrid vigor in Brassica napus. The method comprises: (1) hybridizing an Ogura CMS sterile line as the female parent with a plant containing a sulfonylurea herbicide resistance locus to obtain an Ogura CMS sterile line containing the sulfonylurea herbicide resistance locus; (2) planting the Ogura CMS sterile line containing the sulfonylurea herbicide resistance locus as the female parent and an Ogura CMS restorer line as the male parent in a 5:1 ratio in a seed production field, employing conventional field management methods, and harvesting the Brassica napus seeds when mature; and (3) planting the harvested seeds in a conventional field and spraying the sulfonylurea herbicide at the seedling stage to obtain Brassica napus hybrid seeds of higher purity. The present invention mixes the improved Ogura CMS sterile line with the female sterile restorer line in a seed production field to obtain the first generation of offspring, and sprays herbicides at the seedling stage to obtain rapeseed hybrids with higher purity. This method can greatly reduce the cost of seed production. The present invention also provides an effective method for the reproduction of the restorer line 9538R.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of hybrid vigor utilization of Brassica napus, in particular to a low-cost rapeseed hybrid seed production method, and specifically to an application of Brassica napus female sterile 9538R as a restorer line in rapeseed hybrid seed production. Background Art

[0002] Utilizing heterosis is an effective measure to increase crop yields (Kempe & Gils 2011, Wang & Deng 2018). Compared to other crops, rapeseed exhibits significant heterosis, potentially increasing yields by 30-50%. Hybrid vigor in rapeseed can be exploited through four approaches: artificial emasculation, chemical male sterilization, male sterility, and self-incompatibility seed production. Male sterility is widely used in rapeseed hybrid seed production. Male sterility is primarily categorized into three types: photothermosensitive male sterility (PSMS), nuclear male sterility (GMS), and cytoplasmic male sterility (CMS). Photothermosensitive male sterility (PSMS) utilizes controlled light and temperature conditions to propagate sterile materials and produce hybrids. However, within certain light and temperature ranges, it is susceptible to microparticle formation, which can affect the purity of hybrid offspring. Cytoplasmic male sterility can produce completely sterile lines, but its propagation requires a temporary support line. Furthermore, hybrid seed production requires the removal of 50% of fertile plants, increasing seed production costs (Xia et al. 2016). Early applications of cytoplasmic male sterility primarily focused on Polima CMS (Singh & Brown 1991, Liu et al. 2016) and Shaanxi 2A CMS (Liao et al. 2010), both of which are homologous cytoplasmic male sterility lines. Although their restorer sources are widely available, these two lines are susceptible to temperature-induced microparticle formation, which can affect the purity of hybrid offspring. In recent years, the allogenic cytoplasmic sterility (Ogura CMS) system has been widely used in rapeseed hybrid production (Brown et al 2003, Desloire et al 2003, Duroc et al 2005, Yamagishi & Bhat 2014). This is due in part to its complete sterility, unaffected by environmental factors. Furthermore, the mechanism of the Ogura CMS system has been elucidated: expression of the mitochondrial gene orf138 leads to abnormal mitochondrial development and pollen abortion (Bellaoui et al 1999). The PPR-B protein, encoded by the restorer gene RFO, translocates to the mitochondria and specifically binds to orf138 mRNA, blocking its translation and elongation, thereby inhibiting ORF138 protein synthesis and rendering hybrid progeny fertile (Uyttewaal et al 2008). The use of male sterile lines is a common method in modern hybrid seed production, which generally adopts the "three-line two-field method", namely the male sterile line, the maintainer line, the restorer line, the parent breeding field (the male sterile line is the female parent hybridized with the maintainer line), and the hybrid seed production field (the male sterile line is the female parent hybridized with the restorer line).

[0003] Utilizing hybrid vigor requires not only ensuring the purity of male sterile and restorer lines, but also ensuring that the propagation of the sterile lines and hybrid seed production are simple, easy, and low-cost. To exploit hybrid vigor in rapeseed, scientists typically crossbreed high-purity sterile lines with restorer lines to produce hybrids. While this method is theoretically convenient and feasible, it also has drawbacks. First, different materials must be sown in rows; second, the parent lines must be harvested separately, otherwise the purity of the hybrid will be compromised, significantly increasing the cost of seed production. To minimize this cost, we have proposed a novel approach: using a female sterile restorer line as the male parent for hybridization with a sterile line. The restorer line provides sufficient pollen but does not produce seeds, allowing for the mixing and harvesting of the parent lines without compromising the purity of the hybrid, thus reducing the manpower, material, and financial resources required for rapeseed hybrid seed production. Summary of the Invention

[0004] The purpose of the present invention is to overcome the shortcomings and deficiencies of the prior art and provide a low-cost rapeseed hybrid seed production method.

[0005] The object of the present invention is achieved in this way.

[0006] Specifically, the present invention comprises the following steps:

[0007] ① Using the Ogura CMS sterile line as the female parent, hybridizing it with a plant containing a sulfonylurea herbicide resistance locus to obtain the Ogura CMS sterile line containing the sulfonylurea herbicide resistance locus;

[0008] ② The Ogura CMS sterile line containing sulfonylurea herbicide resistance loci was used as the female parent, and the Ogura CMS restorer line was used as the male parent. The two lines were planted in a 5:1 ratio in a seed production field. Conventional field management methods were used, and the Brassica napus seeds were harvested at maturity.

[0009] ③ Plant the harvested seeds in ordinary fields and spray sulfonylurea herbicides at the seedling stage to obtain high-purity Brassica napus hybrids;

[0010] in:

[0011] The Ogura CMS sterile line in step ① is Z11A, and the improved Ogura CMS sterile line is Z11AH, which has resistance to sulfonylurea herbicides;

[0012] The Ogura CMS restorer line in step ② was 9538R, which had no difference from the wild type during the vegetative growth period; during the reproductive growth period, the pollen viability of 9538R was normal; compared with the wild type, the radial width of the pistil of 9538R increased by 10-50%, and the longitudinal length decreased by 7.4-21.8%; the style length of 9538R was also reduced by 40.4-57.1% compared with the wild type; at maturity, the silique length of 9538R was 1.47 cm, which was significantly lower than that of the wild type (4.68 cm); in addition, the average number of grains per silique of 9538R was 2. The seed set rate of 9538R (Wuhan, 0.95±0.18; Lanzhou, 3.83±0.34) was 93.4-96.1% lower than that of the wild type (Wuhan, 19.28±0.68; Lanzhou, 19.15±0.94). The seed set rate of 9538R was extremely low, and its use as a restorer line could save the labor, material, and financial resources required for seeding different materials in drills and removing the male parent at maturity. Furthermore, both bagging and selfing with a double-layer tent increased the seed set rate of 9538R. Therefore, it is possible to propagate restorer lines with low seed set rates by artificially increasing the environmental humidity.

[0013] In step ③, the purity of the hybrid was identified using the dominant marker BnRfo-AS2F / BnRfo-AS2S linked to the RFO gene.

[0014] Compared with the prior art, the present invention has the following advantages and positive effects:

[0015] The improved Ogura CMS sterile line and the female sterile restorer line are mixed and harvested in the seed production field to obtain the first generation of offspring. By spraying herbicides at the seedling stage, rapeseed hybrids with higher purity are obtained. This method can save the manpower, material and financial resources required for sowing different materials in rows and cutting the male parent at maturity, and is suitable for mechanization. In addition, the biggest problem of the low fruit set rate 9538R as a restorer line is its self-reproduction. The present invention verified in Wuhan and Lanzhou that increasing the environmental humidity can significantly improve the fruit set rate of 9538R, which lays a solid foundation for 9538R as a restorer line for rapeseed hybrid seed production. The present invention also provides an effective method for the reproduction of the restorer line 9538R. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is the optimization of Ogura CMS sterile line Z11A and rapeseed hybrid seed production;

[0017] Figure 2 is the average number of grains per silique of 9538R and wild type under different conditions;

[0018] Figure 3 This is the growth status of the Ogura CMS sterile line and the 9538R restorer line at maturity in the field;

[0019] Figure 4 It is a rapeseed hybrid seed production model;

[0020] Figure 5 There are significant differences in pistil development between 9538R and the wild type.

[0021] References

[0022] 1. Guan Wenjie, Zhang Fugui, Yan Guixin, Ma Qiming, Wu Xiaoming. Research progress on the mechanism of herbicide resistance and germplasm creation of rapeseed. Chinese Journal of Oil Crops, 2021, 43: 1159-1173

[0023] 2. Liao Zhiqiang, Kuang Chenguang, Xu Lifang, Zhou Chengyong. Main types of cytoplasmic male sterility in Chinese Brassica napus and their application in breeding practice. Chinese Agricultural Science Bulletin, 2010, 26(3): 105-110

[0024] 3. Peng Hai, Zhang Jing, Zhou Junfei. A method for rapid and accurate detection of hybrid rice seed purity. Chinese Patent, CN102912010A. 2013-02-06

[0025] 4. Song Fengshun, Ni Dahu, Ni Jinlong, Li Li, Yang Jianbo. Review of hybrid rice seed purity detection methods. Jiangsu Agricultural Sciences, 2016, (6): 6

[0026] 5. Kempe K&Gils M.Pollination control technologies for hybridbreeding.Molecular Breeding, 2011,27:417-437

[0027] 6. Wang H&Deng XW. Development of the "Third-Generation" Hybrid Rice in China. Genomics Proteomics Bioinformatics, 2018, 16(6): 393-396

[0028] 7. Xia S, Wang Z, Zhang H, Hu K, Zhang Z, Qin M, Dun

[0029] 8、Singh M&Brown GG.Suppression of cytoplasmic male sterility bynuclear genes alters expression of a novel mitochondrial gene region.PlantCell,1991,3(12):1349-62

[0030] 9、Liu Z,Yang Z,Wang X,Li K,An H,Liu J,Yang G,Fu T,Yi B,Hong D.AMitochondria-targeted PPR protein restores pol cytoplasmic male sterility byreducing orf224 transcript levels in oilseed rape.Molecular Plant,2016,9(7):1082-4

[0031] 10、Brown GG,FormanováN,Jin H,Wargachuk R,Dendy C,Patil P,Laforest M,Zhang J,Cheung WY,Landry BS.The radish Rfo restorer gene of Ogura cytoplasmicmale sterility encodes a protein with multiple pentatricopeptiderepeats.Plant Journal,2003,35(2):262-72

[0032] 11、Desloire S,Gherbi H,Laloui W,Marhadour S,Clouet V,Cattolico L,Falentin C,Giancola S,Renard M,Budar F,Small I,Caboche M,Delourme R,Bendahmane A.Identification of the fertility restoration locus,Rfo,in radish,as a member of the pentatricopeptide-repeat protein family.EMBO Reports,2003,4(6):588-94

[0033] 12、Duroc Y,Gaillard C,Hiard S,Defrance MC,Pelletier G,BudarF.Biochemical and functional characterization of ORF138,a mitochondrialprotein responsible for Ogura cytoplasmic male sterility inBrassiceae.Biochimie,2005,87(12):1089-100

[0034] 13、Yamagishi H&Bhat SR.Cytoplasmic male sterility in Brassicaceaecrops.Breeding Science,2014,64(1):38-47

[0035] 14、Bellaoui M,Grelon M,Pelletier G,Budar F.The restorer Rfo gene actspost-translationally on the stability of the ORF138 Ogura CMS-associatedprotein in reproductive tissues of rapeseed cybrids.Plant Mol Biol,1999,40:893-902

[0036] 15. Uyttewaal M, Arnal N, Quadrado M, Martin-Canadell A, Vrielynck N, HiardS, Gherbi H, Bendahmane A, Budar F, Mireau H. Characterization of Raphanus sativuspentatricopeptide repeat proteins encoded by the fertility restorer locus for Ogura cytoplasmic male sterility.Plant Cell,2008,20:3331-3345

[0037] 16. Hu

[0038] 17. Guo Y, Cheng L, Long W, Gao J, Zhang J, Chen S, Pu H, Hu M. Synergisticmutations of two rapeseed AHAS genes confer high resistance to sulfonylureaherbicides for weed control. Theoretical and Applied Genetics, 2020, 133(10): 2811-2824 DETAILED DESCRIPTION

[0039] The present invention is further defined below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0040] 1. Methods

[0041] 1. Optimization of Ogura CMS sterile line Z11A and rapeseed hybrid production

[0042] like Figure 1 , seed production includes the following steps:

[0043] ① The Ogura CMS sterile line Z11A was used as the female parent and hybridized with the germplasm 5N containing sulfonylurea herbicides to produce F1. The F1 was subjected to prospect selection and the F1 plants with herbicide resistance were screened and named F1(H);

[0044] ② Hybridize F1(H) with maintainer line Z11 and select target plants with herbicide resistance and high background recovery rate through foreground selection and background selection;

[0045] ③ The target individual plants were backcrossed with the maintainer line Z11 for three generations, and the target individual plants with herbicide resistance and a background recovery rate of more than 95% were screened and named the Z11AH sterile line;

[0046] ④ The Z11AH sterile line was hybridized with the Ogura CMS restorer line 9538R, and the resulting first generation was the hybrid.

[0047] 2. Average number of grains per silique of 9538R and wild type under different conditions

[0048] like Figure 2 Specifically: in natural field hybridization, the average number of siliques of 9538R in Wuhan was 0.95±0.18, and the average number of siliques without siliques of the wild type in Wuhan was 19.28±0.68; through bagging self-pollination, the average number of siliques of 9538R in Wuhan was 3.89±0.56, and the average number of siliques of the wild type in Wuhan was 19±1.68; outside the double-layer tent, the average number of siliques without siliques of 9538R in Lanzhou was 3.83±0.34, and inside the double-layer tent, the average number of siliques of 9538R in Lanzhou was 7.76±0.53.

[0049] 3. Growth status of the Ogura CMS sterile line and the 9538R restorer line at maturity in the field;

[0050] like Figure 3 Specifically, the 9538R restorer line has a long flowering period and normal pollen viability, providing sufficient pollen for the Ogura CMS sterile line Z11AH. When the Ogura CMS sterile line receives pollen from the 9538R restorer line and develops into mature siliques, the 9538R restorer line is still in full flowering.

[0051] 4. Rapeseed hybrid seed production model

[0052] like Figure 4 , specifically:

[0053] The optimized Ogura CMS sterile line Z11AH was used as the female parent, and the 9538R restorer line was used as the male parent. Their seeds were mixed at a ratio of 5:1 and sown in the seed production field. After the seeds matured, the mixed seeds were harvested. The harvested mixed seeds were sown in ordinary fields, and a small number of restorer line hybrids were eliminated by spraying sulfonylurea herbicides at the seedling stage, thereby obtaining rapeseed hybrids with higher purity.

[0054] 2. Others

[0055] 1. Sulfonylurea resistance in the improved Ogura CMS sterile line Z11AH was determined using Hi-Tom high-throughput sequencing technology using primers ALS1F / R and ALS3F / R. Sequencing results indicated that the plant harbored the target mutation in both the ALS1 and ALS3 genes, indicating resistance to the sulfonylurea herbicide.

[0056] ALS1F GTGGATATTGACGGTGATGGAAG——SEQ ID NO.1,

[0057] ALS1R CCCGAGATAAGTGTGAGCTCTG——SEQ ID NO.2;

[0058] ALS3F GCAATTGACGGTGATGGAAG——SEQ ID NO.3,

[0059] ALS3R GTCCCCGAGATAAGTGTGAGC—SEQ ID NO.4.

[0060] 2. The pollen viability of the Ogura CMS restorer line 9538R is no different from that of the wild type

[0061] like Figure 5 There are significant differences in the pistil development between 9538R and the wild type. Specifically, the radial width of the pistil of 9538R is 10-50% wider than that of the wild type, and the longitudinal length is 7.4-21.8% shorter than that of the wild type; the style length of 9538R is also 40.4-57.1% shorter than that of the wild type; at maturity, the length of the silique of 9538R is 1.47 cm, which is significantly lower than that of the wild type at 4.68 cm.

[0062] 3. The purity of the hybrids was determined using the dominant markers BnRfo-AS2F / BnRfo-AS2S linked to the Ogura CMS restorer gene RFO. The primer sequences are:

[0063] BnRfo-AS2F:CATGCTTCGATCTCGTCCTTTA,——SEQ ID NO.5

[0064] BnRfo-AS2S: GGTAACAACATCAGGGTGGAGT, - SEQ ID NO.6.

[0065] 3. Examples

[0066] 1. Example 1: Optimization of Ogura CMS sterile line Z11A

[0067] The radish cytoplasmic male sterile line Z11A is a sterile line with complete pollen abortion and excellent agronomic traits, and is widely used in agricultural production. With the expansion of rapeseed cultivation areas and the increasing number of weed species in the fields, the cost of manual weed control in rapeseed fields has increased dramatically, hindering the large-scale promotion of rapeseed. Chemical herbicides (such as sulfonylurea herbicides) can effectively control dicotyledonous broadleaf weeds, but there are currently no herbicides that target only broadleaf weeds without harming rapeseed. Therefore, breeding the Ogura CMS sterile line with sulfonylurea herbicide resistance is beneficial to the healthy development of the rapeseed industry. Currently, widely used resistance genes include ALS and EPSPS, which confer herbicide resistance to plants by inhibiting the binding of herbicides to target sites. The 5N material, controlled by two pairs of incompletely dominant nuclear genes (ALS1), has demonstrated excellent herbicide resistance in experiments. In the present invention, 5N was used as the donor material for hybridization with Z11A. Hi-Tom high-throughput sequencing was used to select foreground hybrids, identifying individual plants with mutations in both the ALS1 and ALS2 genes. The herbicide-resistant F1 strain and the maintainer line Z11 were then subjected to background selection using AFLP marker-assisted selection to identify plants more similar to Z11A.

[0068] 2. Example 2: Breeding application of restorer line 9538R

[0069] 9538R, derived from an Ogura restorer recurrent population, contains the PPR-B protein, which blocks orf138 mRNA translation and elongation, rendering the plant fertile. Acetic acid carmine staining revealed that pollen viability of 9538R was comparable to that of the wild type, indicating that it can provide sufficient pollen for the Ogura CMS sterile line. Field data from two sites in Wuhan and Lanzhou over two years revealed that the average number of seeds per silique of 9538R was 0.95±0.18 and 3.83±0.34, respectively, significantly lower than that of the wild type (19.28±0.68 and 19.15±0.94). This suggests that 9538R, when used as a restorer line, can be interplanted and harvested with sterile lines, reducing the labor, material, and financial resources required for drilling different materials and removing male parents at maturity. This makes 9538R suitable for mechanized seed production, significantly reducing seed production costs. 9538R has a long flowering period, suggesting that the proportion of 9538R restorer seeds can be appropriately reduced when interplanting sterile and restorer lines.

[0070] The seed set rate of 9538R is extremely low, and its core challenge as a restorer line is seed reproduction. Pollen tube germination experiments revealed that mature pollen grains that land on the stigma of 9538R fail to properly penetrate the stigmatic papillae, resulting in a reduced seed set rate. Paraffin sections revealed that compared to the wild type, 9538R lacks sufficient ducts at the junction of the stigma and style. This significantly reduced seed set rate is hypothesized to be due to a lack of sufficient water for pollen tube elongation. Field experiments using bagging and selfing and double-layer tent cover revealed that the average number of grains per silique in bagged 9538R was 3.89 and 7.77 under double-layer tent cover, significantly higher than the seed set rate of 9538R in free-pollination (average number of grains per silique, 1), suggesting that increasing environmental humidity can improve the seed set rate of 9538R to some extent.

[0071] 3. Example 3: The optimized Ogura CMS sterile line Z11AH was used as the female parent, and the female sterile restorer line 9538R was used as the male parent. They were sown in a seed production field in an appropriate ratio and harvested at maturity.

[0072] To maximize hybrid purity, a herbicide-resistant gene was introduced into the Ogura CMS sterile line Z11A. After spraying herbicides at the seedling stage, the F1 hybrids survived due to the herbicide-resistant gene. The small number of impure plants produced by self-pollination with the female sterile restorer line 9538R were eliminated by chemical herbicide screening, resulting in highly pure rapeseed hybrids. The sterile line was propagated by crossing the optimized Ogura CMS sterile line Z11AH with the maintainer line Z11. The restorer line was propagated by increasing humidity during the flowering period of the female sterile restorer line 9538R.

[0073] IV. Working Mechanism and Creativity of the Invention

[0074] The improved Ogura CMS sterile line and the female sterile restorer line were mixed and harvested in seed production fields to obtain the first generation of offspring. Herbicides were sprayed at the seedling stage to obtain high-purity rapeseed hybrids. This method can save the manpower, material, and financial resources required for drilling different materials and cutting the male parent at maturity, and is suitable for mechanization. In addition, the main problem of the low-fruiting rate 9538R as a restorer line is its own reproduction. The present invention verified in Wuhan and Lanzhou that increasing the environmental humidity can significantly improve the fruiting rate of 9538R, laying a solid foundation for 9538R as a restorer line for rapeseed hybrid seed production.

Claims

1. A low-cost rapeseed hybrid seed production method, characterized in that The following steps are involved: ① Using the Ogura CMS sterile line as the female parent, hybridizing it with a plant containing a sulfonylurea herbicide resistance locus to obtain the Ogura CMS sterile line containing the sulfonylurea herbicide resistance locus; ② The Ogura CMS sterile line containing sulfonylurea herbicide resistance loci was used as the female parent, and the Ogura CMS restorer line was used as the male parent. The two lines were planted in a 5:1 ratio in a seed production field. Conventional field management methods were used, and the Brassica napus seeds were harvested at maturity. ③ Plant the harvested seeds in ordinary fields and spray sulfonylurea herbicides at the seedling stage to obtain high-purity Brassica napus hybrids; The propagation method of the low-fruiting restorer line 9538R is to significantly increase the fruiting rate of 9538R by bagging and self-pollination or covering with a double-layer tent, which is used for the propagation of the restorer line. The Ogura CMS restorer line in step ② was 9538R, whose seed setting rate was reduced by 93.4%-96.1% compared with the wild type; In step ③, the purity of the hybrid was identified using the dominant marker BnRfo-AS2F / BnRfo-AS2S linked to the RFO gene.

Citation Information

Patent Citations

  • Technology for preparing non-GMO sterile herbicide-resisting hybrid seeds

    CN109511547A