A quantum dot substrate probe and its preparation method and application

Abstract

The present invention discloses a quantum dot substrate probe, a preparation method thereof and an application thereof. The method includes: obtaining a nucleic acid strand targeted by LbCas12a protein or LbuCas13a protein; dissolving cadmium chloride, zinc chloride and N-acetyl-L-cysteine in water and adjusting the pH to 8-10 to obtain a cadmium precursor solution; reacting tellurium powder and sodium borohydride under an anaerobic ice bath condition to obtain a tellurium precursor solution; mixing the nucleic acid strand with the cadmium precursor solution, and then adding the tellurium precursor solution, and reacting at 70-200 °C to obtain the quantum dot substrate probe. Compared with the commonly used fluorescent dye substrate probe, this probe has the characteristics of stable fluorescence properties, single-excitation multi-emission, and narrow and symmetrical emission peaks, and can simply and efficiently achieve multi-component detection and imaging analysis.

Description

Technical Field

[0001] The present invention relates to the technical fields of nanomaterials and biomedical analytical chemistry, and particularly relates to a quantum dot substrate probe, a preparation method thereof, and an application thereof. Background Art

[0002] The CRISPR / Cas system is a natural immune system used by bacteria and archaea to defend against foreign invaders such as viruses or plasmids. Based on nucleic acids, it is composed of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR-associated proteins (Cas) expressed by a cas gene. Due to its advantages such as high sensitivity, good specificity, simple operation steps, fast response speed, and reliable performance, it has rapidly emerged in the field of molecular diagnosis, providing a brand-new detection method for disease diagnosis. Among them, after being activated by the target nucleic acid, Cas12a and Cas13a can continuously cleave short single-stranded oligonucleotide reporter molecules through their unique trans-cleavage effect, separating the fluorescent group and quenching group labeled at both ends of the reporter molecule and generating a measurable fluorescent signal. In current research, the Zhang Feng team found that different Cas13s have different cleavage preferences, so they designed reporter molecules with different sequences and different fluorescent groups and developed a multi-channel detection platform (Gootenberg et al., Science, 2018, 360, 439-444). However, the fluorescent group used in this method is a fluorescent dye. The Stokes shift of the fluorescent dye is small, and a specific excitation wavelength needs to be selected for a specific fluorescent dye, resulting in the need to use multiple different wavelengths of excitation light in the actual operation process and low multi-element detection efficiency.

[0003] Quantum dots have excellent optical and chemical properties, such as adjustable emission spectra, single-excitation multi-emission, wide absorption range, narrow emission spectra, large Stokes shift, high quantum yield, and good stability. The characteristic of single-excitation multi-emission enables it to have obvious advantages in simultaneous detection and multi-element imaging. Therefore, using DNA-QD and RNA-QD as substrate probes for the CRISPR / Cas system can make up for the deficiencies of fluorescent dyes and make the CRISPR / Cas system more simple and efficient in multi-element analysis and detection.

[0004] Therefore, there is an urgent need for a quantum dot that can be used as a substrate probe for the CRISPR / Cas system. Summary of the Invention

[0005] The object of the present invention is to provide a quantum dot substrate probe, a preparation method and an application thereof, and to prepare a substrate probe for the CRISPR / Cas system. Compared with the commonly used fluorescent dye substrate probe, it has the characteristics of stable fluorescence properties, single-excitation multi-emission, narrow and symmetric emission peaks, etc., and can simply and efficiently achieve multi-detection and imaging analysis.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] In the first aspect of the present invention, a preparation method of a quantum dot substrate probe is provided, and the method includes:

[0008] Obtain a DNA nucleic acid strand with a sequence targeted by LbCas12a protein as shown in SEQ ID NO.1, or an RNA nucleic acid strand with a sequence targeted by LbuCas13a protein as shown in SEQ ID NO.2; the 5' end of the DNA nucleic acid strand or RNA nucleic acid strand is modified with thiophosphate, the 3' end is modified with a quenching group, or the 3' end is modified with thiophosphate and the 5' end is modified with a quenching group;

[0009] Dissolve cadmium chloride, zinc chloride and N-acetyl-L-cysteine in water and adjust the pH to 8-10 to obtain a cadmium precursor;

[0010] React tellurium powder and sodium borohydride under an anaerobic ice bath condition to obtain a tellurium precursor solution;

[0011] Mix the nucleic acid strand with the cadmium precursor solution, then add the tellurium precursor solution, and react at 70-200 °C to obtain the quantum dot substrate probe.

[0012] In the second aspect of the present invention, a preparation method of a quantum dot substrate probe is provided, and the method includes:

[0013] Obtain a DNA nucleic acid strand as shown in SEQ ID NO.3, and the 5' end is modified with thiophosphate;

[0014] Dissolve cadmium chloride, zinc chloride and N-acetyl-L-cysteine in water and adjust the pH to 8-10 to obtain a cadmium precursor solution;

[0015] React tellurium powder and sodium borohydride under an anaerobic ice bath condition to obtain a tellurium precursor solution;

[0016] Mix the nucleic acid strand with the cadmium precursor solution, then add the tellurium precursor solution, and react at 70-200 °C to obtain a reaction product;

[0017] Hybridize the reaction product with a DNA nucleic acid strand modified with a quenching group at the 3' end and having a sequence as shown in SEQ ID NO. 4 or an RNA nucleic acid strand as shown in SEQ ID NO. 5 to obtain a quantum dot substrate probe.

[0018] Further, the molar ratio of cadmium chloride, zinc chloride and N-acetyl-L-cysteine is 1:(0.5 - 3):(0.2 - 0.7).

[0019] Further, the molar ratio of tellurium powder to sodium borohydride is 1:(2 - 3), and the reaction time under the anaerobic ice bath condition is 2 - 5 h.

[0020] Further, the ratio range of the molar amount of the nucleic acid strand to the volume of the cadmium precursor solution is 25 - 50 nmol:(1 - 3) mL; the volume ratio of the cadmium precursor solution to the tellurium precursor solution is (380 - 420):1.

[0021] In the third aspect of the present invention, a quantum dot substrate probe prepared by the method is provided.

[0022] In the fourth aspect of the present invention, the application of the quantum dot substrate probe in the preparation of a new coronavirus nucleic acid detection kit is provided.

[0023] In the fifth aspect of the present invention, a new coronavirus nucleic acid detection kit is provided, and the kit includes: the quantum dot substrate probe, Cas protein, crRNA and buffer solution, and the sequence of the crRNA is selected from at least one of SEQ ID NO. 6 - SEQ ID NO. 7.

[0024] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0025] (1) A preparation method of a quantum dot substrate probe provided by the present invention is to mix a nucleic acid sequence with a cadmium precursor, and then add a tellurium precursor to the mixture and react at 70 - 200 °C to obtain a quantum dot substrate probe; the preparation process of this method is simple, highly operable, and can be synthesized in general laboratories. It can be reacted at 70 °C by a water bath heating method to protect RNA from hydrolysis; it can also use a reaction kettle to react at a high temperature of 200 °C to accelerate the synthesis rate of DNA-QD and improve the reaction efficiency; while the substrate probe labeled with a fluorescent dye cannot be prepared in general laboratories. In addition, by regulating the reaction time, CRISPR / Cas system substrate probes of different colors can be obtained, which means that when synthesizing quantum dots, quantum dots with different fluorescence wavelengths can be obtained by simply terminating the reaction at different times, greatly reducing the time cost.

[0026] (2) The principle of the quantum dot substrate probe provided by the present invention for the nucleic acid detection of the novel coronavirus based on the CRISPR / Cas system:

[0027] As Figure 1 shown in A, the DNA-QD substrate probe is modified with QD and a quenching group at both ends, and five bases TTATT that meet the cleavage preference of Cas12a are modified in the middle. This probe is both a trans-cleavage substrate and a fluorescent signal molecule. When CRISPR / Cas12a binds to the target double-stranded DNA, its trans-cleavage activity is activated, cleaving the DNA-QD substrate probe and restoring the QD fluorescence signal, realizing the detection of the double-stranded DNA transcribed from the novel coronavirus RNA.

[0028] As Figure 1 shown in B, the RNA-QD substrate probe is modified with QD and a quenching group at both ends, and five uridine nucleotides (rU) that meet the cleavage preference of Cas13a are modified in the middle. This probe is also both a trans-cleavage substrate and a fluorescent signal molecule. When CRISPR / Cas13a binds to the target RNA, the Cas13a protein is activated and transformed into a non-specific RNA endonuclease, thus non-specifically cleaving the RNA-QD and restoring the QD fluorescence signal, realizing the detection of the novel coronavirus RNA.

[0029] As Figure 1 shown in C, when the DNA-QD substrate probe and the RNA-QD substrate probe are simultaneously placed in the CRISPR / Cas12a and CRISPR / Cas13a mixed system, the simultaneous detection of different targets can be achieved.

[0030] Compared with the commonly used fluorescent dye substrate probe, the quantum dot substrate probe also has the characteristics of single-excitation multi-emission. By using quantum dots with different fluorescence wavelengths obtained by regulating the reaction time, simultaneous detection and multi-component imaging can be achieved at a single excitation wavelength and a single detection channel. Description of the Drawings

[0031] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0032] Figure 1 is the schematic diagram of the quantum dot substrate probe in the CRISPR / Cas system for nucleic acid detection; Figure 1 A is the principle of the DNA-QD substrate probe in the CRISPR / Cas12a system for detecting double-stranded DNA; Figure 1B is the principle of detecting RNA with RNA-QD substrate probes in the CRISPR / Cas13a system; Figure 1 C is the detection principle of simultaneously detecting different targets with DNA-QD substrate probes and RNA-QD substrate probes.

[0033] Figure 2 Transmission electron micrograph (Figure A) and particle size distribution map (Figure B) of the DNA-QD substrate probe in the CRISPR / Cas system synthesized in Example 1.

[0034] Figure 3 UV-visible absorption spectrum of the DNA-QD substrate probe in the CRISPR / Cas system synthesized in Example 1.

[0035] Figure 4 Feasibility analysis of detecting double-stranded DNA transcribed from SARS-CoV-2 RNA with the DNA-QD substrate probe in Example 1.

[0036] Figure 5 UV-visible absorption spectrum of the DNA-QD substrate probe in the CRISPR / Cas system synthesized in Example 2.

[0037] Figure 6 Feasibility analysis of detecting double-stranded DNA transcribed from SARS-CoV-2 RNA with the DNA-QD substrate probe in Example 2.

[0038] Figure 7 UV-visible absorption spectrum of the RNA-QD substrate probe in the CRISPR / Cas system synthesized in Example 3.

[0039] Figure 8 Feasibility analysis of detecting SARS-CoV-2 RNA with the RNA-QD substrate probe in Example 3.

[0040] Figure 9 UV-visible absorption spectrum of the RNA-QD substrate probe in the CRISPR / Cas system synthesized in Example 4.

[0041] Figure 10 Feasibility analysis of detecting SARS-CoV-2 RNA with the RNA-QD substrate probe in Example 4.

[0042] Figure 11 Feasibility analysis of simultaneously detecting SARS-CoV-2 nucleic acid as RNA and double-stranded DNA transcribed from RNA in Example 5. Detailed implementation methods

[0043] The present invention will be specifically described below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be presented more clearly therefrom. Those skilled in the art should understand that these specific embodiments and examples are used to illustrate the present invention, rather than to limit the present invention.

[0044] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood to have the meanings as commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as the general understanding of those skilled in the art to which the present invention pertains. In case of contradiction, this specification shall prevail.

[0045] Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment, etc. used in the present invention can be obtained through market purchases or can be obtained by existing methods.

[0046] The general idea of the present invention is as follows:

[0047] According to a typical embodiment of the present invention, a method for preparing a quantum dot substrate probe is provided, characterized in that the method comprises:

[0048] (1) Scheme 1

[0049] Step S1: Obtain a DNA nucleic acid strand as shown in SEQ ID NO.1 targeted by LbCas12a protein, with a phosphorothioate modification at the 5' end and a quenching group at the 3' end, or a phosphorothioate modification at the 3' end and a quenching group at the 5' end;

[0050] The sequence design principle:

[0051] There is a phosphorothioate modification at the 5' end of the DNA sequence and a quenching group at the 3' end, or a phosphorothioate modification at the 3' end and a quenching group at the 5' end; the DNA sequence design principle is: 5 - 10 phosphorothioate-modified bases + 3 - 10 linker bases + 4 - 10 DNA bases preferred by Cas enzyme cleavage + modified quenching group;

[0052] As a specific embodiment, the DNA nucleic acid strand targeted by LbCas12a protein is shown in Table 1.

[0053] Table 1 - Single-strand scheme of DNA-QD probe targeted by LbCas12a protein

[0054]

[0055] Step S2: Dissolve cadmium chloride, zinc chloride, and N-acetyl-L-cysteine in water and adjust the pH to 8 - 10 to obtain a cadmium precursor solution;

[0056] In the said Step S2,

[0057] The reason for adjusting the pH to 8 - 10 is that the quantum dot substrate probe has good stability in an alkaline environment;

[0058] The molar ratio of the cadmium chloride, zinc chloride, and N-acetyl-L-cysteine is 1:(0.5 - 3):(0.2 - 0.7). The quantum dot substrate probe has the best brightness within this molar ratio range. If the molar ratio is not within the above range, the luminescence performance is poor;

[0059] Step S3: React tellurium powder and sodium borohydride under an anaerobic ice bath condition to obtain a tellurium precursor solution;

[0060] The reaction equation involved in step S3 is:

[0061]

[0062] The molar ratio of the tellurium powder to the sodium borohydride is 1:(2 - 3). This molar ratio range can better control the reduction rate. If the molar ratio is not within the above range, there may be adverse effects such as the generation of by-products and failure to reach the reaction rate;

[0063] The reaction time under the anaerobic ice bath condition is 2 - 5 h.

[0064] Step S4: Mix the nucleic acid strand with the cadmium precursor solution, and then add the tellurium precursor solution, and react at 70 - 200 °C to obtain the quantum dot substrate probe.

[0065] In step S4,

[0066] The dosage of the substrate probe is 25 - 50 nmol, and the volume ratio of the cadmium precursor to the tellurium precursor is 400:1.

[0067] As a specific implementation method, step S4 includes: mixing the substrate probe with 2 mL of the cadmium precursor to obtain a mixed solution A, taking out 5 μL of the tellurium precursor with a micro syringe and quickly transferring it into the mixed solution A to obtain a mixed solution B; finally, reacting the mixed solution B at 70 - 200 °C for 22 - 1680 mins to obtain the quantum dot substrate probe; according to the kinetic principle, the lower the reaction temperature, the longer the reaction time required to synthesize the quantum dot substrate probe with the same particle size.

[0068] The method further includes step S5: purifying and storing the quantum dot substrate probe. The specific operation steps are as follows:

[0069] The quantum dot substrate probe obtained in step S4 is centrifugally purified using an ultrafiltration tube with a molecular cut-off of 50,000. The waste liquid is poured out, and then enzyme-free tris-HCl solution is added for washing and centrifugation. Wash three times in this way; then invert the ultrafiltration tube for centrifugation to obtain a pure quantum dot substrate probe, and store it in the dark at 4°C; among them, the enzyme-free tris-HCl solution is 10 mM and the pH value is 8.0.

[0070] (2) Scheme II:

[0071] Step S1: Obtain an RNA nucleic acid strand with the sequence targeted by LbuCas13a protein as shown in SEQ ID NO.2 (modified with phosphorothioate at the 5' end and a quenching group at the 3' end, or modified with phosphorothioate at the 3' end and a quenching group at the 5' end);

[0072] The design principle of the sequence:

[0073] Modified with phosphorothioate at the 5' end of the RNA sequence and a quenching group at the 3' end, or modified with phosphorothioate at the 3' end and a quenching group at the 5' end; the design principle of this RNA sequence: 5-10 phosphorothioate-modified bases + 3-10 linker bases + 4-10 RNA bases preferred by Cas enzyme cleavage + modified quenching group.

[0074] As a specific implementation manner, the RNA nucleic acid strand targeted by LbuCas13a protein is shown in Table 2.

[0075] Table 2 - Single-strand scheme of RNA-QD probe targeted by LbuCas13a protein

[0076]

[0077] Step S2: Dissolve cadmium chloride, zinc chloride and N-acetyl-L-cysteine in water and adjust the pH to 8-10 to obtain a cadmium precursor solution;

[0078] Step S3: React tellurium powder and sodium borohydride under anaerobic ice bath conditions to obtain a tellurium precursor solution;

[0079] Step S4: Mix the nucleic acid strand with the cadmium precursor solution, and then add the tellurium precursor solution, and react at 70-200°C to obtain a quantum dot substrate probe.

[0080] (3) Scheme III:

[0081] Step S1: Obtain a DNA nucleic acid strand as shown in SEQ ID NO.3 (modified with phosphorothioate at the 5' end);

[0082] Step S2: Dissolve cadmium chloride, zinc chloride, and N-acetyl-L-cysteine in water and adjust the pH to 8 - 10 to obtain a cadmium precursor solution;

[0083] Step S3: React tellurium powder and sodium borohydride under anaerobic ice bath conditions to obtain a tellurium precursor solution;

[0084] Step S4: Mix the nucleic acid strand with the cadmium precursor solution, then add the tellurium precursor solution, and react at 70 - 200 °C to obtain a reaction product;

[0085] Step S5: Hybridize the reaction product with the DNA nucleic acid strand shown in SEQ ID NO.4 (with a quenching group modified at the 3' end and a fragment targeted by LbCas12a protein modified in the middle) to obtain a quantum dot substrate probe.

[0086] Table 3 - Double-stranded protocol for LbCas12a protein-targeted DNA-QD probe

[0087]

[0088] (4) Protocol 4:

[0089] Step S1: Obtain a DNA nucleic acid strand with the sequence shown in SEQ ID NO.3 (modified with thiophosphate at the 5' end);

[0090] Step S2: Dissolve cadmium chloride, zinc chloride, and N-acetyl-L-cysteine in water and adjust the pH to 8 - 10 to obtain a cadmium precursor solution;

[0091] Step S3: React tellurium powder and sodium borohydride under anaerobic ice bath conditions to obtain a tellurium precursor solution;

[0092] Step S4: Mix the nucleic acid strand with the cadmium precursor solution, then add the tellurium precursor solution, and react at 70 - 200 °C to obtain a reaction product;

[0093] Step S5: Hybridize the reaction product with the RNA nucleic acid strand shown in SEQ ID NO.5 (with a quenching group modified at the 3' end and a fragment targeted by LbuCas13a protein modified in the middle) to obtain a quantum dot substrate probe.

[0094] Table 4 - Double-stranded protocol for LbuCas13a protein-targeted RNA-QD probe

[0095]

[0096]

[0097] The specific operating steps and parameters of steps S2 - S3 in the second, third, and fourth solutions are the same as those in the first solution.

[0098] The quantum dot probe provided by the present invention is constructed by designing a substrate nucleic acid sequence, modifying a quenching group at one end thereof, and then synthesizing quantum dots at the unmodified end of the nucleic acid. That is, the designed nucleic acid with a quenching group is mixed with a cadmium precursor, and then a tellurium precursor is added to the mixture. After reacting for a period of time, a substrate probe can be obtained. This preparation process is simple, and different colors of CRISPR / Cas system substrate probes can be obtained by regulating the reaction time and reaction temperature. Compared with the commonly used fluorescent dye substrate probes, quantum dots have the characteristics of stable fluorescence properties, single - wavelength excitation and multi - wavelength emission, and narrow and symmetrical emission peaks, and can simply and efficiently achieve multiplex detection and imaging analysis. Since proteins such as LbCas12a protein and LbuCas13a protein in the CRISPR / Cas system have different nucleic acid cleavage preferences, DNA - QD and RNA - QD substrate probes can be constructed respectively based on this to realize the analysis and detection of different target substances and simultaneous determination, providing a new idea for the construction of novel substrate probes for the CRISPR / Cas system.

[0099] According to another typical embodiment of the present invention, a quantum dot substrate probe prepared by the above - mentioned method is provided.

[0100] According to another typical embodiment of the present invention, the application of the quantum dot substrate probe in the preparation of a nucleic acid detection kit is provided.

[0101] The nucleic acid detection includes all nucleic acids, such as nucleic acids of novel coronavirus, echovirus, enterovirus, etc. The application method of the nucleic acid detection kit includes the following steps:

[0102] ① Design crRNA according to the target sequence of the nucleic acid to be detected;

[0103] ② Construct a reaction system containing Cas protein, crRNA, the obtained quantum dot substrate probe, the sample to be detected, and a buffer solution, and carry out a cleavage reaction;

[0104] ③ After adding a buffer solution to the reaction solution in step (2) and transferring it into a fluorescence cuvette, or directly transferring the reaction solution into a fluorescence cuvette, set the excitation wavelength to 360 nm, and measure the fluorescence spectrum in the range of emission wavelengths from 500 to 680 nm;

[0105] ④ Qualitative detection: If the fluorescence intensity increases, the sample to be detected contains the nucleic acid of the virus to be detected;

[0106] ⑤Quantitative detection: Substitute the increased value of the fluorescence intensity into the working curve for quantitatively detecting the nucleic acid to be detected, and obtain the content of the nucleic acid to be detected. The increased value of the fluorescence intensity is the fluorescence intensity value when the nucleic acid to be detected is present minus the fluorescence intensity value when the nucleic acid to be detected is absent.

[0107] When the Cas protein is LbCas12a protein, the quantum dot substrate probe prepared by the steps of the first and third schemes is used;

[0108] When the Cas protein is LbuCas13a protein, the quantum dot substrate probe prepared by the steps of the second and fourth schemes is used.

[0109] As an optional implementation manner, the present invention applies the quantum dot substrate probe to the preparation of a kit for detecting nucleic acid of novel coronavirus.

[0110] According to another typical implementation manner of the present invention, a kit for detecting nucleic acid of novel coronavirus is provided. The kit includes: the quantum dot substrate probe, Cas protein, crRNA, and buffer solution. The sequence of the crRNA is selected from at least one of SEQ ID NO.6-SEQ ID NO.7.

[0111] As a specific implementation manner, after preparing a kit for detecting nucleic acid of novel coronavirus by using the quantum dot substrate probe of the present invention, the detection method includes the following three types:

[0112] (1) Detection method 1: When the nucleic acid of novel coronavirus is RNA, the detection method specifically includes the following steps:

[0113] ① Design crRNA1 according to the target sequence, and its oligonucleotide sequence is 5'-GACCACCCCAAAAUGAAGGGGACUAAAACAAUGCUAUUCUACCUGCACUGUA-3' (SEQ ID NO.6);

[0114] ② Construct a reaction system containing 1 μL of 500 nM LbuCas13a, 5 μL of 100 nM crRNA, 5 μL of 500 nM RNA-QD substrate probe, 5 μL of the RNA to be detected, and 34 μL of buffer solution, and perform a cleavage reaction at 37°C for 10-30 minutes;

[0115] Among them, the 34 μL of buffer solution is composed of 5 μL of reaction buffer solution (50 mM NaCl, 50 mM pH 8.0 tris-HCl, 10 mM MgCl2) and 29 μL of 10 mM pH 8.0 tris-HCl solution;

[0116] ③ Add 10 mM pH 8.0 tris-HCl solution to the reaction solution to 100 μL, then transfer it to a fluorescence cuvette for measurement. Set the excitation wavelength to 360 nm, the slit to 10 nm, and the fluorescence emission spectrum scanning wavelength range to 500 - 680 nm;

[0117] ④ Qualitative detection: If the fluorescence intensity increases, the test sample contains the double-stranded DNA transcribed from the test virus RNA;

[0118] ⑤ Quantitative detection: Substitute the increased value of the fluorescence intensity into the working curve for quantitatively detecting the test RNA to obtain the content of the test RNA. The increased value of the fluorescence intensity is the fluorescence intensity value when the test RNA is present minus the fluorescence intensity value when the test RNA is absent.

[0119] (2) Detection method 2. When the nucleic acid of the novel coronavirus is double-stranded DNA transcribed from RNA, the detection method specifically includes the following steps:

[0120] ① Design crRNA2 according to the target sequence, and its oligonucleotide sequence is 5’-UAAUUUCUACUAAGUGUAGAUAAGGUUUGUGUGUUUACCUG-3’ (SEQ ID NO.7);

[0121] ② Construct a reaction system containing 0.5 μL of 1.6 μM LbCas12a, 5 μL of 320 nM crRNA, 2 μL of 500 nM DNA-QD substrate probe, 2 μL of the double-stranded DNA to be tested, and 10.5 μL of buffer solution. Carry out the cleavage reaction at 37 °C for 10 - 30 mins;

[0122] Among them, the 10.5 μL of buffer solution consists of 2 μL of reaction buffer solution (500 mM NaCl, 100 mM pH 8.0 tris-HCl, 100 mM MgCl2, 10 mM dTT) and 8.5 μL of 10 mM pH 8.0 tris-HCl solution;

[0123] ③ Add 10 mM pH 8.0 tris-HCl solution to the reaction solution to 200 μL, then transfer it to a fluorescence cuvette for measurement. Set the excitation wavelength to 360 nm, the slit to 10 nm, and the fluorescence emission spectrum scanning wavelength range to 500 - 680 nm;

[0124] ④ Qualitative detection: If the fluorescence intensity increases, the test sample contains the double-stranded DNA transcribed from the test virus RNA;

[0125] ⑤Quantitative detection: Substitute the increased value of the fluorescence intensity into the working curve for quantitatively detecting the double-stranded DNA to be detected, and the content of the double-stranded DNA to be detected can be obtained. The increased value of the fluorescence intensity is the fluorescence intensity value when the double-stranded DNA to be detected is present minus the fluorescence intensity value when there is no double-stranded DNA to be detected.

[0126] (3) Detection method 3. When the nucleic acid of the novel coronavirus is RNA and the double-stranded DNA transcribed from the RNA, the specific detection method includes the following steps:

[0127] ①Design crRNA1 according to the target RNA sequence, and its oligonucleotide sequence is 5'-GACCACCCCAAAAAUGAAGGGGACUAAAACAAUGCUAUUCUACCUGCACUGUA-3' (SEQ ID NO.6);

[0128] Design crRNA2 according to the target double-stranded DNA sequence, and its oligonucleotide sequence is 5'-UAAUUUCU ACUAAGUGUAGAUAAGGUUUGUGUGUUUACCUG-3' (SEQ ID NO.7);

[0129] ②Construct a reaction system containing 1 μL of 500 nM LbuCas13a, 1.25 μL of 1.6 μM LbCas12a, 5 μL of 100 nM crRNA1, 12.5 μL of 320 nM crRNA2, 5 μL of 500 nM RNA-QD substrate probe, 5.25 μL of 500 nM DNA-QD substrate probe, 5 μL of the double-stranded DNA to be detected, and 5 μL of the RNA to be detected. Carry out a cleavage reaction at 37°C, and the reaction time is 10 - 30 mins;

[0130] ③Add 50 μL of 10 mM pH 8.0 tris-HCl solution to the reacted solution, and then transfer it to a fluorescence cuvette for measurement. Set the excitation wavelength to 360 nm, the slit to 10 nm, and the fluorescence emission spectrum scanning wavelength range to 500 - 680 nm;

[0131] ④Qualitative detection: If the fluorescence intensity at the wavelength corresponding to the RNA-QD substrate probe increases, the sample to be detected contains the virus RNA to be detected; if the fluorescence intensity at the wavelength corresponding to the DNA-QD substrate probe increases, the sample to be detected contains the double-stranded DNA transcribed from the virus RNA to be detected;

[0132] ⑤Quantitative detection: Substitute the increase in fluorescence intensity at the wavelength corresponding to RNA-QD into the working curve for quantitatively detecting the RNA to be detected to obtain the content of the RNA to be detected; substitute the increase in fluorescence intensity at the wavelength corresponding to the DNA-QD substrate probe into the working curve for quantitatively detecting the double-stranded DNA to be detected to obtain the content of the double-stranded DNA to be detected; the increase in fluorescence intensity is the fluorescence intensity value in the presence of the nucleic acid to be detected minus the fluorescence intensity value in the absence of the nucleic acid to be detected.

[0133] Next, a quantum dot substrate probe of the present application will be described in detail in conjunction with examples and experimental data.

[0134] Example 1. Synthesis method of a DNA-QD substrate probe for a CRISPR / Cas system and its application in the detection of novel coronavirus

[0135] 1. The preparation method of the quantum dot substrate probe (i.e., the DNA-QD substrate probe based on the CRISPR / Cas system) in the embodiment of the present invention includes the following steps:

[0136] (1) Design a DNA sequence according to the cleavage preference of the LbCas12a protein. The 5' end of the DNA sequence is modified with phosphorothioate, and the 3' end is modified with a quenching group. Its sequence is G*G*G*G*G*G*G*G*G*G*AA AAATTATTATT-BHQ2;

[0137] (2) Dissolve cadmium chloride, zinc chloride, and N-acetyl-L-cysteine in DEPC-treated water at a molar ratio of 1:1:4, and adjust the pH value to 9.0 using enzyme-free 1M NaOH to obtain a cadmium precursor; respectively add tellurium powder and sodium borohydride with a molar ratio of 1:2 to a 10 mL round-bottom flask, introduce nitrogen, and react under anaerobic ice bath conditions for 3.5 h to obtain a tellurium precursor; then mix 25 nmol of the DNA sequence with 2 mL of the cadmium precursor to obtain a mixed solution A. Take out 5 μL of the tellurium precursor with a micro syringe and quickly transfer it into the mixed solution A to obtain a mixed solution B; finally, react the mixed solution B at 200 °C for 28 minutes to obtain a DNA-QD substrate probe with a maximum emission wavelength of 583 nm;

[0138] (3) Centrifuge and purify the obtained DNA-QD substrate probe with an ultrafiltration tube with a molecular cut-off of 50000, pour out the waste liquid, and then add an enzyme-free tris-HCl solution (10 mM pH 8.0) for washing and centrifugation. Wash 3 times in this way; then invert the ultrafiltration tube for centrifugation to obtain a pure product of the DNA-QD substrate probe, and store it in the dark at 4 °C; dilute it into an aqueous solution with the required concentration when needed.

[0139] Figure 2Transmission electron micrograph (Figure A) and particle size distribution diagram (Figure B) of the DNA-QD substrate probe in the CRISPR / Cas system synthesized in Example 1 Figure 2 The inset of A is an HR-TEM image. It can be seen from the transmission electron micrograph that the DNA-QD substrate probe has good dispersibility and particle size uniformity, and its average size is about 4.4 nm. Figure 3 UV-visible absorption spectrum of the DNA-QD substrate probe of the CRISPR / Cas system synthesized in Example 1. It can be seen from the UV-visible absorption spectrum that the probe has an obvious absorption peak at 558 nm.

[0140] 2. Its application in the detection of novel coronavirus includes the following steps:

[0141] (1) Using the double-stranded DNA transcribed from novel coronavirus RNA as the target, whose oligonucleotide sequences are 5-AATTTTGAAGGTTTGTGTGTTTACCTGAAGTTAG and 5-CTAACTTCAGGTA AACACACAAACCTTCAAAATT; and designing crRNA1 according to the target sequence, whose oligonucleotide sequence is 5’-UAAUUUCUACUAAGUGUAGAUAAGGUUUGUGUGUUUACCUG-3’;

[0142] (2) Construct a reaction system with a total volume of 20 μL, which contains 0.5 μL of 1.6 μM LbCas12a, 5 μL of 320 nM crRNA, 2 μL of 500 nM DNA-QD substrate probe, 2 μL of the double-stranded DNA to be tested, 2 μL of the reaction buffer solution (500 mM NaCl, 100 mM pH 8.0 tris-HCl, 100 mM MgCl2, 10 mM dTT) and 8.5 μL of 10 mM pH 8.0 tris-HCl solution. Place this reaction system in a 37 °C forced-air drying oven and react for 20 minutes.

[0143] (3) After the reaction is completed, add 180 μL of 10 mM pH 8.0 tris-HCl solution to the reaction solution, then transfer it to a fluorescence cuvette for measurement. Set the excitation wavelength to 360 nm, the slit to 10 nm, and measure the fluorescence intensity value of this reaction system at 583 nm;

[0144] Figure 4 Feasibility analysis for detecting the double-stranded DNA transcribed from novel coronavirus RNA in Example 1. It can be Figure 4 seen that when 500 nM of the target double-stranded DNA is added to the system, the fluorescence value of DNA-QD at 583 nm shows an obvious increase.

[0145] Example 2: Synthesis Method of DNA-QD Substrate Probe of CRISPR / Cas System and Its Application in COVID-19 Detection

[0146] 1. The synthesis method of the quantum dot substrate probe (i.e., the DNA-QD substrate probe based on the CRISPR / Cas system) of this invention's example includes the following steps:

[0147] (1) Design DNA sequence 1 according to the cleavage preference of LbCas12a protein. The 3' end of DNA sequence 1 is modified with a quenching group, and its sequence is TTGTCGTCCAGCTCTGAATTATTATTGATTT-BHQ1; design DNA sequence 2 that is complementary paired with 18 bases at the 5' end of this DNA sequence. The 5' end of DNA sequence 2 is modified with phosphorothioate, and its sequence is G*G*G*G*G*G*G*G*G*G*AAAAATCCCTTGTTCAGAGCTGGACGACAATGATTAGGGTTAG;

[0148] (2) Dissolve cadmium chloride, zinc chloride, and N-acetyl-L-cysteine in DEPC-treated water according to a molar ratio of 1:1:4, and use enzyme-free 1M NaOH to adjust the pH value to 9.0 to obtain a cadmium precursor; respectively take tellurium powder and sodium borohydride with a molar ratio of 1:2 and add them to a 10 mL round-bottom flask, introduce nitrogen, and react for 3.5 h under an anaerobic ice bath condition to obtain a tellurium precursor; then mix 25 nmol of DNA sequence 2 with 2 mL of the cadmium precursor to obtain a mixed solution A. Take out 5 μL of the tellurium precursor with a microsyringe and quickly transfer it into the mixed solution A to obtain a mixed solution B; finally, react the mixed solution B at 200 °C for 24 mins to obtain a DNA-QD with a maximum emission wavelength of 543 nm;

[0149] (3) Centrifuge and purify the obtained DNA-QD with an ultrafiltration tube with a molecular cut-off of 50000. After pouring out the waste liquid, add enzyme-free tris-HCl solution (10 mM pH 8.0) for washing and centrifugation, and wash 3 times in this way; then invert and centrifuge the ultrafiltration tube to obtain pure DNA-QD;

[0150] (4) Take 2 μL of 10 μM DNA sequence 1 and 2 μL of 2.74 μM pure DNA-QD product and add them to 16 μL of buffer solution (100 mM NaCl, 10 mM pH 8.0 tris-HCl, 10 mM MgCl2), then anneal it at 76 °C for 5 mins and hybridize it at room temperature for 20 mins to obtain a DNA-QD substrate probe.

[0151] Figure 5UV-visible absorption spectrum of the DNA-QD substrate probe of the CRISPR / Cas system synthesized in Example 2. As can be seen from the UV-visible absorption spectrum, the probe has an obvious absorption peak at 525 nm.

[0152] 2. Its application in the detection of novel coronavirus includes the following steps:

[0153] (1) Using the double-stranded DNA transcribed from novel coronavirus RNA as the target, its oligonucleotide sequence is 5-AATTTTGAAGGTTTGTGTGTTTACCTGAAGTTAG and 5-CTAACTTCAGGTA AACACACAAACCTTCAAAATT; and designing crRNA1 according to the target sequence, its oligonucleotide sequence is 5’-UAAUUUCUACUAAGUGUAGAUAAGGUUUGUGUGUUUACCUG-3’;

[0154] (2) Construct a reaction system with a total volume of 20 μL, which contains 0.5 μL of 1.6 μM LbCas12a, 5 μL of 320 nM crRNA, 2 μL of 500 nM DNA-QD substrate probe, 2 μL of the double-stranded DNA to be tested, 2 μL of the reaction buffer solution (500 mM NaCl, 100 mM pH 8.0 tris-HCl, 100 mM MgCl2, 10 mM dTT), and 8.5 μL of 10 mM pH 8.0 tris-HCl solution. Place this reaction system in a 37 °C forced-air drying oven and react for 20 mins.

[0155] (3) After the reaction is completed, add 180 μL of 10 mM pH 8.0 tris-HCl solution to the reaction solution, then transfer it to a fluorescence cuvette for measurement. Set the excitation wavelength to 360 nm, the slit to 10 nm, and measure the fluorescence intensity value of this reaction system at 543 nm;

[0156] Figure 6 Feasibility analysis for detecting the double-stranded DNA transcribed from novel coronavirus RNA in Example 2. As Figure 6 can be seen, when adding 100 nM of the target double-stranded DNA to the system, the fluorescence value of DNA-QD at 543 nm shows an obvious increase.

[0157] Example 3. A method for synthesizing an RNA-QD substrate probe of a CRISPR / Cas system and its application in the detection of novel coronavirus

[0158] 1. The preparation method of the quantum dot substrate probe (i.e., the RNA-QD substrate probe based on the CRISPR / Cas system) in the embodiment of the present invention includes the following steps:

[0159] (1) Design an RNA sequence according to the cleavage preference of the LbuCas13a protein. The 5'-end of the RNA sequence is modified with phosphorothioate, and the 3'-end is modified with a quenching group. Its sequence is G*G*G*G*G*G*G*G*G*G*AAAAArUrUrUrUrUAAA-BHQ2;

[0160] (2) Dissolve cadmium chloride, zinc chloride, and N-acetyl-L-cysteine in DEPC-treated water at a molar ratio of 1:1:4, and adjust the pH value to 9.0 using enzyme-free 1M NaOH to obtain a cadmium precursor; respectively, take tellurium powder and sodium borohydride with a molar ratio of 1:2 and add them to a 10 mL round-bottom flask, introduce nitrogen, and react for 3.5 h under an anaerobic ice bath condition to obtain a tellurium precursor; then mix 25 nmol of the RNA sequence with 2 mL of the cadmium precursor to obtain a mixed solution A, take out 5 μL of the tellurium precursor with a microsyringe, and quickly transfer it into the mixed solution A to obtain a mixed solution B; finally, react the mixed solution B at 200 °C for 23 mins to obtain an RNA-QD substrate probe with a maximum emission wavelength of 543 nm;

[0161] (3) Centrifuge and purify the obtained RNA-QD substrate probe using an ultrafiltration tube with a molecular cut-off of 50,000, pour out the waste liquid, and then add an enzyme-free tris-HCl solution (10 mM pH 8.0) for washing and centrifugation. Wash 3 times in this way; then invert the ultrafiltration tube for centrifugation to obtain a pure RNA-QD substrate probe, and store it in the dark at 4 °C; dilute it to an aqueous solution with the required concentration when needed.

[0162] Figure 7 The ultraviolet-visible absorption spectrum of the RNA-QD substrate probe of the CRISPR / Cas system synthesized in Example 3. It can be seen from the ultraviolet-visible absorption spectrum diagram that the probe has an obvious absorption peak at 495 nm.

[0163] 2. Its application in the detection of novel coronavirus includes the following steps:

[0164] (1) Select a partial sequence in the novel coronavirus RNA genome as the target, and its sequence is 5'-UACAGUGCAGGUAGAAUAGCAUUAGU; and design crRNA2 according to the target sequence, and its oligonucleotide sequence is 5'-GACCACCCCAAAAAUGAAGGGGACUAAAACAAUGCUAUUCUAC CUGCACUGUA-3';

[0165] (2) Construct a reaction system with a total volume of 50 μL, which contains 1 μL of 500 nM LbuCas13a, 5 μL of 100 nM crRNA, 5 μL of 500 nM RNA-QD substrate probe, 5 μL of the RNA to be tested, 5 μL of reaction buffer solution (50 mM NaCl, 50 mM pH 8.0 tris-HCl, 10 mM MgCl2), and 29 μL of 10 mM pH 8.0 tris-HCl solution. Place this reaction system in a forced-air drying oven at 37 °C and react for 20 mins.

[0166] (3) After the reaction is completed, add 50 μL of 10 mM pH 8.0 tris-HCl solution to the reaction solution, then transfer it to a fluorescence cuvette for measurement. Set the excitation wavelength to 360 nm, the slit to 10 nm, and measure the fluorescence intensity value of this reaction system at 543 nm;

[0167] Figure 8 For the feasibility analysis of detecting novel coronavirus RNA in Example 3, it can be seen from Figure 8 that when 10 nM of target RNA is added to the system, the fluorescence value of RNA-QD at 543 nm shows an obvious increase.

[0168] Example 4. A method for synthesizing an RNA-QD substrate probe of a CRISPR / Cas system and its application in the detection of novel coronavirus

[0169] 1. The synthesis method of the quantum dot substrate probe of the present invention (i.e., the RNA-QD substrate probe based on the CRISPR / Cas system) in the embodiment includes the following steps:

[0170] (1) Design an RNA sequence according to the cleavage preference of the LbuCas13a protein. The 3' end of the RNA sequence is modified with a quenching group, and its sequence is TTGTCGTCCAGCTCTGAArUrUrUrUrUGATTT-BHQ2; design a DNA sequence that is complementary to 18 bases at the 5' end of the RNA sequence. The 5' end of the DNA sequence is modified with phosphorothioate, and its sequence is G*G*G*G*G*G*G*G*G*G*AAAAATCCCTTGTTCAGAGCTGGACGACAATGATTAGGGTTAG;

[0171] (2) Dissolve cadmium chloride, zinc chloride, and N-acetyl-L-cysteine in DEPC-treated water at a molar ratio of 1:1:4, and adjust the pH value to 9.0 using enzyme-free 1M NaOH to obtain a cadmium precursor; separately add tellurium powder and sodium borohydride with a molar ratio of 1:2 to a 10 mL round-bottom flask, introduce nitrogen, and react for 3.5 h under an anaerobic ice bath condition to obtain a tellurium precursor; then mix 25 nmol of the DNA sequence with 2 mL of the cadmium precursor to obtain a mixed solution A. Take out 5 μL of the tellurium precursor using a microsyringe and quickly transfer it into the mixed solution A to obtain a mixed solution B; finally, react the mixed solution B at 200 °C for 23 minutes to obtain a DNA-QD with a maximum emission wavelength of 547 nm.

[0172] (3) Centrifuge and purify the obtained DNA-QD using an ultrafiltration tube with a molecular cut-off of 50000. After pouring out the waste liquid, add an enzyme-free tris-HCl solution (10 mM pH 8.0) for washing and centrifugation, and wash 3 times in this way; then invert the ultrafiltration tube for centrifugation to obtain a pure DNA-QD product.

[0173] (4) Take 2 μL of a 10 μM RNA sequence and 2 μL of a 2.74 μM pure DNA-QD product and add them to 16 μL of a buffer solution (100 mM NaCl, 10 mM tris-HCl pH 8.0, 10 mM MgCl2), then anneal it at 76 °C for 5 minutes and hybridize it at room temperature for 20 minutes to obtain an RNA-QD substrate probe.

[0174] Figure 9 Figure 10 is the ultraviolet-visible absorption spectrum of the RNA-QD substrate probe of the CRISPR / Cas system synthesized in Example 4. It can be seen from the ultraviolet-visible absorption spectrum that the probe has an obvious absorption peak at 538 nm.

[0175] 2. Its application in the detection of the novel coronavirus includes the following steps:

[0176] (1) Select a partial sequence in the novel coronavirus RNA genome as the target, and its sequence is 5’-UACAGUGCAGGUAGAAUAGCAUUAGU; and design crRNA2 according to the target sequence, and its oligonucleotide sequence is 5’-GACCACCCCAAAAAUGAAGGGGACUAAAACAAUGCUAUUCUAC CUGCACUGUA-3’.

[0177] (2) Construct a reaction system with a total volume of 50 μL, which contains 1 μL of 500 nM LbuCas13a, 5 μL of 100 nM crRNA, 5 μL of 500 nM RNA-QD substrate probe, 5 μL of the RNA to be tested, 5 μL of reaction buffer solution (50 mM NaCl, 50 mM pH 8.0 tris-HCl, 10 mM MgCl2), and 29 μL of 10 mM pH 8.0 tris-HCl solution. Place this reaction system in a forced-air drying oven at 37 °C for 20 mins.

[0178] (3) After the reaction, add 50 μL of 10 mM pH 8.0 tris-HCl solution to the reaction solution, and then transfer it to a fluorescence cuvette for measurement. Set the excitation wavelength to 360 nm, the slit to 10 nm, and measure the fluorescence intensity value of this reaction system at 547 nm;

[0179] Figure 10 For the feasibility analysis of detecting novel coronavirus RNA in Example 4, it can be Figure 10 seen that when 10 nM of target RNA is added to the system, the fluorescence value of RNA-QD at 547 nm increases significantly.

[0180] Example 5. A method for simultaneously detecting novel coronavirus RNA and double-stranded DNA transcribed from RNA using RNA-QD substrate and DNA-QD substrate probe in a CRISPR / Cas system

[0181] (1) Select a partial sequence in the novel coronavirus RNA genome as target 1, and its sequence is 5’-UACAGUGCAGGUAGAAUAGCAUUAGU; and design crRNA1 according to the target sequence, and its oligonucleotide sequence is 5’-GACCACCCCAAAAAUGAAGGGGACUAAAACAAUGCUAUUCUA CCUGCACUGUA-3’; double-stranded DNA is used as target 2, and its oligonucleotide sequences are 5-AATTTTGA AGGTTTGTGTGTTTACCTGAAGTTAG and 5-CTAACTTCAGGTAAACACACAAACCTTCAAAATT; and design crRNA2 according to the target sequence, and its oligonucleotide sequence is 5’-UAAU UUCUACUAAGUGUAGAUAAGGUUUGUGUGUUUACCUG-3’;

[0182] (2) Construct a reaction system with a total volume of 50 μL, which contains 1 μL of 500 nM LbuCas13a, 1.25 μL of 1.6 μM LbCas12a, 5 μL of 100 nM crRNA1, 12.5 μL of 320 nM crRNA2, 5 μL of 500 nM RNA-QD substrate probe, 5.25 μL of 500 nM DNA-QD substrate probe, 5 μL of the double-stranded DNA to be tested, 5 μL of the RNA to be tested, and 10 μL of reaction buffer solution. Place this reaction system in a forced-air drying oven at 37 °C and react for 20 mins. The DNA-QD substrate probe used here is synthesized by reacting at 200 °C for 32 mins according to the method in Reference Example 1, and it is a DNA-QD substrate probe with a wavelength of 674 nm; the RNA-QD substrate probe used is the RNA-QD substrate probe with a wavelength of 547 nm synthesized in Example 4.

[0183] (3) After the reaction is completed, add 50 μL of 10 mM pH 8.0 tris-HCl solution to the reaction solution, then transfer it to a fluorescence cuvette for measurement. Set the excitation wavelength to 360 nm, the slit to 10 nm, and measure the fluorescence intensity values of this reaction system at 547 nm and 674 nm;

[0184] Figure 11 It is a feasibility analysis for simultaneously detecting the nucleic acid of the new coronavirus as RNA and the double-stranded DNA transcribed from RNA in Example 5. Figure 11 The results show that this method can achieve the simultaneous detection of two nucleic acids, namely the RNA of the new coronavirus and the double-stranded DNA transcribed from RNA.

[0185] Finally, it should also be noted that the term "comprises", "comprising" or any other variant thereof is intended to cover a non-exclusive inclusion, such that a process, method, article or device comprising a series of elements not only includes those elements but also includes other elements not expressly listed, or further includes elements inherent to such process, method, article or device.

[0186] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they know the basic creative concept. Therefore, the appended claims are intended to be construed as including the preferred embodiments and all changes and modifications falling within the scope of the present invention.

[0187] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. A preparation method of a quantum dot substrate probe, characterized in that, The method includes: Obtaining a DNA nucleic acid strand with a sequence targeted by LbCas12a protein as shown in SEQ ID NO.1, or an RNA nucleic acid strand with a sequence targeted by LbuCas13a protein as shown in SEQ ID NO.2; the 5' end of the DNA nucleic acid strand or RNA nucleic acid strand is modified with thiophosphate, the 3' end is modified with a quenching group, or the 3' end is modified with thiophosphate and the 5' end is modified with a quenching group; Dissolving cadmium chloride, zinc chloride and N-acetyl-L-cysteine in water and adjusting the pH to 8-10 to obtain a cadmium precursor solution; Reacting tellurium powder and sodium borohydride under an anaerobic ice bath condition to obtain a tellurium precursor solution; Mixing the nucleic acid strand with the cadmium precursor solution, and then adding the tellurium precursor solution, and reacting at 70-200 °C to obtain a quantum dot substrate probe; the molar ratio of cadmium chloride, zinc chloride and N-acetyl-L-cysteine is 1:(0.5-3):(0.2-0.7), the molar ratio of tellurium powder to sodium borohydride is 1:(2-3), and the ratio range of the molar amount of the nucleic acid strand to the volume of the cadmium precursor solution is 25-50 nmol:(1-3) mL; the volume ratio of the cadmium precursor solution to the tellurium precursor solution is (380-420):1, and the reaction time under the anaerobic ice bath condition is 2-5 h.

2. A preparation method of a quantum dot substrate probe, characterized in that The method includes: Obtaining a DNA nucleic acid strand as shown in sequence SEQ ID NO.3 and having a thiophosphate modification at the 5' end; Dissolving cadmium chloride, zinc chloride and N-acetyl-L-cysteine in water and adjusting the pH to 8-10 to obtain a cadmium precursor solution; Reacting tellurium powder and sodium borohydride under an anaerobic ice bath condition to obtain a tellurium precursor solution; Mixing the nucleic acid strand with the cadmium precursor solution, and then adding the tellurium precursor solution, and reacting at 70-200 °C to obtain a reaction product; Hybridizing the reaction product with a DNA nucleic acid strand with a quenching group modified at the 3' end and a sequence as shown in SEQ ID NO.4 or an RNA nucleic acid strand as shown in SEQ ID NO.5 to obtain a quantum dot substrate probe; the molar ratio of cadmium chloride, zinc chloride and N-acetyl-L-cysteine is 1:(0.5-3):(0.2-0.7), the molar ratio of tellurium powder to sodium borohydride is 1:(2-3), and the ratio range of the molar amount of the nucleic acid strand to the volume of the cadmium precursor solution is 25-50 nmol:(1-3) mL; the volume ratio of the cadmium precursor solution to the tellurium precursor solution is (380-420):1, and the reaction time under the anaerobic ice bath condition is 2-5 h.

3. A quantum dot substrate probe prepared by the method according to any one of claims 1-2.

4. Use of the quantum dot substrate probe according to claim 3 in the preparation of a nucleic acid detection kit.

5. Use of the quantum dot substrate probe according to claim 3 in the preparation of a novel coronavirus nucleic acid detection kit.

6. A novel coronavirus nucleic acid detection kit, characterized in that, The kit includes: the quantum dot substrate probe described in claim 3, Cas protein, crRNA, and a buffer solution, and the sequence of the crRNA is selected from at least one of SEQ ID NO.6-SEQ ID NO.7.

Images