A strain of Lactobacillus mucinosus JL20 and its application

Abstract

The present invention discloses a strain of Lactobacillus mucosus from guinea pigs JL20 and its application, belonging to the field of biomedicine. Lactobacillus mucosus from guinea pigs JL20 was deposited in the General Microbiology Center of the China National Committee for the Collection of Microorganisms on July 19, 2023, with the deposit number CGMCC No. 27949. Lactobacillus mucosus from guinea pigs JL20 can be used as an adjuvant in leptospira vaccines, and has the effects of enhancing vaccine potency, improving antibody quality, and enhancing the reactivity of antigen-presenting cells. It is also convenient to administer, significantly reduces the vaccine dosage, reduces production costs, is safe and has no side effects, and reduces the production of inflammatory side effects caused by vaccine immunization, and has very important application value.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a strain of Lactobacillus mucosus JL20 and an application thereof. Background Art

[0002] In recent years, various new or re-emerging infectious diseases and zoonotic diseases have frequently emerged, seriously threatening public health and safety. Leptospirosis is an acute, global, zoonotic, and naturally occurring infectious disease caused by the pathogenic bacterium Leptospira interrogans.

[0003] Currently, over 300 pathogenic Leptospira serotypes have been identified worldwide, and in my country, 18 serogroups and 75 serotypes have been identified. Common serogroups of Leptospira are the icterohaemorrhagiae, Pomona, Canine, Flu-Typhoid, Australian, Autumn, Seven-Day, and Java serogroups. Each serogroup includes multiple serotypes. For example, the icterohaemorrhagiae serogroup includes Bilkin, Icterohaemorrhagiae, Lai, Mankaso, Nwogoro, Namu, and Ndahambakagi serotypes.

[0004] Leptospira has a wide spectrum of infection and can infect almost all warm-blooded animals. Humans, livestock (pigs, cattle, sheep), pets (dogs, cats, horses), rats and other animals are infected when their broken skin and mucous membranes come into contact with urine, semen, milk, sewage, soil, etc. contaminated with Leptospira. The main clinical manifestations include fever, diarrhea, jaundice, hemoglobinuria, miscarriage, stillbirth, and even death from multiple organ failure.

[0005] As an important component of the body, the intestinal flora not only influences the occurrence and development of metabolic diseases such as obesity and diabetes, but also widely participates in immune regulation, affecting the immune efficacy of vaccines. Probiotics are a relatively inexpensive intervention measure. Studies have found that the use of specific probiotics at different age stages can improve the immune efficacy of related vaccines. For example, Bifidobacterium increased the level of anti-poliovirus IgA induced by the DTaP-IPV-Hib vaccine in infant feces, while the addition of Lactobacillus coryneformis to adults increased the levels of anti-hepatitis A virus IgG and IgM induced by the hepatitis A vaccine. Therefore, regulating the host's intestinal flora may be a new direction for improving vaccine efficacy.

[0006] Lactobacillus species are widely distributed in nature, found on plant surfaces, in dairy products, meat products, and fermented carbohydrate products of plants and animals. They are also found in the mouth, vagina, and intestines of warm-blooded animals. Previous studies by our group have shown that the intestinal microbiota is involved in the development and progression of leptospirosis. Changes in the intestinal microbiota caused by leptospirosis infection are correlated with host phenotype, with the abundance of intestinal Lactobacillus species significantly elevated in the tolerant group. Subsequently, we orally administered animal Lactobacillus to mice, improving their resistance to leptospirosis. Based on this, to develop a vaccine adjuvant that is convenient to administer, easily accepted by the body, enhances vaccine potency, mitigates the side effects of inactivated vaccines, and avoids allergic reactions caused by subcutaneous injection of the adjuvant itself, we tested the effects of four different Lactobacillus strains on the immune response to a killed whole-cell Leptospira vaccine. The results showed that one strain significantly enhanced the protective efficacy of the leptospira vaccine, suggesting that intestinal Lactobacillus may exert an adjuvant-like enhancing effect on the leptospira vaccine. Further experiments have successfully screened the JL20 strain for vaccine efficacy, which was shown to increase both the level and quality of antibodies produced by vaccine-induced immunity. Summary of the Invention

[0007] One of the objects of the present invention is to provide a novel strain of Lactobacillus mucosus JL20, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0008] Furthermore, the guinea pig mucus Lactobacillus JL20 provided by the present invention was deposited on July 19, 2023 in the General Microbiology Center of the China Culture Collection Administration Committee (No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing), with a deposit number of CGMCC No. 27949, and was classified as guinea pig mucus Lactobacillus Limosilactobacillus caviae.

[0009] The second object of the present invention is to provide the use of the above-mentioned Lactobacillus mucosus JL20 in Leptospira vaccine adjuvant.

[0010] Furthermore, the Leptospira is icterohaemorrhagiae.

[0011] Furthermore, the Leptospira vaccine is an inactivated Leptospira icterohaemorrhagiae whole-cell killed vaccine.

[0012] Compared with the prior art, the technical effects of the present invention are:

[0013] The present invention starts from the perspective of intestinal flora and screens a probiotic bacterium, Lactobacillus mucosa JL20, which can effectively enhance the protective effect of Leptospira vaccine. Lactobacillus mucosa JL20 is a type of lactic acid bacteria that is anaerobic or facultative anaerobic, acid-producing, acid-resistant and bile-resistant, and can tolerate gastric acid and pepsin to enter the intestine for colonization. It has the effects of enhancing vaccine potency, improving the utilization rate and unit efficacy of vaccine antigens, improving antibody quality, and enhancing the reactivity of antigen-presenting cells. It is also convenient to administer, significantly reducing the vaccine dosage, reducing production costs, being safe and having no side effects, and reducing the occurrence of inflammatory side effects caused by vaccine immunization, and has very important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments described in the present invention. For ordinary technicians in this field, other drawings can also be obtained based on these drawings.

[0015] Figure 1 This is the BLAST comparison result of the 16s sequencing sequence of the JL20 strain provided in Example 1 of the present invention against the NCBI database.

[0016] Figure 2 These are the preliminary experimental screening results of the candidate strains provided in Example 1 of the present invention to enhance the vaccine effect.

[0017] Figure 3 Gram staining microscopic examination photos and optical microscope photos of JL20 single bacteria provided in Example 2 of the present invention.

[0018] Figure 4 This is the liquid culture growth curve of the JL20 strain provided in Example 2 of the present invention.

[0019] Figure 5 The JL20 strain provided in Example 1 of the present invention was used as a vaccine adjuvant to improve the survival rate of mice.

[0020] Figure 6 The JL20 strain provided in Example 2 of the present invention improves the phagocytic rate of Leptospira pathogens by peritoneal macrophages after oral administration.

[0021] Figure 7 The JL20 strain provided in Example 2 of the present invention provides the expression results of IL-1β and IL-6 cytokines that improve the reactivity of antigen-presenting cells after oral administration. DETAILED DESCRIPTION

[0022] To help those skilled in the art better understand the technical solutions of the present invention, the present invention will be further described in detail below with reference to the embodiments and accompanying drawings. Obviously, the embodiments described are only some of the embodiments of the present invention, not all of them. All other embodiments derived by those skilled in the art based on the embodiments of the present invention without creative effort are also within the scope of protection of the present invention.

[0023] The experimental materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores. The experimental methods in the following examples, unless otherwise specified, were conventional methods.

[0024] Example 1 Isolation and screening of strains

[0025] Based on previous research, Lactobacillus was isolated from the intestine of guinea pigs. The isolation culture medium was MRS culture medium purchased from Qingdao Haibo Biological Co., Ltd., with the following numbers: HB0384-14 (broth); HB0384-5 (agar).

[0026] Guinea pig feces from Changchun City, Jilin Province, were collected using a sterile fecal collection box, with 4-6 g of feces transferred to a sterile 1.5 ml centrifuge tube. The feces were mashed using a sterile pipette tip, resuspended in 1 ml of sterile PBS, and centrifuged at 1500 rpm / min for 5 minutes. The supernatant was removed, followed by centrifugation at 5000 rpm / min for 10 minutes, after which the supernatant was discarded and resuspended in 50 μl of sterile PBS. The feces were aseptically spread onto MRS agar plates and cultured in anaerobic bags at 37°C for 12-24 hours. A single colony was picked for Gram staining and transferred to MRS liquid medium for enrichment for 8-12 hours, followed by 16s sequencing. Combining the results of Gram staining and 16s sequencing, two potential lactobacilli were isolated and named JL-10 and JL-20.

[0027] The JL10 and JL20 strains were enriched in liquid culture and subsequently subjected to 16S sequencing. The results showed that the JL10 strain had the highest degree of match with Lactobacillus reuteri, and the JL10 strain was identified as Lactobacillus reuteri. The JL20 strain had the highest degree of match with Lactobacillus mucosus of Guinea pigs, and the JL20 strain was identified as Lactobacillus mucosus of Guinea pigs. The sequencing results of the JL20 strain are shown in SEQ ID NO: 1, and the NCBI database BLAST comparison results are shown in Figure 1 .

[0028] A pilot study was conducted on the oral administration of inactivated Leptospira icterohaemorrhagiae whole-cell killed vaccine against Lactobacillus plantarum standard strain BNCC.194165, Lactobacillus animalis standard strain ATCC 35046, JL10 strain, and JL20 strain. The screening results showed that only JL20 strain could improve the vaccine effect. Figure 2 .

[0029] Example 2 Strain Identification

[0030] 2.1 Colony morphology identification

[0031] The JL20 strain was inoculated on MRS agar medium and cultured at 37℃ for 48 hours. The JL20 single colony was rough and grayish white. Under the microscope, it was long or short rod-shaped with flat ends. The JL20 single colony and the photos under the optical microscope were shown in the figure. Figure 3 .

[0032] 2.2 Liquid culture growth curve determination

[0033] After two subcultures for 18 hours to the logarithmic phase, the fresh culture was inoculated into MRS medium at a volume of 0.1% (volume fraction), and 12 groups were set up for 2 hours, 4 hours, 6 hours, 8 hours, 10 hours, 12 hours, 14 hours, 16 hours, 18 hours, 20 hours, 22 hours, 24 hours, and 30 hours, respectively. Two tubes of bacterial solution were cultured in each group. At the same time, the OD600nm value of the bacterial solution was measured using an ultraviolet spectrophotometer according to the time after inoculation, and the growth curves of the control standard model strain - animal Lactobacillus ACTT 35046 and JL20 strain were drawn according to the OD values.

[0034] According to the growth curve, the bacterial solution at 8h, 12h, and 14h was diluted and plated. The bacterial solution concentration at each OD value was determined according to the dilution multiple and the number of colonies. 10 9 -10 10 (CFU) / ml concentration OD value. The growth curves of ACTT 35046 strain and JL20 strain are shown in Figure 4 .

[0035] 2.3 Identification of physiological and biochemical characteristics

[0036] The inoculation solution in this example was prepared as follows: 1 ml of JL20 bacterial culture was cultured at 37°C for 12 hours under sterile conditions, centrifuged at 5000 rpm / min for 5 minutes, washed twice with sterile PBS buffer, and then resuspended with the same volume of PBS buffer and diluted 50 times to serve as the inoculation solution.

[0037] 1) Salinity tolerance experiment

[0038] Under sterile conditions, add 190 μL of BSM liquid medium containing 1%, 2%, 3%, 4%, 5%, 6%, 7%, or 8% salt concentrations to a 96-well plate (replicate in triplicate). Then, add 10 μL of inoculum. Uninoculated wells serve as controls. Add 50 μL of autoclaved paraffin oil to each well to prevent evaporation during incubation. Incubate at 37°C and observe whether the medium becomes turbid.

[0039] The results showed that the JL20 strain grew at a salt concentration of 1% to 6%, did not grow at a salt concentration of 7% to 8%, and had a maximum tolerance to salt concentration of 6%.

[0040] 2) Hydrogen peroxide experiment

[0041] Take a drop of fresh bacterial liquid and drop it on a clean slide, then add a drop of 3% hydrogen peroxide solution on it. It is observed that the JL20 strain does not produce bubbles, which is a negative reaction.

[0042] Example 3 Tolerance test of guinea pig Lactobacillus mucinous JL20 to artificial gastric juice and artificial intestinal juice

[0043] 3.1 Preparation of artificial gastric juice

[0044] Weigh 5 g of peptone, 2.5 g of yeast extract, 1 g of glucose, and 2 g of sodium chloride, add 1000 ml of distilled water, adjust the pH to 3.0 with dilute hydrochloric acid, and sterilize at 115°C for 20 minutes. Add 3.2 g of porcine mucosal pepsin before use, shake well to dissolve, and incubate in a 37°C water bath for 1 hour to simulate human body temperature.

[0045] 3.2 Preparation of artificial intestinal fluid

[0046] Weigh 5 g of peptone, 2.5 g of yeast extract, 1 g of glucose, 6.8 g of potassium dihydrogen phosphate, and 3.0 g of ox bile salts, add 77 ml of 0.2 mol / L sodium hydroxide solution, and dilute to 1000 ml. Adjust the pH to 6.8 ± 0.1 with dilute hydrochloric acid or sodium hydroxide solution, and sterilize at 115°C for 20 minutes. Add 1 g of pancreatin before use, shake well to dissolve, and incubate in a 37°C water bath for 1 hour to simulate human body temperature.

[0047] 3.3 Experimental methods

[0048] Take 2 ml of fresh bacterial liquid and centrifuge at 5000 rpm / min for 5 minutes to collect the bacteria. The bacteria are washed three times with normal saline and resuspended in 2 ml of normal saline to serve as the inoculum. Take 1 ml of the inoculum and add it to 24 ml of artificial gastric juice and artificial intestinal juice respectively. Place it in a 37°C water bath shaker (200 rpm / min) for 3 hours, and then sample 1 ml. The viable bacteria count method is in accordance with the national standard "GB4789.35-2016-Food Microbiology Test Lactic Acid Bacteria Test" to test the viable bacteria count before digestion, after artificial gastric juice digestion, and after artificial intestinal juice digestion. The viable bacteria count (Log CFU / mL) of the JL20 strain after artificial intestinal juice digestion is shown in Table 1.

[0049] Table 1 The amount of viable bacteria after digestion with artificial gastric juice and artificial intestinal juice

[0050]

[0051] The results showed that the viable bacterial count of the isolated JL20 strain decreased by only about 0.3 Log CFU / ml after digestion with artificial gastric juice, and by only about 1.1 Log CFU / ml after digestion with artificial intestinal juice, indicating that the strain has strong tolerance to artificial gastric and intestinal juices.

[0052] Application Example 1: Study on the effect of guinea pig Lactobacillus mucosa JL20 as an oral adjuvant to enhance vaccine efficacy

[0053] Grouping and oral dosage:

[0054] In this example, the standard model strain of Lactobacillus animalis ATCC 35046 and the aluminum gel adjuvant were used as controls. 80 guinea pigs weighing 120-180 g were selected and divided into 5 groups, namely, a blank control group, a vaccine control group, an aluminum gel adjuvant control group, a standard strain control group, and an isolated strain experimental group, with 16 animals in each group. Fresh liquid MRS culture of the standard model strain of Lactobacillus animalis ACTT 35046 and the isolated strain of Lactobacillus guinea pig mucosa JL20 were orally administered at a dose of 1×10 9 CFU / ml (OD600nm≈1.2), volume is 200 μl / mouse.

[0055] The specific implementation plan is as follows:

[0056] Take 1 ml of fresh culture medium at 5000 rpm / min, centrifuge for 5 minutes, wash 3 times with sterile PBS, and resuspend in 200 μl. The immunization schedule uses two immunizations every 28 days, with oral administration for 5 consecutive days before each immunization, followed by 10 4 / dose (half-protective immune dose) for immunization; the aluminum gel adjuvant control group was administered 30% aluminum gel adjuvant + half-protective immune dose, the vaccine control group was immunized with only half-protective immune dose, and the blank control group was injected with the same dose of sterile PBS. During the immunization period, blood was collected from the fundus venous plexus 14 days and 28 days after the first immunization, and the serum was subjected to antibody titer MAT detection and antibody quality detection. After the immunization program, the homologous icterohaemorrhagiae type, heterologous canine type, autumn type, and influenza typhoid type of Leptospira were used to challenge with a full lethal dose (4 / group). During the experiment, the guinea pigs were free to eat and drink water, and the daylight / darkness was 12 hours / 12 hours. They were observed for 21 days after the challenge.

[0057] The results show:

[0058] Icterohemorrhagic type challenge - blank control group (0 / 4), vaccine control group (2 / 4), aluminum gel adjuvant control group (2 / 4), standard strain control group guinea pigs (2 / 4), isolated strain experimental group (4 / 4); Canine type challenge - blank control group (0 / 4), vaccine control group (0 / 4), aluminum gel adjuvant control group (0 / 4), standard strain control group guinea pigs (0 / 4), isolated strain experimental group (3 / 4); Autumn type challenge - blank control group (0 / 4), vaccine control group (0 / 4), aluminum gel adjuvant control group (0 / 4), standard strain control group guinea pigs (0 / 4), isolated strain experimental group (2 / 4); Influenza typhoid type challenge - blank control group (0 / 4), vaccine control group (0 / 4), aluminum gel adjuvant control group (0 / 4), standard strain control group guinea pigs (0 / 4), isolated strain experimental group (2 / 4). Survival rate results are shown in Figure 5 , indicating that the isolate experimental group can improve the vaccine effect, and the icterohemorrhagic type increases the survival rate to 100%, while improving the cross-protection effect of the other three types, significantly reducing the vaccine dosage, reducing the inflammatory side effects caused by vaccine immunization, and reducing production costs.

[0059] The MAT results of antibody titers at different time points are shown in Table 2, indicating that the antibody level in the isolate experimental group was significantly higher than that in the other groups. In addition, due to the use of half the immune dose, the antibody titers of the blank control group and the aluminum gel adjuvant control group were generally lower; the antibody quality results are shown in Table 3, indicating that the antibody binding ability of the isolate experimental group against heterologous strains was significantly higher than that of the other groups, indicating that the antibody quality was significantly improved.

[0060] Table 2 MAT results of antibody titers at different time points

[0061]

[0062] Table 3 Antibody quality MAT results

[0063]

[0064] Application effect example 2: Study on the effect of Lactobacillus mucosus JL20 on enhancing the reactivity of antigen presenting cells in guinea pigs

[0065] Grouping and oral dosage:

[0066] In this example, the standard type strain of Lactobacillus animalis ATCC 35046 was used as a control. Fifteen guinea pigs weighing 120-180 g were selected and divided into three groups: a blank control group, a standard strain control group, and an isolated strain experimental group, with 5 animals in each group. Fresh liquid MRS culture of the standard type strain of Lactobacillus animalis ACTT 35046 and the isolated strain of Lactobacillus guinea pig mucosa JL20 were orally administered at a dose of 1×10 9 CFU / ml (OD600nm≈1.2), volume is 200 μl / mouse.

[0067] The specific implementation plan is as follows:

[0068] The standard strain control group and the isolated strain experimental group were orally administered with the above doses for 5 consecutive days, and the blank control group was orally administered with sterile PBS. Subsequently, sterile thioglycollate (TG) was intraperitoneally injected at 2.5 ml / mouse. Three days after the injection, the guinea pig peritoneal cavity was flushed with 1640 pure culture medium under sterile conditions, primary peritoneal macrophages were extracted, and red blood cell lysis solution was used to remove red blood cells. The cells were resuspended in DMEM culture medium, counted on a cell counting plate, and resuspended in DMEM + 10% fetal bovine serum + 1% double-antibody culture medium, plated on a 6-well plate, 1.5 ml / well of culture medium, and 2.5*10 cells were cultured. 6 / well, and then placed in a cell culture incubator at 37°C, 5% carbon dioxide for 6 hours to allow the cells to adhere.

[0069] Each group of cells was divided into two groups: a non-challenged group and a Leptospira-challenged group. The Leptospira-challenged group used 2.5*10 8 The cells were challenged with a dose of 1 mg / well for 1 hour, washed three times with sterile PBS, and trypsinized at 1200 rpm / min for 5 minutes. The cells were collected and DNA was extracted. The number of leptospires in the cells, i.e., the phagocytic rate of the cells, was detected by RT-qPCR using the Leptospira Lipl32 primers. The results are shown in the table. Figure 6 The results showed that the phagocytic rate of pathogens by peritoneal macrophages in the isolate experimental group was significantly higher than that in the standard strain control group.

[0070] Each group of cells was divided into unstimulated group and vaccine-stimulated group. The vaccine-stimulated group was treated with inactivated Leptospira vaccine 2.5*10 8 The cells were stimulated with a dose of 100 μg / well for 24 hours, and RNA samples were collected. Guinea pig IL-1β primers and guinea pig IL-6 primers were used to detect the expression of IL-1β and IL-6 cytokines. The results are shown in the table. Figure 7 The results showed that the expression levels of IL-1β and IL-6 in the isolate control group after pathogen infection were significantly higher than those in the standard strain control group.

[0071] Leptospira Lipl32 primer sequences:

[0072] Upstream primer: TCGCTGAAATRGGWGTTCGT

[0073] Downstream primer: CGCCTGGYTCMCCGATT

[0074] Guinea pig IL-1β primer sequence:

[0075] Upstream primer: TTCTGTGACTCCTGGGATGGT

[0076] Downstream primer: GTTGGTTTATGTTCTGTCCGTTG

[0077] Guinea pig IL-6 primer sequence:

[0078] Upstream primer: ACCCTGGCTGTATGGACAATG

[0079] Downstream primer: AGTCCAGAAGACCAGAGGTGA

[0080] The above-described embodiments are only specific implementation methods of the present application, which are used to illustrate the technical solutions of the present application, rather than to limit them. The scope of protection of the present application is not limited thereto. Although the present application has been described in detail with reference to the above-mentioned embodiments, those skilled in the art should understand that any person skilled in the art can modify or easily conceive of changes to the technical solutions described in the above-mentioned embodiments within the technical scope disclosed in the present application, or perform equivalent replacements for some of the technical features thereof; and these modifications, changes or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present application. They should all be included in the scope of protection of the present application. Therefore, the scope of protection of the present application shall be subject to the scope of protection of the claims.

Claims

1. A strain of Limosilactobacillus caviae JL20, characterized in that: It was deposited in the General Microbiology Center of China Culture Collection Administration on July 19, 2023, with the deposit number CGMCC No. 27949.

2. The use of Lactobacillus mucosus JL20 of claim 1 in preparing a Leptospira vaccine adjuvant, wherein: The Leptospira is an icterohaemorrhagiae Leptospira.

3. The use according to claim 2, characterized in that The Leptospira vaccine is an inactivated Leptospira icterohaemorrhagiae whole-bacterial vaccine.

Images