Use of a compound in preparing a drug for improving or treating liver damage and / or liver fibrosis

Abstract

The present invention provides an application of a compound in the preparation of a drug for improving or treating liver damage and / or liver fibrosis, and the present invention belongs to the field of biomedical technology. The present invention provides an application of a compound in the preparation of a drug for improving or treating liver damage and / or liver fibrosis, wherein the compound inhibits liver fibrosis by activating Mettl3. The present invention verifies that overexpression of Mettl3 in the liver of mice inhibits the progression of liver fibrosis, and finds that the expression level of Mettl3 in liver tissue is negatively correlated with the progression of liver fibrosis, that is, Mettl3 has an inhibitory effect on the course of liver fibrosis, and by comparing three small molecule compounds that have an activating effect on Mettl3, a small molecule compound that can be used to treat liver fibrosis is screened, which can be used to develop drugs for preventing and treating liver fibrosis.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to the use of a compound in preparing a drug for improving or treating liver damage and / or liver fibrosis. Background Art

[0002] Chronic liver disease seriously threatens human health. Nearly 1 billion people worldwide suffer from liver disease, causing about 2 million deaths each year, bringing serious social problems and economic burdens. The causes of chronic liver disease include: viral infection (such as hepatitis B virus HBV, hepatitis C virus HCV, etc.), alcoholic fatty liver (Alcoholic Steatohepatitis, ASH), non-alcoholic fatty liver (non-alcoholic steatohepatitis, NASH), autoimmune and genetic factors. Among the chronic liver diseases caused by the above various causes, liver fibrosis is a common progression process. Liver fibrosis is characterized by the accumulation of extracellular matrix and the destruction of the physiological structure of the liver. The liver fibrosis process is a heterogeneous proliferation, migration population and fibroblasts that regulate inflammation / immune response and angiogenesis. In the liver, the occurrence of fibrosis mainly determines the quality of life and prognosis. The level of fibrosis is related to liver function. The disease may progress to cirrhosis and is also a major risk factor for the occurrence of hepatocellular carcinoma.

[0003] Mettl3 is a methyltransferase 3 gene, which is an RNA modification m 6 A(N6-methyladenosine,m 6 A) The core molecule of the methylase complex, whose main function is to catalyze the m6A modification of RNA molecules on N6-methyladenine. The role of Mettl3 in liver diseases is more complex. The expression level of Mettl3 is significantly upregulated in patients with hepatocellular carcinoma, accompanied by m 6 A modification level is increased and is associated with poor prognosis. Many articles at home and abroad have reported on the progress of the role of Mettl3 in liver disease. Among them, an article published in Nature communication by Xinzhi Li et al. in 2021 pointed out that Mettl3 has a negative regulatory effect on the progression of the nonalcoholic steatohepatitis (NASH) phenotype. Liver-specific knockout of Mettl3 expression can promote the progression of nonalcoholic fatty liver (NAFL) to nonalcoholic steatohepatitis NASH. Another study showed that Mettl3 promotes the progression of nonalcoholic fatty liver (NAFL) to nonalcoholic steatohepatitis NASH by promoting the 3' end mRNA of tumor suppressor genes. 6A modification accelerates its degradation, or promotes the proliferation, invasion and metastasis of liver cancer cells by acting together with YTHDF1. In the study cohort of intrahepatic cholangiocarcinoma, it was also found that the expression level of Mettl3 in cholangiocarcinoma tissue was higher than that in adjacent tissues, and was positively correlated with poor prognosis.

[0004] In summary, the role of Mettl3 in liver fibrosis still needs to be further explored and studied by scientists. 6 A component of the modified protein complex, m 6 Modification of mA can reduce liver damage caused by lipid deposition. In addition, in the reversal of liver fibrosis, m 6 The A modification is enriched in immune responses and apoptosis.

[0005] To date, there is still a lack of effective anti-liver fibrosis therapeutic drugs and methods in clinical practice, and there is no public activator targeting Mettl3 activation as a drug for the prevention and treatment of liver fibrosis. Summary of the invention

[0006] The purpose of the present invention is to provide a targeted therapeutic drug with significant therapeutic effects for liver fibrosis, and to provide new ideas and design directions for the research and development and application of a new generation of drugs for liver fibrosis.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides use of a compound in preparing a medicament for improving or treating liver damage and / or liver fibrosis.

[0009] Preferably, the compound inhibits liver fibrosis by activating Mettl3.

[0010] Preferably, the compound is methyl 2-piperazinecarboxylate dihydrochloride or a high-efficiency expression vector carrying the Mettl3 gene.

[0011] Preferably, the high-efficiency expression vector includes a plasmid vector and a viral vector.

[0012] Preferably, the efficient expression vector is the liver-tropic adeno-associated virus AAV8 carrying the Mettl3 gene of mouse origin.

[0013] Preferably, the drug is administered by intravenous injection.

[0014] The invention also provides the use of 2-piperazinecarboxylic acid methyl ester dihydrochloride as a Mettl3 activator.

[0015] Beneficial Effects

[0016] 1. The present invention screened and obtained an activator targeting Mettl3 by verifying that overexpression of Mettl3 in the liver of mice inhibits the process of liver fibrosis. The results of animal experiments showed that in the CCl4-induced mouse liver fibrosis model, the adeno-associated virus AAV8 carrying the Mettl3 overexpression vector was injected into the tail vein, causing the liver tissue to overexpress Mettl3. The test results showed that in the serum of mice in the Mettl3 overexpression group, the AST / ALT level, which is an indicator of the severity of liver damage, was significantly lower than that in the control group, and the content of hydroxyproline, the main component of collagen, in the liver tissue was also significantly reduced. At the protein level, the indicators of fibrosis degree, α-SMA, COL1A1, and PDGFRβ, were also significantly reduced.

[0017] 2. The present invention has found through experiments that the expression of Mettl3 in liver tissue is negatively correlated with the progression of liver fibrosis, that is, Mettl3 has an inhibitory effect on the course of liver fibrosis. The present invention compares three small molecule compounds that have an activating effect on Mettl3: 3-piperidinecarboxylate (Methyl piperidine-3-carboxylate, Cas: 50585-89-2), 6-methyl-3-piperidinecarboxylic acid methyl ester (6-Methyl-3piperidinecarboxylic acid Methyl ester, Cas: 908245-03-4) and 2-piperazinecarboxylic acid methyl ester dihydrochloride (Methyl piperazine-2-carboxylatedihydrochloride, Cas: 122323-88-0), and screens out a small molecule compound that can be used to treat liver fibrosis by verifying their therapeutic effects on liver fibrosis. The present invention proves that methyl 2-piperazinecarboxylate dihydrochloride, as a drug intermediate, has Mettl3 activator activity, can promote the expression of Mettl3, and delay the development of liver fibrosis. That is, methyl 2-piperazinecarboxylate dihydrochloride can slow down the occurrence and progression of liver fibrosis, and can be used to develop drugs for preventing and treating liver fibrosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a plasmid map of the Mettl3 overexpression virus constructed using the AAV8-TGB overexpression vector in Example 1 of the present invention.

[0019] Figure 2The induction scheme and results of improving CCl4-induced liver fibrosis after overexpression of Mettl3 in mouse liver by adenovirus AAV8 vector in Example 2 of the present invention. Among them, A is a scheme for studying the effect of overexpression of Mettl3 in mouse liver on CCl4-induced liver fibrosis. B is a comparison of the livers of mice induced with CCl4 after tail vein injection of AAV8-Mock in the control group and AAV8-Mettl3 in the experimental group. C is the relative expression of mRNA of Mettl3 gene in the livers of the two groups of mice.

[0020] Figure 3 The following is a description of the physical signs of mice with CCl4-induced liver fibrosis after in vivo overexpression of Mettl3 in Example 2 of the present invention, and the content of fibrosis-related proteins in serum and liver. A is the ratio of liver weight to body weight of mice in the experimental group and the control group, and the content of ALT and AST in serum. B is the content of hydroxyproline in the liver of mice in the experimental group and the control group. C is the content of liver fibrosis-related proteins α-SMA, COL1A1 and PDGFR-β in the liver of mice in the above-mentioned experimental group and the control group.

[0021] Figure 4 These are the results of pathological examination of liver fibrosis induced by CCl4 in mice after overexpression of Mettl3 in vivo in Example 2 of the present invention. A is the results of hematoxylin-eosin (HE), Sirius red and Masson staining, and B is the immunohistochemical results of ɑ-SMA and COL1A1.

[0022] Figure 5 The chemical structures of three Mettl3 agonists MA1, MA2 and MA3 in Example 3 of the present invention and the steps for investigating the effects of the compounds on CCl4-induced liver fibrosis in mice; A is the chemical structures of MA1, MA2 and MA3; B is the research scheme for the inhibitory effects of Mettl3 agonists MA1, MA2 and MA3 on CCl4-induced liver fibrosis.

[0023] Figure 6 The ALT and AST levels in the serum of mice induced by CCl4 and treated with three Mettl3 agonists MA1, MA2 and MA3 in Example 3 of the present invention.

[0024] Figure 7 The inhibitory effect of MA3 on induced liver fibrosis in Example 3 of the present invention; A is a comparison of the livers of mice in the control group injected with CCl4, and mice in the experimental group 3 injected with MA3 and the control group; B is a comparison of the ratio of liver weight to body weight and the relative expression of Mettl3 in the above two groups of experiments.

[0025] Figure 8The results of pathological examination of mice in experimental group 3 and control group in Example 3 of the present invention include the results of hematoxylin-eosin (HE) staining, Sirius red staining and Masson staining. DETAILED DESCRIPTION

[0026] In the following examples of the present invention, methyl piperidine-3-carboxylate (Methyl piperidine-3-carboxylate, Cas: 50585-89-2, referred to as MA1 in the present invention), methyl 6-methyl-3-piperidinecarboxylate (6-Methyl-3piperidinecarboxylic acid Methyl ester, Cas: 908245-03-4, referred to as MA2 in the present invention), and methyl 2-piperazinecarboxylate dihydrochloride (Methyl piperazine-2-carboxylate dihydrochloride, Cas: 122323-88-0, referred to as MA3 in the present invention).

[0027] The “#” in the attached figure is the laboratory naming code.

[0028] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0029] Example 1. Preparation of AAV8-mediated adenovirus for high expression of Mettl3 gene in mouse liver

[0030] In order to ensure efficient expression of Mettl3 in the liver, the AAV8 recombinant adenovirus assembly system was selected to realize the in vivo experiment of overexpressing Mettl3 in mouse liver. The recombinant adeno-associated virus AA8 serotype has the advantages of strong liver targeting, good safety, low immunogenicity, wide host range, and long-term stable expression of exogenous genes. First, the target gene fragment is the mouse Mettl3 gene with a size of 1743bp (NCBI gene NM_019721.2). Second, the recombinant adenovirus plasmid carries important elements such as the adenotoxin backbone and the liver-targeted TGB promoter. The Mettl3 target gene fragment is assembled into the AAV8-TGB vector by gene synthesis to obtain the AAV8-TGB-Mettl3 vector structure ( Figure 1). Third, prepare 315μg of recombinant plasmid AAV8-TGB-Mettl, 30μl of liposome transfection reagent Lipo3000 and 500μl of serum-free culture transfection body. After standing for 20 minutes for complexation, add the above system to HEK293 cells cultured in a 10cm culture dish. After 48h of culture and transfection, collect the culture fluid containing the virus in the upper layer. Fourth, use low-speed centrifugation or filtration to remove cells and cell debris to obtain a clear virus solution. Add 10% volume fraction of polyethylene glycol (PEG) to the clarified virus solution, mix gently to ensure that PEG is completely dissolved, and incubate at 4°C for 12 hours to allow the virus particles to bind to PEG. Centrifuge at 12000rpm at 4°C to precipitate the virus particles bound to PEG.

[0031] Example 2. Adenovirus-mediated targeted overexpression of Mettl3 gene in the liver of mice to inhibit liver fibrosis (1) Experimental method:

[0032] 20 SPF-grade C57BL / 6J male mice, 8 weeks old and weighing 22-25g, were purchased from Beijing Weitong Lihua Experimental Animal Technology Co., Ltd. The mice were placed in a quiet environment before the experiment, and the room temperature was controlled at 25°C and the humidity was 55% for one week to adapt. The mice were randomly divided into two groups. The experimental group was AAV8-Mettl3, which was a liver-tropic adeno-associated virus AAV8 carrying the Mettl3 gene of the mouse species, and the control group was AAV8-Mock, which was an empty adeno-associated virus AAV8. It was injected into the mouse by tail vein injection. The titer of AAV8 adeno-associated virus was: 5×10 11 μg / 20g mouse body weight.

[0033] Subsequently, the two groups were simultaneously subjected to CCl4-induced liver fibrosis in mice. CCl4 was dissolved in corn oil and injected intraperitoneally into the mice at a concentration of 0.5 μL / g of mouse body weight. The administration was performed twice a week for a total of 9 times (the induction scheme of liver fibrosis is as follows Figure 2 A). After reaching the end point of the experiment, the weight of each mouse was weighed and recorded, and orbital blood was collected from the living mice into a 1.5 ml centrifuge tube. After standing at room temperature for 30 minutes, gradient centrifugation was performed at 3,000 rpm for 30 minutes, and the upper layer of mouse serum was collected and stored at -80°C. The serum alanine aminotransferase (ALT), aspartate aminotransferase (AST) and other indicators were detected by an automatic biochemical analyzer to reflect whether there was abnormal liver function.

[0034] Mouse liver tissue was obtained by dissection and divided into three parts. The first part of the liver tissue was used to extract RNA from the liver tissue, the second part was used to extract protein from the liver tissue, and the third part was fixed in 4% paraformaldehyde solution for subsequent pathological experiments.

[0035] A portion of liver tissue was taken to extract tissue RNA and detect the expression level of the target gene.

[0036] First, extract total RNA using the Trizol method: take 100 mg of tissue and place it in a 1.5 mL centrifuge tube, add 1 mL of Trizol reagent to fully homogenize, let stand at room temperature for 5 minutes, add 200 μL of chloroform, shake vigorously for 30 seconds, let stand for 3 minutes, centrifuge at 4°C, 12,000 rpm for 20 minutes, take the upper aqueous phase to a new 1.5 mL centrifuge tube, add 500 μL of isopropanol, mix by inversion, let stand at 4°C for 20 minutes, centrifuge at 4°C, 12,000 rpm for 20 minutes, discard the supernatant, add cold 75% ethanol, resuspend and wash the precipitate, centrifuge at 4°C, 12,000 rpm for 10 minutes, discard the supernatant, and add an appropriate amount of DEPC (RNase Free) water to dissolve RNA. The quality of RNA was tested using a Thermo Scientific Nanodrop 2000 micro-spectrophotometer, and OD 260 / OD 280 If the ratio range is between 1.8 and 2.1, the RIN value is >7, the double peaks are clear and there is no impurity peak concentration >20ng / μL, and the volume is >50μL, then the RNA passes the quality test.

[0037] Second, reverse transcription of cDNA: RNA denaturation, take excess RNA solution and heat it at 65℃ for 5 minutes, then quickly put it on ice for 2 minutes. Place it in a handheld centrifuge and centrifuge it for a few seconds to make the RNA denatured solution accumulate at the bottom of the tube. Prepare the following reverse transcription system:

[0038] Table 1 Reverse transcription system

[0039] Denatured RNA template 800ng 5×RTMasterMix 4μL RNase / DNase free water Make up to 20 μL

[0040] Reverse transcription PCR reaction conditions: 37°C, 15 min; 50°C, 5 min; 98°C, 5 min, and finally maintained at 10°C. The cDNA obtained by reverse transcription was stored at -20°C.

[0041] Third, use qRT-PCR to detect the expression level of the target gene: dilute the cDNA, dilute the reverse transcribed product cDNA 20 times with RNase / DNase free water, and centrifuge to mix.

[0042] The qRT-PCR reaction system was configured using the miScript SYBR Green PCR Kit as follows:

[0043] Table 2 qRT-PCR reaction system

[0044] 2×SYBRGREENmix 10μL Upstream primer 0.5μL Downstream primer 0.5μL cDNA template 1μL <![CDATA[ddH2O]]> 8μL Total reaction volume 20μL

[0045] The primer sequences used in the present invention are as follows (primers provided by Qingke Biotechnology Co., Ltd.):

[0046] Table 3 Primer sequences

[0047] musMettl3-RT-1F CTGGGCACTTGGATTTAAGGAA musMettl3-RT-1R TGAGAGGTGGTGTAGCAACTT musGapdh-RT-1F CATCACTGCCACCCAGAAGACTG musGapdh-RT-1R ATGCCAGTGAGCTTCCCGTTCAG

[0048] Design the sample addition plate, add the reaction system and samples in sequence, and make 3 replicate wells for each group.

[0049] The PCR reaction program was set as follows: 95°C, 2 min; (95°C, 15 s; annealing temperature 56°C, 30 s; 72°C, 30 s) × 40 cycles; 72°C, 5 min; 10°C, hold. The PCR plate with the sample was centrifuged at 1200 rpm for 5 min and placed in an IQ5 fully automatic fluorescent real-time quantitative PCR instrument to run PCR. After the PCR was completed, U6 was used as an internal reference to calibrate the expression level of miR-194-5p. The calculation method was 2 －△△Ct Relative quantitative method (i.e. △Ct = gene Ct-Reference gene Ct, reference △Ct = NC△Ct mean, △△Ct = △Ct-reference △Ct, relative expression is 2 -△△Ct ).

[0050] The second part is to detect the content of target protein by protein immunoblotting of liver tissue.

[0051] The specific method is to take the tissue into a 1.5mL EP tube, add 400μL cold (4℃) RIPA lysis buffer (containing composite protease inhibitor PI) to resuspend, place on ice for 20min, and mix once every 10min. Centrifuge the lysate at 4℃, 12,000rpm for 15min, transfer the protein supernatant to a new EP tube, measure the protein concentration with a spectrophotometer, and store at -80℃ for later use. Select a suitable glass plate and comb and clean them, and install the glass plate according to the instructions. Prepare the separation gel and the concentrated gel. When preparing 10mL of separation gel, the required volume of each component is prepared as follows (mL):

[0052] Table 4 Separation gel formula

[0053]

[0054] Preparation of 30% polyacrylamide: Weigh 29 g acrylamide and 1 g N,N'-methylenebisacrylamide, dissolve at 37°C, and adjust the volume to 100 mL.

[0055] The required volumes of each component for preparing concentrated gel are as follows (mL):

[0056] Table 5 Concentrated gel formula

[0057]

[0058]

[0059] Slowly add separation gel to the glass plate to avoid bubbles, then slowly add distilled water until it is full, press flat and wait for the separation gel to solidify, discard the upper layer of distilled water, slowly add concentrated gel, and slowly insert the comb to avoid bubbles. When the gel is completely solidified, put the glass plate into the electrophoresis tank, carefully pull out the comb, add electrophoresis solution to cover the sample hole to expel bubbles. For protein sample preparation, choose the appropriate loading amount according to the protein concentration, add 1 / 3 volume of 4× loading buffer of the protein sample, mix thoroughly and boil in water for 5 minutes to denature the protein. Take the appropriate amount of protein sample and add it to the sample well, add markers at the appropriate position, cover the electrophoresis tank lid, start at 80V, adjust the voltage to 180V after the band enters the separation gel, and run electrophoresis until bromophenol blue runs out of the bottom of the separation gel. Transfer membrane, cut the gel, measure the size of the gel, soak the gel in the electrotransfer solution, cut the PVDF membrane and two filter papers of the same size as the gel, soak the PVDF membrane in methanol for 30 seconds, then soak it in the electrotransfer solution, and soak the filter paper directly in the electrotransfer solution. Put the filter paper, PVDF membrane, gel, and filter paper into the electrotransfer instrument in order from top to bottom, and start electrotransfer after removing the bubbles. The voltage is adjusted to 25V, and the transfer time depends on the molecular weight of the protein. Block, immerse the PVDF membrane in the blocking buffer (5% skim milk powder prepared with TBST), and gently shake at room temperature for 2h. Incubate the primary antibody, dilute the primary antibody with the blocking buffer according to the antibody instructions, immerse the PVDF membrane in the primary antibody dilution, and incubate overnight at 4℃. Incubate the secondary antibody, wash three times with TBST, 10min each time, dilute the secondary antibody corresponding to the primary antibody species with the blocking buffer, immerse the PVDF membrane in the secondary antibody dilution, and incubate it on a shaker at room temperature for 1h. ECL development, TBST washing three times, 10 min each time. Prepare ECL developer, mix equal volumes of solution A and solution B, absorb excess TBST on the PVDF membrane with filter paper, immerse in developer, and develop using an automatic developer.

[0060] The third part of liver tissue was taken and fixed with 4% paraformaldehyde for 24 h before immunohistochemical staining evaluation.

[0061] Baking: Place the paraffin slices in a baking machine or oven at 60℃ for 1 hour to evaporate the moisture on the wax slices and melt the paraffin. Dewaxing and hydration: Place the slices in xylene I for 15 minutes, xylene II for 15 minutes, 100% ethanol for 5 minutes, 100% ethanol II for 5 minutes, 95% ethanol for 5 minutes, and 70% ethanol. Antigen repair: Since some antigens in the tissue lose their antigenicity due to cross-linking between proteins and blocking of aldehyde groups during the fixation process of formaldehyde or paraformaldehyde, antigen repair can be used to expose the antigenic determinants in the cells again, thereby improving the antigen detection rate. Commonly used repair methods are generally divided into three types from strong to weak: high-pressure repair, microwave repair, and pancreatic enzyme repair. We use microwave repair. If the antigen repair method is not specified on the antibody data sheet, the best repair method for each antigen must be determined experimentally. Use enough antigen repair solution to cover the slide and the liquid level should be at least several centimeters higher. Add appropriate antigen repair buffer to a microwave-safe container. Use a non-sealed container to ensure that the solution can evaporate when boiling. Always pay attention to the evaporation and watch out for boiling over during the process. Heat on high heat for 5 minutes to make the repair solution boil. Put the slices in while hot, turn to low heat and heat for 20 minutes to perform antigen repair. After the slices cool naturally in the antigen repair solution, wipe off the moisture around the tissue and draw circles around the tissue with an immunohistochemical oil pen. Membrane disruption (cell permeabilization): The purpose is to allow antibodies to fully enter the cell for binding reaction. Generally, permeabilization solutions such as Triton X-100 and proteinase k are used. For example, Triton X-100 can dissolve lipids on the cell membrane, nuclear membrane, and organelle membrane to allow antibodies and macromolecular substances to enter the cytoplasm and nucleus. Therefore, it is particularly recommended for cell immunohistochemistry, so that antibodies can smoothly enter the cell and bind to the corresponding antigen. In immunohistochemistry (>10μm thick sections) and immunocytochemistry, Triton X-100 is generally used as a cell permeabilizer to punch holes in the membrane. Add 0.2% Triton X-100 to the tissue to break the membrane for 30 minutes. Rinse with PBS buffer 3 times, 5 minutes each time to inactivate endogenous peroxidase: add endogenous peroxidase blocker or 0.3% hydrogen peroxide to inactivate endogenous peroxidase, and incubate at room temperature for 10 minutes in the dark. Rinse with PBS buffer 3 times, 5 minutes each time. Incubate with primary antibody: prepare primary antibody with antibody diluent and incubate at 4℃ overnight. Recover primary antibody, rinse with PBS buffer 3 times, 5 minutes each time, add reaction enhancement solution, and incubate at room temperature for 20 minutes. Rinse with PBS buffer 3 times, 5 minutes each time, add secondary antibody and incubate at room temperature for 20 minutes. Rinse with PBS buffer 3 times, 5 minutes each time, prepare DAB color development solution, and develop color under a microscope. Hematoxylin nuclear labeling: stain with hematoxylin solution for 1 min 30 s, rinse with tap water until colorless, dehydrate and seal with neutral resin.

[0062] (2) Experimental results:

[0063] like Figure 2 As shown, the surface of mouse liver tissue was smoother in the AAV8-Mettl3 group than in the AAV8-Mock group after induction of liver fibrosis ( Figure 2 B), the expression of Mettl3 in liver tissue increased significantly ( Figure 2 C).

[0064] like Figure 3 As shown in Figure 2, the ratio of liver weight to body weight in the AAV8-Mettl3 group was lower than that in the AAV8-Mock group, and the levels of ALT and AST in serum were significantly lower than those in the AAV8-Mock group ( Figure 3 A), indicating that high expression of Mettl3 in liver tissue can significantly inhibit the degree of liver damage in the process of liver fibrosis. In addition, the content of hydroxyproline, the main component of collagen tissue, in the AAV8-Mettl3 group was also significantly lower than that in the AAV8-Mock group ( Figure 3 B). Protein levels also showed that the expression of fibrosis markers α-SMA, COL1A1, and PDGFRβ in AAV8-Mettl3 group was lower than that in AAV8-Mock group ( Figure 3 C), indicating that high expression of Mettl3 in liver tissue can significantly reduce the progression of liver fibrosis.

[0065] like Figure 4 As shown in the figure, in mice with CCl4-induced liver fibrosis, the liver lobule structure was destroyed, the boundaries between the liver lobules became obvious, there was a large amount of proliferative fibrous connective tissue in the portal area, and collagen fibers proliferated, while the liver lobule structure of the group with high expression of Mettl3 in vivo was relatively complete. Sirius red staining and Masson staining showed that collagen deposition in the AAV8-Mettl3 group was significantly reduced ( Figure 4 A). The immunohistochemical results showed that the AAV8-Mettl3 group significantly reduced the expression of α-SMA and COL1A1, indicating that high expression of Mettl3 in vivo can significantly inhibit the progression of liver fibrosis ( Figure 4 B).

[0066] From the above experiments, it can be seen that the expression level of Mettl3 in liver tissue is negatively correlated with the progression of liver fibrosis, that is, the expression of Mettl3 has an inhibitory effect on the course of liver fibrosis.

[0067] Example 3. Inhibitory effect of Mettl3 activator MA3 on induced liver fibrosis

[0068] (1) Experimental methods:

[0069] C57 WT mice with induced liver fibrosis were treated with Mettl3 activator as follows:

[0070] 8-week-old C57BL / 6J mice with matching body weight were randomly selected to set up a control group (intraperitoneal injection of CCl4) and experimental group 1 (intraperitoneal injection of CCl4 and MA1), experimental group 2 (intraperitoneal injection of CCl4 and MA2), and experimental group 3 (intraperitoneal injection of CCl4 and MA3). Each group had 10 mice (n=10) (the structures of compounds MA1, MA2, and MA3 are shown in Table 1). Figure 5 A). To establish a mouse liver fibrosis model, mice in the control group were intraperitoneally injected with 0.5 μL / g of mouse body weight of CCl4, twice a week, for a total of 9 doses, reaching the experimental endpoint. The experimental group was administered in the same way, and the compound was intraperitoneally injected at the same time as CCl4 administration. The dosage was 100 mg / kg (prepared with PBS as a 10 mg / ml solution, easily soluble, and the volume of intraperitoneal administration to mice was 100 μL / 10 g. After 30 days of administration, the required amount of drug was about 1 g. The administration method of drug administration while modeling was adopted, with the same frequency of CCl4 administration. After CCl4 administration, the compound was immediately intraperitoneally injected (the effect of the compound on CCl4-induced mouse liver fibrosis is shown in the steps below). Figure 5 B). After reaching the end point of the experiment, the weight of each mouse and the tail vein blood were weighed and recorded. The mouse blood was collected into a 1.5 ml centrifuge tube. After standing at room temperature for 30 minutes, the upper mouse serum was collected by gradient centrifugation at 3,000 rpm for 30 minutes and stored at -80°C. The serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) and other indicators were detected by an automatic biochemical analyzer to reflect whether the liver function was abnormal. The mouse liver tissue was obtained by dissection and divided into three parts. One part of the liver tissue was used to extract RNA from the liver tissue, one part was used to extract protein from the liver tissue, and the other part was fixed in a 4% paraformaldehyde solution for subsequent pathological experiments. The specific operation method was the same as Example 2.

[0071] (2) Experimental results:

[0072] like Figure 6 As shown in Table 6, the levels of ALT and AST in the serum of the experimental group 3 (intraperitoneal injection of CCl4 and MA3) were significantly lower than those of the control group and experimental groups 1 and 2, indicating that compound MA3 has the ability to inhibit the degree of liver damage in the process of liver fibrosis, and its effect is significantly better than other small molecule compounds with Mettl3 activation effect.

[0073] Table 6 ALT and AST levels in the control group and experimental groups 1 to 3

[0074]

[0075] like Figure 7 , 8 As shown, the liver tissue surface of experimental group 3 was smoother than that of the control group ( Figure 7 A), although there was no significant difference in the ratio of liver weight to body weight, the expression of Mettl3 in the liver tissue of experimental group 3 increased under the action of MA3 ( Figure 7 B). Pathological analysis showed that the liver lobule structure of experimental group 3 was intact, and Sirius red staining and Masson staining also showed that the collagen deposition in experimental group 3 was significantly lower than that in the control group ( Figure 8 ).

[0076] It can be seen that methyl 2-piperazinecarboxylate dihydrochloride, as a drug intermediate, has Mettl3 activator activity, can promote the expression of Mettl3, and delay the development of liver fibrosis. It can be used to develop drugs for the prevention and treatment of liver fibrosis.

[0077] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of methyl 2-piperazinecarboxylate dihydrochloride in the preparation of a drug for improving or treating liver fibrosis, characterized in that: The 2-piperazinecarboxylic acid methyl ester dihydrochloride inhibits liver fibrosis by activating Mettl3.

2. The use of methyl 2-piperazinecarboxylate dihydrochloride according to claim 1 in the preparation of a drug for improving or treating liver fibrosis, characterized in that: The administration route of the 2-piperazinecarboxylic acid methyl ester dihydrochloride is intraperitoneal injection.

Images