A method for preparing low-phosphorus-tolerant rice based on tissue-specific gene editing technology

Abstract

The present invention discloses a method for preparing low-phosphorus-tolerant rice based on tissue-specific gene editing technology. Based on tissue-specific gene knockout technology, negative regulatory genes for rice phosphorus absorption and utilization are specifically knocked out in rice vascular tissue to prepare low-phosphorus-tolerant and high-yield rice materials. The present invention uses the CRISPR / Cas9 system as a framework, and uses the vascular tissue-specific gene promoters OsPHO1;2p and OsSHR1p sequences in rice to replace traditional constitutive promoter sequences such as 35s promoters and ubi promoters to construct a new type of tissue-specific rice somatic gene editing vector. Two groups of different target genes are selected to construct a set of transgenic rice materials in which negative regulatory genes for phosphorus absorption are specifically knocked out in vascular cells. The yield of the material is significantly increased compared with the wild type under low-phosphorus soil culture conditions, with an average increase of 78%, and the system can be stably inherited, and the phenotype is stable between different generations.

Description

Technical Field

[0001] The present invention belongs to the technical field of rice tissue-specific gene editing, and in particular relates to a method for preparing low-phosphorus-tolerant rice based on tissue-specific gene editing technology. Background Art

[0002] Phosphorus is an important nutrient for rice growth and yield. In order to meet the growing demand for food, the use of phosphorus fertilizers has increased year by year. However, phosphorus is easily fixed in the soil, resulting in a low utilization rate of phosphorus fertilizers. The large-scale application of phosphorus fertilizers not only causes the depletion of non-renewable resources such as phosphate rock, but also causes environmental problems such as eutrophication. Cultivating rice varieties that efficiently absorb and utilize phosphorus will help the country's sustainable agricultural development and the achievement of the "dual carbon" goals.

[0003] The main technology for improving rice tolerance to low phosphorus is to overexpress rice phosphorus absorption and transport-related positive regulatory genes throughout the plant to achieve the goal of efficient phosphorus absorption and utilization in rice. For example, a strong promoter is used to overexpress the phosphorus deficiency response signal center transcription factor OsPHR3, the phosphorus efflux transporter OsPHO1;2, or the high-affinity transporter upper membrane auxiliary protein OsPHF1 in rice to improve the efficiency of rice phosphorus absorption and utilization. There are also studies on knocking out negative regulatory genes for phosphorus absorption and transport in rice, but related reports show that growth inhibition phenotypes appear after constitutive knockout of negative regulatory genes.

[0004] The existing gene editing technologies mainly include ZFN, TALENs, CRISPR / Cas9 and base replacement technology derived from CRISPR / Cas9. None of the existing rice gene editing technologies have the function of finely editing the genome at the tissue level. Only at the transcriptional level, there are reports of expressing RNAi systems in specific tissues to knock down the expression of target genes. In summary, the existing technologies have the following disadvantages: 1) The strong promoter used for whole-plant expression drives the rice phosphorus signal and absorption and transport positive regulatory genes, and cannot perform tissue-specific fine regulation; 2) Overexpression of rice phosphorus signal and absorption and transport positive regulatory genes or complete knockout of negative regulatory genes can easily cause excessive phosphorus absorption and transport in rice, which in turn breaks the phosphorus homeostasis in rice, which is not conducive to rice growth and yield.

[0005] Higher plants have highly differentiated tissue types, and different tissue types undertake different physiological functions. Rice has a well-developed vascular tissue that is responsible for the absorption, transportation and distribution of nutrients. At the same time, rice vascular tissue does not undertake important energy synthesis and metabolic activities such as photosynthesis. Specific editing of important genes in vascular tissue can promote plant nutrient absorption and distribution without affecting metabolic balance. Summary of the invention

[0006] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0007] As one aspect of the present invention, the present invention provides a method for preparing low-phosphorus-tolerant rice based on tissue-specific gene editing technology, which adopts CRISPR / Cas9 gene editing technology to specifically knock out one of the negative regulatory genes OsPHO2 or OsSPX1 / 2 (i.e., knock out OsSPX1 and OsSPX2 at the same time) of phosphorus absorption and utilization in rice vascular tissue.

[0008] As a preferred embodiment of the method for preparing low-phosphorus-tolerant rice based on tissue-specific gene editing technology described in the present invention: the CRISPR / Cas9 gene editing technology uses the pYLCRISPR / ubi-Cas13-eGFP multi-target vector constructed in the laboratory as the skeleton, and uses the promoter OsPHO1;2p from the rice gene OsPHO1;2 or the promoter OsSHR1p from the rice gene OsSHR7 as the tissue-specific promoter to prepare the gene editing vector.

[0009] As a preferred embodiment of the method for preparing low-phosphorus-tolerant rice based on tissue-specific gene editing technology described in the present invention, it also includes fusing the eGFP protein to the C-terminus of Cas9.

[0010] As a preferred scheme of the method for preparing low-phosphorus-tolerant rice based on tissue-specific gene editing technology described in the present invention: the OsU3 promoter expresses the t1gRNA target sequence ccaagctggacaagatgttc and the OsU6a promoter expresses the t2gRNA target sequence aacccaaatttgtatgagtc of the targeted gene OsPHO2.

[0011] As a preferred scheme of the method for preparing low-phosphorus-tolerant rice based on tissue-specific gene editing technology described in the present invention: the target of the targeted gene OsSPX1 is expressed by the OsU3 promoter with the t1 gRNA target sequence ggacaagttcttgtcgtaca, and the OsU6a promoter with the t2 gRNA target sequence ccgcatgaagcccgcctcct.

[0012] The target of the targeted gene OsSPX2 is expressed by the OsU6c promoter with the t1 gRNA target sequence cgagcaagcggcgtcgcgt and the OsU6b promoter with the t2 gRNA target sequence gaggtgatgcgcgtgagga.

[0013] As a preferred embodiment of the method for preparing low-phosphorus-tolerant rice based on tissue-specific gene editing technology described in the present invention: the Ubi promoter in the pYLCRISPR / ubi-Cas13-eGFP multi-target vector (obtained in the laboratory by transformation of the pYLCRISPR / Cas9Pubi-H vector) is replaced by the promoter OsPHO1;2p from the rice gene OsPHO1;2 or the promoter OsSHR1p from the rice gene OsSHR7 through BamHI and Spel enzyme digestion and homologous recombination, wherein the sequence of the promoter OsPHO1;2p is shown in SEQ ID NO: 1, and the sequence of the promoter OsSHR1p is shown in SEQ ID NO: 2.

[0014] As a preferred embodiment of the method for preparing low-phosphorus-tolerant rice based on tissue-specific gene editing technology described in the present invention: the gene sequence of Cas9 is shown in SEQ ID NO: 3.

[0015] As a preferred embodiment of the method for preparing low-phosphorus-tolerant rice based on tissue-specific gene editing technology described in the present invention: the gene editing vector is one of OsPHO1, 2p: Cas9-eGFP; Ospho2, OsPHO1, 2p: Cas9-eGFP; Osspx1 / 2, OsSHR1p: Cas9-eGFP; Ospho2 or OsSHR1p: Cas9-eGFP; Osspx1 / 2.

[0016] As a preferred embodiment of the method for preparing low-phosphorus-tolerant rice based on tissue-specific gene editing technology described in the present invention: the gene sequence of eGFP is shown in SEQ ID NO: 4.

[0017] Beneficial effects of the present invention: The present invention achieves tissue-specific gene knockout in rice, overcoming the deficiency that existing gene editing technology for rice cannot knock out specific genes in specific tissues or cell types. The tissue-specific gene editing material in the present invention, with a combination of two vascular tissue-specific promoters and two groups of targeted genes, increases the number of effective tillers and yield of rice under phosphorus-deficient soil conditions. The present invention overcomes the problem of imbalance of phosphorus homeostasis in rice caused by knocking out negative regulatory factors for phosphorus absorption and utilization throughout the plant, which affects the normal physiological activities of the plant and thus inhibits yield, and effectively provides a new solution for increasing rice yield under low phosphorus conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0019] Figure 1 This is the OsPHO1, 2p: Cas9-eGFP; Ospho2 vector map.

[0020] Figure 2 This is the OsPHO1, 2p: Cas9-eGFP; Osspx1 / 2 vector map.

[0021] Figure 3 This is the OsSHR1p:Cas9-eGFP;Ospho2 vector map.

[0022] Figure 4 This is the OsSHR1p:Cas9-eGFP;Osspx1 / 2 vector map.

[0023] Figure 5 This is the map of the pYLCRISPR / ubi-Cas13-eGFP vector.

[0024] Figure 6 This is the map of the pYLCRISPR / ubi-Cas9-eGFP intermediate vector.

[0025] Figure 7 Identification of positive strains of tissue-specific gene knockout materials.

[0026] Figure 8 Single sample analysis for tissue-specific knockout material.

[0027] Fig. 9 Analysis of target mutation rate of OsPHO2 gene knockout materials.

[0028] Fig.10 Yield of tissue-specific gene knockout material under low-phosphate conditions.

[0029] Fig.11 Schematic diagram of the construction of tissue-specific gene editing vector. DETAILED DESCRIPTION

[0030] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with specific embodiments.

[0031] Embodiment 1:

[0032] Design and construction of tissue-specific gene editing vectors:

[0033] The function of tissue-specific gene editing in the present invention is mainly composed of three key parts in the vector. The first is to screen promoters for tissue-specific expression. The promoter needs to have a stable expression level and a very specific tissue localization, so that it can have the expression strength of the gene editing system without causing erroneous editing between tissue types. The second is to select suitable targeted genes and gene target sequences that are efficient and not easy to off-target. And, a Cas9 protein with a fluorescent tag eGFP that can be observed for distribution and positioning. At the same time, the vector also has the basic characteristics of the original vector skeleton and has a hygromycin resistance gene for screening transgenic materials.

[0034] The present invention uses two tissue-specific gene promoters as tissue-specific promoters, namely OsPHO1;2 and OsSHR1 from rice genes. Both genes have been reported in published papers and have been verified by our experiments. They have very specific tissue expression patterns and are expressed in rice vascular tissues. We write the upstream promoters of these two genes as OsPHO1;2p and OsSHR1p. In order to detect the tissue localization and subcellular localization of Cas9 protein expression, we fused eGFP protein to the C-terminus of Cas9 to facilitate the observation of Cas9 protein expression and subcellular localization under a fluorescence microscope. At the same time, the present invention screened two groups of negative regulatory genes for phosphorus absorption and utilization as target genes, namely OsPHO2 (LOC_Os05g48390) and two homologous genes OsSPX1 (LOC_Os06g40120) and OsSPX2 (LOC_Os02g10780). In order to improve the efficiency of gene editing, both groups of genes were designed as dual targets, where the dual targets of the gene OsPHO2 were expressed by the OsU3 promoter for ospho2-t1 and the OsU6a promoter for ospho2-t2. The four targets of OsSPX1 / 2 were expressed by the OsU3 promoter for osspx1-t1, the OsU6a promoter for osspx1-t2, the OsU6c promoter for osspx2-t1, and the OsU6b promoter for osspx2-t2. Four vectors are composed of two promoters and two groups of targeted genes: 1) OsPHO1, 2p: Cas9-eGFP; Ospho2, 2) OsPHO1, 2p: Cas9-eGFP; Osspx1 / 2, 3) OsSHR1p: Cas9-eGFP; Ospho2, 4) OsSHR1p: Cas9-eGFP; Osspx1 / 2. Figure 1-Figure 4 .

[0035] The present invention uses laboratory pYLCRISPR / ubi-Cas13-eGFP ( Figure 5 ) The multi-target vector is used as the backbone. Based on the pYLCRISPR / ubi-Cas13-eGFP vector, the vector is double-digested with Pad and 5pel to remove the Cas13 fragment as the pYLCRISPR / ubi-eGFP vector backbone. The enzyme digestion system is as follows:

[0036] Reagents Volume 50 μl 10x FastDigest Green Buffer 5μl pYLCRISPR / ubi-Cas13-eGFP vector 3μg Pad / Spel 0.5 μl each <![CDATA[ddH2O]]> Add to 50 μl

[0037] The digested products were recovered by agarose gel electrophoresis (Novozyme Product Purification Kit DC301-01).

[0038] Using the pYLCRISPR / Cas9Pubi-H vector plasmid as a template, amplification was performed using primers Cas9-f and Cas9-nostop-r. The PCR system is as follows:

[0039] Reagents Volume 50 μl 10x KOD buffer 25μl 2mM dNTP 10μl KOD fx 1μl 10 μM upstream and downstream primers 1μl each pYLCRISPR / Cas9Pubi-H vector plasmid 1ul <![CDATA[ddH2O]]> Add to 50 μl

[0040] The digested product was recovered by agarose gel electrophoresis (Novozyme Product Purification Kit DC301-01). The recovered product was double digested with Pac1 and 5pel, and the digestion system was as follows:

[0041] Reagents Volume 20 μl 10x FastDigest Green Buffer 2μl Cas9 PCR amplification fragment 10 μg Pad / Spel 0.5 μl each <![CDATA[ddH2O]]> Add to 20 μl

[0042] The digested product was purified by a kit to remove impurities (Novozyme Product Purification Kit DC301-01). The purified fragment was connected to the vector fragment using t4 ligase. The connection system is as follows

[0043]

[0044] The ligation product was transformed into E. coli DH5α competent cells, and single clones were selected for PCR. After culture, the vector plasmid was extracted for restriction enzyme verification and sequencing, and the strain was preserved. The intermediate vector was named pYLCRISPR / ubi-Cas9-eGFP ( Figure 6 ). The ubi promoter in the pYLCRISPR / ubi-Cas9-eGFP vector was removed by BamHI and Spel enzymes. The enzyme cutting system is as follows

[0045] Reagents Volume 50 μl 10x FastDigest Green Buffer 5μl Ubi:Cas9-eGFP vector 3μg BamHI / Spel 0.5 μl each <![CDATA[ddH2O]]> Add to 50 μl

[0046] The digested products were purified by agarose gel electrophoresis and recovered (Novagen Product Purification Kit DC301-01).

[0047] Using DNA extracted by TPS method as template, specific primers were used to amplify the upstream promoter region sequences of OsPHO1;2 and OsSHR7.

[0048] PCR amplification system:

[0049] Reagents Volume 50 μl 10x KOD buffer 25μl 2mM dNTP 10μl KOD fx 1μl 10 μM upstream and downstream primers 1μl each DNA template 2μl <![CDATA[ddH2O]]> Add to 50 μl

[0050] The amplified product was recovered by agarose gel electrophoresis (Novozyme product purification kit DC301-01). Then, the purified OsSHR1p and OsPHP1.2p fragments were connected to the vector backbone by homologous recombination to complete the replacement of the promoter. The homologous recombination system is as follows

[0051]

[0052]

[0053] React at 50℃ for 30min.

[0054] The ligation product was transformed into competent E. coli DH5α, and single clones were selected for PCR. After culture, the vector plasmid was extracted for restriction enzyme verification and sequencing, and the strain was preserved. The CAS9-eGFP vector with OsPHO1;2p or OsSHR1p promoter was linearized with SgsI. The restriction enzyme system is as follows

[0055]

[0056] The constitutive gene editing vector strains pYLCRISPR / Pubi-Cas9;ospho2 and pYLCRISPR / Pubi-Cas9;osspx1 / 2 with OsPHO2 and OsSPX1 / 2 target elements in the laboratory were cultured, and the plasmids were extracted and digested with Sgsl to obtain the target element fragments. The digests are as follows

[0057]

[0058] The amplified product was confirmed to be correct by agarose gel electrophoresis and then excised and recovered (Novagen Product Purification Kit DC301-01).

[0059] The OsPHO2 and OsSPX1 / 2 target element fragments and the digested Cas9-eGFP vector were ligated using T4 ligase. The ligation system is as follows

[0060] Reagents Volume 10 μl 10x Ligase Buffer 1μl Ospho2 and Osppx1 / 2 targeting element fragments 0.3pmol CAS9-eGFP vector 0.02pmol T4 DNA ligase 1μl <![CDATA[ddH2O]]> Add to 10 μl

[0061] The ligation products were transformed into competent E. coli DH5α, and single clones were selected for PCR. After culture, the vector plasmids were extracted for restriction enzyme verification and sequencing, and four vectors, OsPHO1, 2p: Cas9-eGFP; Ospho2, OsPHO1, 2p: Cas9-eGFP; Osspx1 / 2, OsSHR1p: Cas9-eGFP; Ospho2, OsSHR1p: Cas9-eGFP; Osspx1 / 2, were obtained. Fig.11 As shown in the figure, a binary vector with a tissue-specific promoter expressing Cas9-eGFP fusion protein and promoters such as OsU3 and OsU6a expressing sgRNA was constructed. The sequence fragments of the constitutive gene knockout vector containing the OsU6a promoter, target sequence and sgRNA backbone are from a conventional CRISPR / gRNA vector. The constructed vector was transformed into Escherichia coli, and positive clones were selected and identified by colony PCR. After the plasmid was extracted from the positive colony, the vector was verified by enzyme digestion, and the constructed vector plasmid was finally verified by sequencing. The materials with correct sequencing were further subjected to rice transgenic operation according to conventional methods.

[0062] OsPHO1;2p promoter sequence (SEQ ID NO: 1)

[0063]

[0064]

[0065] OsSHR1p promoter sequence (SEQ ID NO: 2)

[0066]

[0067]

[0068] Cas9 gene sequence (SEQ ID NO:3)

[0069]

[0070]

[0071] eGFP sequence (SEQ ID NO:4)

[0072]

[0073] Vector construction primers:

[0074] Cas9-f

[0075] gcgactagtatgcagcagctatatgtggatttCas9-nostop-r

[0076] gcgttaattaacttctttttcttagcctgtccggc

[0077] Promoter amplification primers:

[0078] OsPHO1;2p-infution-f

[0079] Cagcgtgacccggtcgtgcccctctcgtcatccgtatttgagtcggttt

[0080] OsPHO1;2p-infution-r

[0081] taagctaagctaagctttgcctccctagtatgcagcagctatatgtgg

[0082] OsSHR1p-infution-f

[0083] cagcgtgacccggtcgtgcccctctgcatgcctgcaggtcgacacacga

[0084] OsSHR1p-infution-r

[0085] ctcctcctcgtcgccgttgcttagctagtatgcagcagctatatgtgg

[0086] Target gene target sequence:

[0087] ospho2target1-ccaagctggacaagatgttc

[0088] ospho2target2-aacccaaatttgtatgagtc

[0089] osspx1target1-ggacaagttcttgtcgtaca

[0090] osspx1target2-ccgcatgaagcccgcctcct

[0091] osspx2target1-cgagcaagcggcgtcgcgt

[0092] osspx2target2-gaggtgatgcgcgtgagga

[0093] Hitom target sequencing primers:

[0094] pho2 - t1 - hitom - f ggagtgagtacggtgtgcagggctcggaaagatggatc

[0095] pho2 - t1 - hitom - r gagttggatgctggatggtcaactccaactacacggcc

[0096] pho2 - t2 - hitom - f ggagtgagtacggtgtgctccagattttcttgctgctg

[0097] pho2 - t2 - hitom - r gagttggatgctggatggttttcagggtcccacacttc

[0098] spx1 - t1 - hitom - f ggagtgagtacggtgtgcgaagtttgggaagagcctga

[0099] spx1 - t1 - hitom - r gagttggatgctggatggcttcgcctgcctctcctc

[0100] spx1 - t2 - hitom - f ggagtgagtacggtgtgcgaggagaggcaggcgaag

[0101] spx1 - t2 - hitom - r gagttggatgctggatggacaaatggcgatcgatcacc

[0102] spx2 - t1 - hitom - f ggagtgagtacggtgtgccgcgacaacttcctctccta

[0103] spx2 - t1 - hitom - r gagttggatgctggatggtgatgacgtactcctcctcc

[0104] spx2 - t2 - hitom - f ggagtgagtacggtgtgcttcgtcgctgttcctgattg

[0105] spx2 - t2 - hitom - r gagttggatgctggatggaaaattcagagtgtgggcgg

[0106] Example 2:

[0107] Identification and effect of transgenic materials: Use forward primers located in the tissue-specific region and reverse primers located in the Cas9 sequence for PCR amplification. Compare the PCR amplification results with the negative control and select positive transgenic lines (such as Figure 7 ). The present invention utilizes the second-generation sequencing technology to specifically amplify the target gene fragments, and verifies the reliability and success rate of the tissue-specific gene editing of the present invention through the gene mutation rate and mutation type distribution of the target position at a high sequencing depth. Specifically, firstly, samples containing tissue-specific promoter expression regions, roots, nodes and leaves are selected, and the genomes of the corresponding three tissue parts of rice are extracted by the CTAB method. After obtaining a high-quality rice genome, target sequence primers with sequencing adapters are used to amplify the gRNA target before and after, and amplify a DNA fragment of 120-150bp in size. The sequencing data was obtained by the Hi-TOM platform based on the second-generation sequencing technology. And analyzed with CRISPResso2. After analysis, Hi-TOM sequencing can intuitively display the mutation type and proportion, such as Figure 8 This method can be used to batch test the gene editing effect, such as Fig. 9 As shown, in the transgenic rice materials carrying OsPHO1, 2p: Cas9-eGFP; Ospho2 and OsSHR1p: Cas9-eGFP; Ospho2 vectors, a high proportion of gene mutation rates were detected at the t1 target site of Ospho2, proving that tissue-specific gene knockout materials can efficiently complete gene editing within tissues.

[0108] Embodiment 3:

[0109] Phenotype of tissue-specific gene-edited materials: The vascular tissue-specific gene-knockout rice materials of the present invention have been verified by field experiments to increase yield by 78% compared with the wild type under low-phosphorus growth conditions (see Fig.10). The experimental data came from the Changxing Agricultural Experiment Station of Zhejiang University in Changxing County, Huzhou City, Zhejiang Province. A total of 16 strains transformed with NIP and four vectors were selected for T1 and T2 generation seeds, namely: OsPHO1, 2p: Cas9-eGFP; Ospho2 (pop#5, 11, 12, 5-T2, 12-t2); OsPHO1, 2p: Cas9-eGFP; Osspx1 / 2 (pos#5, 6, 10); OsSHR1p: Cas9-eGFP; Ospho2 (sp#1, 2, 16, 1-T2, 2-T2); OsSHR1p: Cas9-eGFP; Osspx1 / 2 (ss#2, 3, 7). The above materials were planted in the low-phosphorus field in the phosphorus gradient field of the Changxing Experiment Station of Zhejiang University. After the material matured and was harvested, individual plants were tested, and yield traits such as individual plant yield and thousand-grain weight were counted, and data analysis was performed using Prism 9 software. The data showed that the thousand-grain weight of seeds of tissue-specific gene knockout materials was not significantly different from that of the wild type. Compared with the wild type, the individual plant yield increased significantly, and it increased in different transgenic materials and in different strains of the same transgenic material. The T1 and T2 generation strains of the same transgenic material showed consistent yield increase phenotypes, proving that the transgenic system can be stably inherited in the T1 and T2 generations, and the phenotype is stable.

[0110] In summary, the present invention provides a novel gene editing method that can be used for crop improvement. Due to the interchangeability of the targets of the CRISPR / Cas9 system, it can be more widely used in different crop improvement fields according to the selection of different targeted genes, thereby achieving different functions.

[0111] The new low-phosphorus and high-efficiency rice solution of the present invention uses tissue-specific gene editing technology to specifically knock out the negative regulatory genes of rice phosphorus absorption and utilization in rice somatic cells, thereby promoting the low-phosphorus tolerance of rice under low-phosphorus growth conditions and promoting the yield of rice under low-phosphorus growth conditions.

[0112] The screened and verified promoters OsPHO1;2p, OsSHR1p and the targeted genes OsPHO2 and OsSPX1 / 2. The vectors in the present invention have been verified by genome and physiological phenotypes, can effectively play the function of specific gene knockout, and bring about advantageous phenotypes that are beneficial to growth. The vectors and materials have great potential for application in agricultural production.

[0113] The tissue-specific gene knockout detection scheme based on the second-generation sequencing platform Hi-TOM in the present invention detects the occurrence of gene mutations and differences in tissue locations by extracting genomes from different tissue locations, thereby distinguishing and identifying constitutive gene knockout materials and tissue-specific gene knockout materials.

[0114] Explanation of terms and terms involved in the present invention:

[0115] 1. CRISPR / Cas9 CRISPR / Cas9 is a commonly used gene editing technology that can be used in rice gene editing research. It is an RNA-guided gene editing technology that can edit the genome efficiently and accurately. The CRISPR / Cas9 system consists of two parts: one is CRISPR RNA (crRNA), which is a small RNA molecule that has the ability to specifically recognize the target DNA sequence; the other is Cas9 protein, which is an endonuclease that can produce double-strand breaks in the target DNA sequence, leading to gene knockout, insertion or replacement. The CRISPR / Cas9 system has the advantages of high efficiency, simplicity and low cost.

[0116] 2. Negative regulatory genes Negative regulatory genes refer to a type of gene that can inhibit the expression of target genes in organisms. They can usually bind to certain regulatory proteins to inhibit gene expression.

[0117] 3. Low-phosphorus tolerance refers to the ability of plants to absorb and utilize phosphorus more efficiently when phosphorus is deficient. For crops such as rice that require a large amount of phosphorus, improving low-phosphorus tolerance can increase their yield and nutritional value.

[0118] 4. Promoter: As used herein, the term "promoter" refers to a DNA region that can be upstream of the start of transcription and can participate in the recognition and binding of RNA polymerase and other proteins to initiate transcription. The promoter can be operably linked to a coding sequence expressed in a cell, or the promoter can be operably linked to a nucleotide sequence encoding a signal sequence, which can be operably linked to a coding sequence expressed in a cell.

[0119] 5. Constitutive promoters. A promoter that is active in most tissue locations and conditions, including but not limited to: promoters from plant viruses, such as the 35S promoter from CaMV; promoters from the rice actin gene; ubiquitin promoters; pEMU; MAS; maize H3 histone promoter; and ALS promoter, the Xba1 / Ncol fragment of the ALS3 structural gene 5 of Brassica napus (or a nucleotide sequence analogue of the Xba1 / Ncol fragment).

[0120] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A method for preparing low-phosphorus tolerant rice based on tissue-specific gene editing technology, characterized in that: Using CRISPR / Cas9 gene editing technology, we specifically knocked out OsPHO2 or OsSPX1 / 2, the negative regulatory genes for phosphorus absorption and utilization in rice vascular tissues; The CRISPR / Cas9 gene editing technology is to use the pYLCRISPR / ubi-Cas13-eGFP multi-target vector as a skeleton, replace the Cas13 fragment with the Cas9 protein fragment, and use the promoter OsPHO1;2p from the rice gene OsPHO1;2 or the promoter OsSHR1p from the rice gene OsSHR1 as a vascular tissue-specific promoter to prepare a gene editing vector; It also includes an eGFP tag at the C-terminus of Cas9; The two gRNAs targeting the gene OsPHO2 were gRNA Ospho2-t1 expressed from the OsU3 promoter with a target sequence of ccaagctggacaagatgttc and gRNA Ospho2-t2 expressed from the OsU6a promoter with a target sequence of aacccaaatttgtatgagtc; The two gRNAs targeting the gene OsSPX1 are gRNA Osspx1-t1 expressed by the OsU3 promoter, with a target sequence of ggacaagttcttgtcgtaca and gRNA Osspx1-t2 expressed by the OsU6a promoter, with a target sequence of ccgcatgaagcccgcctcct; the two gRNAs targeting the gene OsSPX2 are gRNA Osspx2-t1 expressed by the OsU6c promoter, with a target sequence of cgagcaagcggcgtcgcgt and gRNA Osspx2-t2 expressed by the OsU6b promoter, with a target sequence of gaggtgatgcgcgtgagga; By means of BamHI and SpeI digestion and homologous recombination, the ubi promoter in the pYLCRISPR / ubi-Cas9-eGFP multi-target vector backbone was replaced with the promoter OsPHO1;2p from the rice gene OsPHO1;2 or the promoter OsSHR1p from the rice gene OsSHR1, wherein the sequence of the promoter OsPHO1;2p is shown in SEQ ID NO: 1, and the sequence of the promoter OsSHR1p is shown in SEQ ID NO: 2; The gene editing vector is one of OsPHO1;2p:Cas9-eGFP;Ospho2, OsPHO1,2p:Cas9-eGFP;Osspx1 / 2, OsSHR1p:Cas9-eGFP;Ospho2 or OsSHR1p:Cas9-eGFP;Osspx1 / 2; The gene sequence of Cas9 is shown in SEQ ID NO:

3.

2. The method for preparing low-phosphorus-tolerant rice based on tissue-specific gene editing technology according to claim 1, characterized in that: The gene sequence of eGFP is shown in SEQ ID NO:4.

Images