Knock-in mouse model of the novel mutation pathogenic site C104G of the Anxa11 gene and its construction method and application

Abstract

The present invention provides a knock-in mouse model of a new mutation pathogenic site C104G of the Anxa11 gene and a construction method thereof, the method comprising: obtaining an active sgRNA, the nucleotide sequence of the sgRNA is shown in SEQ ID NO.2; obtaining an active Cas9mRNA, the nucleotide sequence of the Cas9 is shown in SEQ ID NO.3; mixing the active sgRNA, Cas9mRNA and a targeting donor with a nucleotide sequence as shown in SEQ ID NO.1 and microinjecting them into mouse fertilized eggs to obtain F0 generation mice; selecting F0 generation positive mice to mate with wild-type mice to obtain F1 generation mice with stable genotypes; and then screening to obtain Anxa11 gene mutation knock-in model mice. The method has high gene editing efficiency.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, and in particular to a knock-in mouse model of a novel mutation pathogenic site C104G of an Anxa11 gene and a construction method thereof. Background Art

[0002] Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disease that causes weakness and atrophy of the limbs, leading to death and disability. As the disease progresses, damage to the upper and lower motor neurons will occur, eventually affecting the respiratory muscles and causing respiratory failure. It is currently believed that ALS and frontotemporal dementia (FTD) have comorbid characteristics. Some ALS patients may also suffer from FTD. At the same time, some genes, such as the C9ORF72 gene mutation, can cause both ALS and FTD.

[0003] The pathogenic genes of amyotrophic lateral sclerosis include the common SOD1 and C9ORF72. Identifying ALS pathogenic genes and mutations is helpful to clarify the pathogenesis of the disease. ANXA11 gene is a newly discovered ALS-related pathogenic gene. ANXA11 gene mutations have been found in patients with ALS combined with FTD, suggesting that ANXA11 gene may be important in the pathogenesis of ALS-FTD (Zhang K, Liu Q, Liu K, Shen D, Tai H, Shu S, Ding Q, Fu H, Liu S, Wang Z, Li X, Liu M, Zhang X, Cui L. ANXA11 mutations prevail in Chinese ALS patients with and without cognitive dementia. Neurol Genet. 2018 May 22; 4(3): e237. doi: 10.1212 / NXG.0000000000000237.). Mutated pathogenic genes provide new targets for the precision treatment of ALS. It is necessary to develop a model for new mutated pathogenic genes to provide a mouse model for further mechanism research and target screening. Summary of the invention

[0004] The purpose of the present invention is to provide a knock-in mouse model of a new mutation pathogenic site c.C104G (hereinafter referred to as C104G) of the Anxa11 gene of amyotrophic lateral sclerosis and a construction method thereof. The method has high gene editing efficiency and provides a mouse model for further studying the mechanism and screening for targets.

[0005] In order to achieve the above object, the present invention adopts the following technical solution:

[0006] In a first aspect of the present invention, a method for constructing a knock-in mouse model of a novel mutation pathogenic site C104G of the Anxa11 gene is provided, the method comprising:

[0007] The sgRNA is transcribed into mRNA in vitro to obtain an active sgRNA, wherein the nucleotide sequence of the sgRNA is shown in SEQ ID NO.2;

[0008] Obtaining active Cas9 mRNA, wherein the Cas9 nucleotide sequence is shown in SEQ ID NO.3;

[0009] The active sgRNA, Cas9 mRNA and a targeting donor with a nucleotide sequence as shown in SEQ ID NO.1 are mixed and microinjected into mouse fertilized eggs to obtain F0 generation mice;

[0010] F0 generation positive mice from the genotype identification results of F0 generation mice were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes; then, gene-targeted mice with correct recombination were screened out to obtain Anxa11 gene knock-in model mice.

[0011] In the second aspect of the present invention, a targeting donor of Anxa11 gene knock-in mouse is provided, and the nucleotide target sequence of the targeting donor is shown as SEQ ID NO.1.

[0012] In the third aspect of the present invention, a set of nucleic acid molecules for constructing a mouse model of the Anxa11 gene C104G mutation is provided, the set of nucleic acid molecules comprising:

[0013] (a) a nucleotide sequence encoding sgRNA, as shown in SEQ ID NO.2;

[0014] (b) a nucleotide sequence encoding Cas9, as shown in SEQ ID NO.3;

[0015] (c) A targeting donor having a nucleotide sequence as shown in SEQ ID NO.1.

[0016] In the fourth aspect of the present invention, a knock-in mouse model of the novel mutation pathogenic site C104G of the Anxa11 gene obtained by the method is provided.

[0017] In the fifth aspect of the present invention, a knock-in mouse model of the novel mutation pathogenic site C104G of the Anxa11 gene is provided for use in preparing mutant Anxa11 protein or screening drugs.

[0018] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0019] The mouse model prepared by the present invention can improve the gene knock-in efficiency by nearly 20 times, and is fast and convenient, improves the success rate, saves costs, shortens the cycle, and is more conducive to industrialization and large-scale commercial applications. It was successfully expressed in the knock-in mouse model of the new mutation pathogenic site C104G of the Anxa11 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0021] Figure 1 The strategy diagram (A) and sequence diagram (B) of the Anxa11 gene C104G mutation knock-in mouse model provided by the present invention; the red part in Figure B is the location of the mutated nucleotide at position 104, and the gray background is the location of the produced synonymous mutation at position 108.

[0022] Figure 2 Schematic diagram of the F1 generation identification strategy;

[0023] Figure 3 The Sanger verification graph of the mouse tail DNA and the quantitative PCR verification graph of RNA level of the mutant mouse. Figure 3 A is a Sanger sequencing diagram confirming that heterozygous and homozygous mutant Anxa11 mice were successfully constructed; compared with the wild type, the mutant mice showed heterozygous overlapping peaks (C / G overlapping peaks) or homozygous mutations (G) at the C104 site (left arrow); at the same time, the nucleotide T was introduced to avoid secondary cleavage (right arrow). Figure 3 B is the result of quantitative PCR at the mRNA level, which confirms that the expression level of Anxa11 is normal. The synonymous mutation made did not introduce a splicing site and did not change the expression of Anxa11. + / R ), homozygous mice (Anxa11 R / R ).

[0024] Figure 4 The cytoplasmic ectopic location of Tdp-43 protein in the anterior horn motor neurons was observed in the spinal cord sections of mutant mice. Tdp-43 protein is normally located in the nucleus (see wild type), and the cytoplasmic translocation is a typical pathological manifestation of amyotrophic lateral sclerosis (mutant type). DETAILED DESCRIPTION

[0025] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0026] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0027] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained by existing methods.

[0028] Explanation of terms

[0029] Wild type allele (WT): wild type mice;

[0030] Targeted allele: positive mice obtained by injection of fertilized eggs, or F1 generation positive heterozygous mice obtained by mating F0 generation positive mice with wild-type mice.

[0031] In order to solve the above technical problems, the overall idea of ​​the technical solution of the present invention is as follows:

[0032] The inventors of the present application detected multiple ALS patients with ANXA11 gene mutations in ALS cohort gene screening. The patients showed typical upper and lower motor neuron damage, with or without frontotemporal dementia. Among them, the pathogenic mutations in the low-complex domain (LCD region) at the N-terminus of the gene-encoded protein caused a clinical phenotype that was different from the phenotype of other pathogenic gene mutations in ALS, such as the SOD1 gene. Patients with mutations in this region have a late onset and relatively slow progression, and can be used as a new ALS research model.

[0033] To this end, a mutation target was selected in the LCD region encoded by the mouse Anxa11 gene to study the mechanism of ALS caused by ANXA11 gene mutation. The applicant selected the c.C104 site to make a mutant mouse model, in which the 104th base mutated from C to G. The reasons for selecting this site are: 1. This site itself can constitute the PAM sequence of sgRNA, and after mutation, it can avoid secondary recognition and cutting of Cas 9 protein ( Figure 1 B). 2. This site is highly conserved among species and theoretically has strong pathogenicity. At the same time, in order to further avoid the problem of secondary cleavage, the inventors of the present application found that a second synonymous mutation (C108T) was made at the 108th nucleotide in the target doner sequence ( Figure 1B) It can prevent secondary cutting of the sequence after the gene editing has been completed.

[0034] In order to further study the mechanism of ANXA11 gene mutation leading to ALS and targeted screening and treatment, it is necessary to provide a mouse model. The design of the gene mutation knock-in mouse model is as follows:

[0035] Knock-in gene name (NCBI number): 11744;

[0036] Knock-in gene NCBI website link: https: / / www.ncbi.nlm.nih.gov / gene / 11744;

[0037] Transcript targeted by the protocol (Ensembl number): Anxa11-201 (ENSMUST00000022416.14)

[0038] KI fragment name and insertion position: The present invention made a C104G site-directed mutation in exon3 of the Anxa11-201 (ENSMUST00000022416.14) transcript, and the 104th base was mutated from C to G, and the corresponding 35th amino acid was mutated from P to R.

[0039] Using CRISPR / Cas9 technology, the target site is genetically modified through the principle of homologous recombination. The specific process is as follows: gRNA is designed and transcribed in vitro, and a homologous recombination (Donor) sequence is constructed at the same time. Cas9, gRNA, and Donor sequence are injected into the fertilized eggs of mice at the same time. Under the guidance of gRNA, Cas9 protein binds to the target site and causes a double-strand break in DNA. The Donor sequence repairs the broken double strand through homologous recombination, thereby achieving genetic modification of the target site.

[0040] The following is a detailed description of the method for constructing a mouse model of the Anxa11 gene C104G mutation knock-in in the present application in combination with the examples and experimental data.

[0041] Example 1: Construction of a knock-in mouse model of the novel mutation pathogenic site C104G of the Anxa11 gene

[0042] 1. Design, construction and purification of gRNA and DONER sequence vectors.

[0043] (1) gRNA design: Using the CRISPR Design tool of the Massachusetts Institute of Technology (http: / / crispr.mit.edu / ), a 20-bp oligonucleotide chain sequence targeting the target DNA was designed based on the score to prepare sgRNA. A donor sequence carrying the target site homology arm and the target knock-in sequence was designed based on the sgRNA sequence, and primers were designed in the target region for subsequent positive clone screening and mouse gene identification.

[0044] (2) Construction and purification:

[0045] The two synthesized single-stranded oligonucleotide sgRNA sequences were annealed (95°C for 5 minutes and then naturally cooled to room temperature) to form double-stranded DNA, which was linked to the pGK1.1 linear vector under the action of T4 DNA ligase to construct an sgRNA expression vector. The recombinant plasmid was transformed into DH5a competent cells. The positive clone plasmids were screened and identified through the kanamycin resistance of the pGK1.1 linear vector and the sequencing of the target DNA. The correct colony clone was selected, and the plasmid was extracted after amplification culture to prepare the in vitro transcription template;

[0046] The donor sequence was directly synthesized (Shanghai Sangon Biotechnology Co., Ltd., China), 2OD, and PAGE purified. The obtained donor was used for injection.

[0047] Table 1 - Sequences used to construct mouse models

[0048]

[0049] 2. Sample preparation and microinjection:

[0050] (1) Sample in vitro transcription: Cas9 expression plasmid (Addgene No. 44758) was linearized by AgeⅠ digestion, purified by phenol chloroform extraction, and dissolved in nuclease-free water as a template for in vitro transcription; Cas 9 mRNA was synthesized in vitro using T7 RNA polymerase according to the T7 Ultra Kit (Ambion, AM1345).

[0051] (2) Microinjection of Cas9 / sgRNA and donor: The transcribed Cas9 mRNA, sgRNA and purified donor fragment were mixed and the concentrations were adjusted to 20 ng / μl Cas9 mRNA, 10 ng / μl sgRNA and 50 ng / μl donor fragment. The mixture was microinjected into the pronucleus and cytoplasm of C57BL / 6 mouse fertilized eggs using a TE2000U microinjector. The fertilized eggs were then transplanted into the uterus of pseudopregnant C57BL / 6 female mice and the F0 generation of mice were awaited for birth.

[0052] 3. Preparation of F0 generation mice;

[0053] Cas9, the microinjection RNA of the sgRNA and the targeting vector were microinjected into mouse fertilized eggs, and mice born after the injection were recorded as the F0 generation.

[0054] 4. Genotype detection of F0 generation mice:

[0055] The present invention uses the method of injecting fertilized eggs with Cas9 / sgRNA to construct gene knock-in mice; 5-7 days after the birth of F0 generation mice, the mice are marked by clipping the toes, and the tail tissue is clipped to extract DNA by the phenol chloroform method, and the primers designed in the target area are used for identification, and the PCR-positive samples are selected for sequencing. Since the early embryonic cleavage rate is very fast, the obtained F0 generation mice are chimeras; therefore, the F0 genotype obtained by identifying the tail of the F0 generation mouse is only for reference, and it cannot represent that it must be a heritable gene mutation type. The heritable genotype needs to be determined after the tail of the F1 generation mouse is detected.

[0056] After fertilized egg microinjection and embryo transplantation, F0 mice were obtained. Through PCR and sequencing confirmation, the following homologous recombination positive F0 generation mice were obtained.

[0057] Table 2

[0058] ID gender color Phenotype Date of Birth Algebra 14 female B Positive 2019 / 4 / 30 F0 17 female B Positive 2019 / 4 / 30 F0 19 male B Positive 2019 / 4 / 30 F0 23 male B Positive 2019 / 4 / 30 F0

[0059] The tail genotype of the F0 generation mice was identified, and PCR products and sequencing showed that the above were positive F0 generation mice.

[0060] 5. Preparation of F1 mice;

[0061] The positive mice in the tail genotype identification results of F0 generation mice were selected and mated with C57BL / 6N wild-type mice to obtain F1 generation mice with stable genotypes.

[0062] 6. Identification of the genotype of F1 mice;

[0063] The F1 generation mice were identified according to the identification method of the F0 generation mice, and the obtained positive F1 generation heterozygous mice could be stably inherited. PCR primers are shown in Table 3. Sequencing primers are shown in Table 4.

[0064] Table 3

[0065]

[0066]

[0067] Table 4

[0068] Primer name Primer sequence (5'-3') Primer Description 00002090-Anxa11-W1-tF1 ggctttgagaggaacaaagcatg TM product sequencing

[0069] According to the PCR strategy diagram, PCR and sequencing confirmed that mice 34#---36# were positive F1 generation mice. The information of positive F1 generation mice is as follows:

[0070] Table 5

[0071] ID gender color Phenotype Date of Birth Algebra serial number 34 female B KI / wt 2019 / 4 / 30 F1 C57BL / 6J / 17# 35 female B KI / wt 2019 / 4 / 30 F1 C57BL / 6J / 17# 36 female B KI / wt 2019 / 4 / 30 F1 C57BL / 6J / 17#

[0072] The tail DNA of the F1 mice identified as positive by the above PCR was extracted for PCR detection and Sanger sequencing. The test results are as follows: Figure 3 As shown, the results showed that mice 34#---36# were correctly recombined and there was no random insertion, indicating that mice carrying the Anxa11 mutant were successfully constructed; at the same time, Tdp-43 protein was observed to be transferred to the cytoplasm in the anterior horn motor neurons of the spinal cord of the mutant mice (Islet1 positive labeled cells), while in wild-type mice, it was distributed in the nucleus ( Figure 4 ), which is a typical ALS pathological manifestation, indicating that the model was successfully constructed.

[0073] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

[0074] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0075] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0076] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A method for constructing a knock-in mouse model of the new mutation pathogenic site C104G of the Anxa11 gene, It is characterized in that The method comprises: The sgRNA having a nucleotide sequence as shown in SEQ ID NO.2 is transcribed into mRNA in vitro to obtain an active sgRNA; Obtain active Cas9 mRNA; The active sgRNA, Cas9 mRNA and a targeting donor with a nucleotide sequence as shown in SEQ ID NO.1 are mixed and microinjected into mouse fertilized eggs to obtain F0 generation mice; F0 generation positive mice from the genotype identification results of F0 generation mice were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes; then, gene-targeted mice with correct recombination were screened out to obtain Anxa11 gene knock-in model mice.

2. A method for constructing a knock-in mouse model of a novel mutation pathogenic site C104G of the Anxa11 gene according to claim 1, It is characterized in that The nucleotide sequence of the Cas9 is shown in SEQ ID NO.

3.

3. A method for constructing a knock-in mouse model of a novel mutation pathogenic site C104G of the Anxa11 gene according to claim 1, It is characterized in that The ratio of the concentrations of Cas9 mRNA, sgRNA and targeting donor is 2:1:(4-6).

4. Targeting donors of Anxa11 knock-in mice, It is characterized in that The nucleotide sequence of the targeting donor of the Anxa11 gene knock-in mouse is shown in SEQ ID NO.

1.

5. Use of a knock-in mouse model of the novel mutation pathogenic site C104G of the Anxa11 gene prepared by the method according to any one of claims 1 to 3 in preparing an overexpressed mutant Anxa11 protein or screening drugs.

6. Used to construct sgRNA for the new mutation pathogenic site C104G of Anxa11 gene, It is characterized in that The nucleotide sequence of the sgRNA is shown in SEQ ID NO.

2.

7. A set of nucleic acid molecules for constructing a knock-in mouse model of the new mutation pathogenic site C104G of the Anxa11 gene, It is characterized in that The set of nucleic acid molecules comprises: (a) a nucleotide sequence encoding sgRNA, as shown in SEQ ID NO.2; (b) a nucleotide sequence encoding Cas9, as shown in SEQ ID NO.3; (c) The targeting donor of the Anxa11 gene C104G mutation knock-in mouse whose nucleotide sequence is shown in SEQ ID NO.1.

Images