Application of a T1FR protein in inhibiting the pathogenicity of adherent and invasive Escherichia coli

Abstract

The present invention provides an application of TIFR protein for inhibiting the pathogenicity of adherent invasive Escherichia coli. The nucleotide sequence of the TIFR protein is shown in SEQ ID NO: 1. Studies have found that the TIFR protein can inhibit the T1FR protein of type I fimbriae of Escherichia coli, and can effectively inhibit the colonization and pathogenicity of adherent invasive Escherichia coli (AIEC) in the intestine of mice, proving that blocking the adhesion process of bacterial fimbriae to tissues and organs by biological factors can effectively reduce the pathogenicity of bacteria, and provides an important reference strategy for the scientific management of bacterial infectious diseases.

Description

[0001] The present invention relates to the application field of T1FR protein, and in particular to an application of T1FR protein in inhibiting the pathogenicity of adherent and invasive Escherichia coli. Background Art

[0002] Studies have found that adherent-invasive Escherichia coli (AIEC), as a type of Escherichia coli with special biological characteristics, can specifically adhere to and colonize intestinal epithelial cells and survive and replicate in macrophages. AIEC breaks through the mucus layer by binding to epithelial cell (IEC) adhesion molecule receptor 6 (CEACAM6) with its own type 1 pili, and the expression of CEACAM6 is significantly upregulated in the intestinal inflammatory sites of patients with Crohn's disease (CD). AIEC adhered to IEC promotes the release of inflammatory factors by activating the NF-kB pathway, thereby causing intestinal inflammation. More and more evidence shows that AIEC is involved in inducing the occurrence of intestinal inflammation in CD patients. After AIEC adheres to IEC, the polysaccharide matrix secreted by AIEC wraps the flora to form a biofilm, which has strong resistance to antibiotics and host immunity, creating a stable internal environment for AIEC to colonize persistently. In addition, the destruction of intestinal flora by broad-spectrum antibiotics in current clinical treatment has a promoting effect on the adhesion and colonization of AIEC, inducing the evolution of bacterial resistance and exacerbating the occurrence of intestinal inflammation.

[0003] Given that fimbriae are the key factor for AIEC to adhere to and colonize the intestinal epithelium, inhibiting the adhesion process mediated by AIEC fimbriae has become an effective means to prevent and treat AIEC-induced intestinal inflammation. Summary of the invention

[0004] The purpose of the present invention is to: in view of the problems existing in the prior art, the present invention provides a TIFR protein, which can inhibit the T1FR protein of type I pili of Escherichia coli, effectively inhibit the pathogenicity of AIEC to the mouse intestine, and provide a reference scheme for the clinical prevention and treatment of Crohn's disease.

[0005] In order to achieve the above object, the technical solution adopted by the present invention is:

[0006] A T1fr gene, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0007] The nucleotide sequence of the T1FR protein encoding gene T1fr is shown in SEQ ID NO: 1:

[0008] ATGGTAGGTTCGCGCTGGTATAAATTTGATTTTCATAACCATACTCCGGCTTCGCATGATTACAAAATTCCTGACATCAGCCCCAGAGAGTGGCTTCTGGCTTATATGAAACAGCATGTCGATTGTGTTGTAATCAGCGATCATAACAGCGGAGCCTGGGTCGACGTGTTGAAGGGTGAGCTGGAGAATATGTCCCGGGACGCCAGCACCGGCGACCTGCCGGAATTTCGGCCACTGACACTCTTTCCGGGGGTTGAACTGACAGCGACCGGTAACGTACATATTCTGGCTGTGC

[0009] TGCACACGCACAGTACAAGTGCCGATGTGGAAAGGCTTCTGGCCCAGTGCAATAATAAT

[0010] AGCCCCATTCCGAGTGAAGTCCCTAACCATCAGCTCGTTCTTCAACTGGGCCCCGCCGG

[0011] CATCATCAGTAATATCCGCCGTAATCCGAAGGCTGTTTGTATTCTTGCGCACATTGATGCA

[0012] GCCAAAGGTGTCTTAAGTCTGACTAATCAGGCAGAGCTCACCGCAGCCTTTCAGGAAA

[0013] GTCCCCATGCCGTTGAGATTCGACACCGGGTGGAGGATATCACCGACGGAACCCGCCGG

[0014] CGGCTGATTGATAATTTACCGTGGCTACGGGGCTCTGATGCGCACCATCCTGAACAAGCC

[0015] GGCATGCGAACCTGCTGGCTGAAAATGTCATCCCCTGATTTTGACGGACTCAGGCATGC

[0016] ACTGCTCGATCCGGAAAACTGTGTGCTGTTTGATCAGCTCCCTCCGGAGGAACCTGCGT

[0017] CATATTTGCGCAGCCTGAAATTCAGAACCCGCCACTGCCATCCTGTGGGTCAGGATTCGG

[0018] CCTCGGTGGAATTCAGCCCGTTCTATAACGCTGTAATCGGCTCAAGAGGCAGCGGGAAG

[0019] TCCACGCTCATTGAAAGCATTCGTCTTGCAATGCGCAAAACAGAAGGTCTCACTGCGAC

[0020] CCAGGGGAGTAAGCTGGACCAGTTCATTCGGACGGGGATGGAAGCGGATTCCTTCATCG

[0021] AATGTATTTTCCACAAAGAAGGCACAGATTTCCGGCTCAGTTGGCGACCAGACAGTAAG

[0022] CATGAATTACATATCTTCAGTGACGGAGAATGGATGCCTGACAGTCACTGGTCGGCTGAC

[0023] CGTTTTCCACTCTCGATTTACAGCCAGAAAATGCTCTATGAGCTGGCTTCGGATACTGGT

[0024] GCATTCCTGCGCGTCTGTGATGAGAGCCCGGTGGTTAACAAACGGGCCTGGAAAGAGC

[0025] GCTGGGATCAGCTGGAAAGGGAATATCTGAATGAACAAATCACGTTGCGGGGCCTGCGT

[0026] GCCAGACAGGGAAGTGCGGATTCGCTGCGGGGGGAATTATCGGATGCTGAACGTGCCG

[0027] TCAGTCAGCTGCAGTCAAGCGCCTATTATCCGGTTTGCAGACAGCTGGCCCTCGCCAGA

[0028] AACGAGCTGTCCGCAGCAACCTTACCCCTGGAGCACTTTGAGCGGCGTATTGCAGCCAT

[0029] TCAGGCTCTGGCAGAAGAACCGCTGCAGAGATCCGATATCCCGCCGGAACCTTCCGGTC

[0030] TGCTGATGGCATTTATGGCGCGCCTGTCATCTGTGCAACAGCAGTATGACCAGCGGCTCA

[0031] ATACTCTCCTGGCAGAATATGCTGCAGAGCTCGCGGGTATCAGGAGAGAGCAATCTTTTA

[0032] TTGCCCTCCGAACAGCAGTGAGTGACCAGGAAACAAATGTAGAAAGTGAAGCTGTTTC

[0033] CCTGCGGGCCAGAGGGCTTAATCCCGATGTTCTCAACGAACTGATGGCACGCTGTGAGT

[0034] CACTGAAAAATGAGCTGAGAAATTACGACGGTCTTGATGGGGCGATCTCTGCCTCTGTT

[0035] GCACGGTCTGAGCAGTTGCTGGCTGAAATGCGTGCCCACAGAATGGCATTGACAGATAA

[0036] CCGGAAGGCGTTTCTCTCCTCCCTGTCGCTCAGCGCTCTGGAAATCAAAATTCTTCCCCT

[0037] CTGCGCCCCTTATGAAGATGTTATATCTGGTTACCAGACGGTTACCGGCATCAGTAATTTT

[0038] GCCGAACGTATCTACGATAACAGTGACGGGAGCGGATTACTGAGCGACTTTATCAGTGA

[0039] ACGTCCGTTCAGCCCGTTGCCTGCCGCAACAGAGAAAAAATACAGGGCGCTGGACGAG

[0040] CTGAAAGCGCTGCATCACAGCATCCGGCTGGATAATTCAGAGGCTGGGGCGGGGCTTCA

[0041] TGGTTCTTTCCGGAATCGTCTCAGGAGTCTGAATGACCAGCAGCTGGATGCCCTGCAAT

[0042] GCTGGTATCCTGATGACGGCATCCACATACGTTACCAGACCCCCGGGGGGCAGATGGAA

[0043] GACATTGCCTTTGCTTCTCCGGGGCAAAAGGGAGCGAGTATGCTGCAGTTCCTCTTATCC

[0044] TATGGCACCGATCCTCTACTACTGGATCAACCGGAGGATGACCTGGACTGCCTGATGCTG

[0045] AGCATGAGCGTGATCCCTGCCATCATGTCGAACAAGAAACGCCGGCAGCTGATTATCGT

[0046] GTCGCACTCTGCCCCTATAGTGGTTAACGGCGATGCAGAATATGTTATCAGTATGCAGCA

[0047] CGATCGCACAGGCCTGTATCCAGGACTCTGCGGTGCACTGCAGGAAGCTCCGATGAAGG

[0048] CACTGATATGCCGTCAAATGGAGGGGGGAGAAAAAGCGTTTCGTTCGCGCTATGAGCGTATTCTTAGCTGA。

[0049] The T1FR protein expressed by the above T1fr gene has the amino acid sequence shown in SEQ ID NO:2.

[0050] *.

[0051] The method for preparing and expressing the T1FR protein expressed by the T1fr gene comprises the following steps:

[0052] Step 1: T1fr gene sequence amplification

[0053] Using pEC51 plasmid (Accession no. OQ230786.1) as a template, the T1fr gene nucleic acid sequence was amplified (primers: F-AGGTCGACTCTAGAGGATCCTTGACAATTAATCATCGGCTCGT, R-TAATGGTGATGGTGATGGTGGCTAAGAATACGCTCATAGC), and the nucleic acid sequence was recovered and purified;

[0054] Step 2: Plasmid construction

[0055] The gene with the nucleotide sequence of SEQ ID NO: 1 is connected to an expression vector plasmid, the plasmid is constructed and transferred into a host bacterium for expression.

[0056] Furthermore, in step 2, the expression vector is pUC19; and the host bacteria is adherent-invasive Escherichia coli (AIEC).

[0057] Another object of the present invention is to provide the application of the above T1FR protein.

[0058] The T1FR protein expressed by the above-mentioned T1fr gene is used to inhibit the adhesion-invasive Escherichia coli (AIEC) fimbriae inhibitor.

[0059] The T1FR protein expressed by the above-mentioned T1fr gene is used to inhibit the colonization of adherent invasive Escherichia coli (AIEC) in the intestine.

[0060] The T1FR protein expressed by the above-mentioned T1fr gene is used to inhibit the pathogenicity of adherent invasive Escherichia coli (AIEC) in the intestine.

[0061] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are:

[0062] 1. The present invention provides a TIFR protein and a preparation method thereof. The TIFR protein nucleotide sequence is shown in SEQ ID NO: 1. Studies have found that the TIFR protein can inhibit the T1FR protein of type I fimbriae of Escherichia coli, and can effectively inhibit the colonization and pathogenicity of adherent invasive Escherichia coli (AIEC) in the intestine of mice, proving that blocking the adhesion process of bacterial fimbriae to tissues and organs by biological factors can effectively reduce the pathogenicity of bacteria, providing an important reference strategy for the scientific management of bacterial infectious diseases.

[0063] 2. The present invention provides the application of T1FR protein in inhibiting the adhesion of aggressive invasive Escherichia coli (AIEC) pili.

[0064] 3. The present invention provides the use of T1FR protein to inhibit the colonization of adherent invasive Escherichia coli (AIEC) in the intestine.

[0065] 4. The present invention provides the use of T1FR protein to inhibit the pathogenicity of adherent invasive Escherichia coli (AIEC) in the intestine. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 Diagram of the process by which TIFR protein inhibits the pathogenicity of adherent-invasive Escherichia coli (AIEC).

[0067] Figure 2 This is the protein structure of TIFR protein.

[0068] Figure 3 Diagram of the process of recombinant plasmid.

[0069] Figure 4 This is a test diagram of the expression results of T1FR protein in LF82 strain.

[0070] Figure 5 This is a transmission electron micrograph of bacterial pili.

[0071] Figure 6 This is a detection diagram of the inhibition of LF82 strain's adsorption to eukaryotic cells by T1FR protein.

[0072] Figure 7 The biofilm images of the two strains were observed using a fluorescence microscope (Leica DM4 B).

[0073] Figure 8 This is a diagram showing the results of AIEC colonization test in mouse intestine.

[0074] Fig. 9 This is the result of intestinal pathology analysis after AIEC infection in mice. DETAILED DESCRIPTION

[0075] The present invention will be described in detail below in conjunction with the accompanying drawings.

[0076] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0077] Example 1

[0078] 1. Construction and transformation of TIFR protein expression vector

[0079] A T1fr gene, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0080] The amino acid sequence of TIFR protein is shown in SEQ ID NO:2.

[0081] The structure of TIFR protein is predicted by AlphaFold, such as Figure 2 shown.

[0082] The pUC19 plasmid containing the T1fr gene (pUC19+T1fr) was constructed by homologous recombination.

[0083] (1) Using pEC51 plasmid (Accession no. OQ230786.1) as a template, the T1fr gene nucleic acid sequence was amplified (primers: F-AGGTCGACTCTAGAGGATCCTTGACAATTAATCATCGGCTCGT, R-TAATGGTGATGGTGATGGTGGCTAAGAATACGCTCATAGC), and the amplified product was recovered and purified.

[0084] (2) The nucleotide sequence shown in SEQ ID NO: 1 was cloned into a plasmid to obtain a recombinant plasmid, pUC19+T1fr, as follows: Figure 3 shown.

[0085] (3) Introducing the recombinant plasmid obtained in step (1) into the LF82 strain to obtain the LF82 strain that overexpresses the TIFR protein.

[0086] 2. Test of the expression results of T1FR protein in LF82 strain

[0087] like Figure 4 As shown, the LF82 strain was cultured at 37°C with shaking until the logarithmic phase, and the pUC19 and pUC19+T1fr plasmids were transformed into the LF82 strain by electroporation, and the strains were named LF82 / pUC19 strain and LF82 / pUC19+T1fr strain, respectively. The expression results of the fluorescent protein in the plasmid were observed by an upright fluorescence microscope (Leica DM4 B), as shown in FIG. Figure 4 As shown in Figure A, the transformation results of the plasmid in the LF82 strain were verified by fluorescence microscopy. Figure 4 B in the figure is the result of PCR verification of the transformation of the plasmid in the LF82 strain. Figure 4 C in the figure is the result of Western blot verification of the expression of T1FR protein in LF82 strain.

[0088] The expression of T1FR protein was verified by multiple testing methods, indicating that T1FR protein was successfully expressed in the LF82 strain.

[0089] 3. Test of the inhibition of T1FR protein on LF82 strain pili

[0090] The F82 / pUC19 strain and the LF82 / pUC19+T1fr strain were inoculated into MHA solid culture medium at 37°C overnight, and then single clones were picked and stained with 2% phosphotungstic acid for 3-10 seconds, dried at room temperature, and then the bacterial pili were observed using a JEM-1400FLASH transmission electron microscope. Figure 5 shown.

[0091] Transmission electron microscopy observations showed that T1FR protein could effectively inhibit the pili of LF82 strain.

[0092] 4. Detection of T1FR protein inhibiting the adsorption of LF82 strain to eukaryotic cells

[0093] like Figure 6 As shown, HICE6 cells were grown in RPMI 1640 medium (Sigma-Aldrich) at 37°C and 5% CO2. The cultured cells were distributed in 24-well plates with approximately 4×105 cells per well. After continued culture for 16 hours, non-adherent cells were removed with PBS. The LF82 / pUC19 strain and LF82 / pUC19+T1fr strain were cultured overnight, the bacteria were collected by centrifugation at 10,000 rpm and resuspended with RPMI 1640 medium. The resuspended bacteria were distributed to the cultured 24-well plates at an infection multiplicity (MOI) of 10 and incubated at 37°C for 3 hours. The liquid in the wells was removed and the free cells were washed with PBS. As shown in the following figure: Figure 6 As shown in A, the adsorption of LF82 / pUC19 strain and LF82 / pUC19+T1fr strain to eukaryotic cells was evaluated under an upright fluorescence microscope.

[0094] like Figure 6 Middle B is the fluorescence intensity analysis of upright fluorescence microscope observation using ImageJ, and the results show that T1FR protein can inhibit the adsorption of LF82 strain to eukaryotic cells.

[0095] 5. T1FR protein inhibits biofilm formation of LF82 strain

[0096] like Figure 7As shown, the LF82 / pUC19 strain and the LF82 / pUC19+T1fr strain were cultured at 37°C with shaking overnight, the bacterial solution was diluted to 108CFU.mL-1, and the slide was placed in the diluted bacterial solution and continued to be cultured for 24 hours. The biofilm attached to the slide was washed with PBS and fixed with 2.5% glutaraldehyde. The fixed slide was washed with PBS and stained with FITC-concanavalin A (FITC-ConA) for 30 minutes at 4°C in the dark. The slide was washed with PBS again and stained with propidium iodide (PI) in the dark for 15 minutes. The excess dye was washed with PBS and dried, and the biofilms of the two strains were observed and analyzed using an upright fluorescence microscope (Leica DM4 B). It was observed by fluorescence microscopy that the T1FR protein can effectively weaken the biofilm formation ability of the LF82 strain.

[0097] 6. Survival rate of AIEC-infected mice and colonization test of AIEC in the mouse intestine

[0098] Five-week-old mice were randomly divided into four groups (PBS, LF82, LF82 / pUC19, and LF82 / pUC19+T1fr), with 10 mice in each group. AIEC (109 CFU / day) was inoculated intragastrically for three consecutive days. The PBS group was intragastrically inoculated with the corresponding volume of PBS buffer for 7 days. The survival rate of mice was calculated. The test results are shown in the figure. Figure 8 As shown in A, it shows that T1FR protein can improve the survival rate of mice infected with LF82 strain.

[0099] The complete colorectum of mice was removed and PBS (0.1 g / mL) pre-cooled at 4°C was added to prepare a suspension using a tabletop tissue homogenizer. The intestinal tissue homogenate was diluted 10 times in a row, and 1 μL of the diluted homogenate was inoculated on an LB agar plate containing tetracycline (5 μg / mL). The colonization of AIEC in the mouse intestine was evaluated by the number of colonies on the plate and the product of the dilution rate. Figure 8 As shown in B. Figure 8 C in the figure is the quantitative analysis result of AIEC colonization in the mouse intestine. The results show that T1FR protein significantly reduced the colonization of LF82 strain in the mouse intestine.

[0100] 7. Results of intestinal pathological analysis of mice infected with AIEC

[0101] like Figure 1 and Fig. 9 As shown, Fig. 9A in the figure is a pathological section of the intestine. The mouse colon was fixed with a fixative for 24 hours, dehydrated by a standard procedure, and embedded in paraffin to prepare 5 μm tissue sections. The sections were stained with hematoxylin-eosin (H&E) and Alcian blue, and scanned and observed with a panoramic tissue section scanning system (Olympus VS200). The results showed that T1FR protein can alleviate the pathological damage of the LF82 strain to the intestine.

[0102] Fig. 9 B in the figure is the result of intestinal cytokine detection. The total protein content in the intestine was determined according to the instructions of the total protein determination kit (Nanjing Jiancheng Technology Co., Ltd.), and the cytokines TNFα, IL-6 and IL-8 in the intestine were determined according to the instructions of the ELISA kit (Jiangsu Enzyme Absorption Industrial Co., Ltd.). The measured values ​​were normalized with the total protein and then statistically analyzed. The results showed that T1FR protein can inhibit the production of inflammatory factors in intestinal tissue induced by LF82 strain. Fig. 9 C in it represents the diversity analysis of 16S RNA of mouse intestinal microorganisms. The intestinal contents of mice were taken, and the DNA of the mouse intestinal contents was extracted according to the instructions of the kit (EZNATM Mag-Bind Soil DNA Kit, OMEGA). The DNA was sequenced by Shengsheng Biotechnology (Shanghai) Co., Ltd., and the non-repetitive sequences with a similarity higher than 97% were clustered into taxonomic units (OTU) using UPARSE. Based on the OUT clustering results, diversity analysis was performed, and the results showed that T1FR protein had little effect on the intestinal microecology.

[0103] The test results showed that T1FR protein can effectively inhibit the pathogenicity of AIEC strain to the mouse intestine.

[0104] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. Use of T1FR protein expressed by T1fr, a T1FR protein encoding gene, in the preparation of a drug for inhibiting colonization of adherent invasive Escherichia coli in the intestine, characterized in that: The amino acid sequence is shown in SEQ ID NO:

2.

2. Use of T1FR protein expressed by T1fr, a T1FR protein encoding gene, in the preparation of a drug for inhibiting the pathogenicity of adherent invasive Escherichia coli in the intestine, characterized in that: The amino acid sequence is shown in SEQ ID NO:

2.

3. The use according to any one of claims 1 to 2, characterized in that: A method for preparing and expressing T1FR protein expressed by T1fr, a gene encoding T1FR protein, The following steps are included: Step 1, T1fr gene sequence amplification: using pEC51 plasmid as a template, amplifying the T1fr gene nucleic acid sequence, and recovering and purifying the nucleic acid sequence; Step 2: Plasmid construction: Connect the gene with the nucleotide sequence of SEQ ID NO: 1 to the expression vector plasmid, construct the plasmid and transfer it into the host bacteria for expression.

4. The use according to claim 3, characterized in that: In step 2, the expression vector is pUC19; the host bacteria is adherent-invasive Escherichia coli.

Images