LDH-dsRNA nanoformulation for preventing and controlling crop anthrax and its application

Abstract

The present invention discloses an LDH-dsRNA nanoformulation for controlling anthracnose in crops and its application. The formulation comprises dsRNA transcribed from a target gene segment represented by SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3, and a nanostructured layered double hydroxide. Research results have shown that the formulation significantly reduces the pathogenicity of anthracnose fungi and has promising application in controlling anthracnose in crops.

Description

Technical Field

[0001] The invention belongs to the technical field of plant disease prevention and control, and particularly relates to an LDH-dsRNA nano preparation for preventing and controlling crop anthracnose and an application thereof. Background Art

[0002] Anthracnose is a common plant disease caused by the fungus Colletotrichum. This genus has a wide geographical distribution and a diverse host plant population, affecting gymnosperms, angiosperms, monocots, and dicots. Anthracnose severely damages important economic crops such as fruits, vegetables, cereals, grasses, and ornamentals, causing significant economic losses (Cannon et al., 2002; Li and Jiang, 2008; Cao et al., 2020). Anthracnose can occur on the leaves, stems, and fruits of host plants. The most common symptoms include leaf spots, branch dieback, leaf blight, seedling death, fruit drop, and postharvest fruit rot (Qin et al., 2019; Huang et al., 2021; Khan et al., 2021). The disease can occur during both pre-harvest production and post-harvest storage of fruits and vegetables, causing significant economic losses. Anthrax usually begins to infect fruit before harvest and becomes active after the fruit is stored or appears on market shelves. Up to 100% of stored fruit will be infected with anthracnose (Prusky., 1996).

[0003] Anthracnose is particularly serious in tropical and subtropical regions. For example, anthracnose of the tropical rubber tree is one of the two major leaf diseases of the tree. Important tropical fruits such as dragon fruit, mango, banana, avocado, and papaya are all susceptible to anthracnose both before and after harvest, resulting in significant economic losses (Ma Wenjuan et al., 2022; Wang Wenjing et al., 2020; Che Jianmei et al., 2020; Wei Wentian, 2014; Yu Jing et al., 2022). Mango anthracnose primarily affects the mango fruit and is one of the most common and damaging diseases of mangoes during postharvest storage. Over 70% of mango diseases are caused by anthracnose. This fungal disease poses a serious threat to the development of the mango industry and causes significant economic losses (Khan et al., 2021; Mo et al., 2018). Papaya anthracnose is a major disease worldwide, causing papaya fruit rot and severely impacting quality and yield (Sun et al., 2020; Dias et al., 2020). With the increasing acreage of fruit and vegetable cultivation, the impact of anthracnose is increasing year by year.

[0004] Nucleic acid pesticides are a class of polynucleotides that specifically bind to the transcripts of specific genes in target organisms, interfering with pathogen growth and development and the expression of genes associated with pathogenicity, thereby disrupting pathogen growth and protecting plants. Spray-induced gene silencing (SIGS) involves spraying in vitro synthesized double-stranded RNA (dsRNA) targeting a target gene onto plant surfaces to inhibit target gene expression. It is a novel plant disease control technology with promising application prospects. Koch et al. reported that spraying 791 nt CYP3-dsRNAs (containing complementary sequences to CYP51B, CYP51A, and CYP51C) onto detached barley leaves before fungal infection effectively inhibited the disease and produced smaller lesions, thereby reducing disease incidence (Koch et al., 2016). Wang et al. found that spraying dsRNA targeting DCL1 and DCL2 onto fruits, vegetables, and flowers effectively inhibited pathogen toxicity, significantly reducing lesion size compared to controls (Wang et al., 2016). McLoughlin et al. used RNA sequencing technology and bioinformatics analysis to guide the design of dsRNA targets and identified multiple effective targets for controlling Botrytis cinerea (McLoughlin et al., 2018). These examples demonstrate that spray-induced gene silencing technologies targeting pathogenicity-related genes can, to a certain extent, protect against various fungal diseases. dsRNA is unstable under natural conditions, and environmental factors such as nucleases, rain, ultraviolet light, and microorganisms can directly affect its stability (Qiao et al., 2023). Therefore, maintaining dsRNA stability is one of the greatest challenges in the commercialization of RNA biopesticides.

[0005] Mycelium is the primary nutrient for filamentous fungi such as Colletotrichum and is a key factor in the growth of Colletotrichum hyphae, potentially serving as a target for anthrax control. Previous research by the present inventors' team has shown that the Colletotrichum fatty acid hydroxylase CsSCS7 is a key factor in the growth of filamentous fungi such as Colletotrichum, suggesting that this gene may serve as a potential target for the control of filamentous fungal diseases such as anthrax. Currently, there are no reports of the use of dsRNA associated with this gene in the prevention and treatment of anthrax. Therefore, targeting this gene, screening for highly effective dsRNA fragments, and applying them to the prevention and treatment of anthrax is of great significance for disease control. Summary of the Invention

[0006] In view of the deficiencies in the prior art, the present invention provides an LDH-dsRNA nanoformulation for preventing and treating crop anthracnose and its application.

[0007] The technical solutions of the present invention are as follows:

[0008] The present invention first provides a target gene segment for preventing and controlling crop anthracnose. The target gene segment is a target gene segment of the anthracnose fungus CsSCS7 gene, which is selected from the segment sequence encoding the Cytb5, FA, and Mid domains of the gene, and its nucleotide sequences are shown in SEQ ID. No. 1, SEQ ID. No. 2, and SEQ ID. No. 3, respectively.

[0009] The nucleotide sequence of SEQ ID. No. 1 (located in the Cytb5 domain coding sequence segment) is as follows:

[0010] TCACCCGCGCCGAGGTCGAGGCACACATATTCGAAGAAGTCCTGTTATGTTACGATTGGCAAAAATGTCTACGACGTAACCGACTTCGCCCAGGACCATCCCGGTGGCGCCGACCTCGTCTTCGACTACGGCGGCAAGGACATCGAATCCATCCTGCGCGATCCGACATCCCACCCCCACTCCGAGGCTGCGTACGAAGTTCTCGACGACTCCTTGGTTGGATTCGTCATT

[0011] The nucleotide sequence described in SEQ ID.No.2 (located in the FA domain coding sequence segment) is as follows:

[0012] TCGGCTTCTTTCTCTGGAGCTTGATCGAGTACATCTTGCACCGCTTCCTCTTCCACCTTGACAAGTGGCTTCCGGACAACCGAGTTGGCATTACCATGCATTTCCTCCTCCACGGCATCCATCATTACCTGCCTATGGACAAGTATCGCCTCGTCATGCCTCCTACACTCTTTGTTGTTCTCGCCACGCCGTTCTACAAGCTGGCTCATTGGGTTTTTTCGTACAGCTGGCACGCCGCTACCGCTGTTTATTGCGGAGGCATCTTTGGTTACATCTGCTACGACTTGACGCACTACTTCCTTCACCACCAGAACTTGCCGCTCTGGTACAAGGAATTGAAGAAGTACCACCTTCAGCACCACTTCCTTGACTATGAGCTTGGCTTTGGCGTCACCAGCCGGTTCTGGGATAGCATTTTCGGCACCGAACTGCCTCCCATTGTCAAGACGCAATAA

[0013] The nucleotide sequence of SEQ ID.No.3 (located in the coding sequence segment of the Mid domain) is as follows:

[0014] CAATCAATGGGACGGCCAACAAGCCCAACGGAAAAGCGAATGGACATGTGAACGGGAATGCGAACGGCAATGGCAACAGCGCTGCCAAGACCCAGGAGCATGAGGACGAGCCAAAGATGAATGAATGGCGAGCTCTGGGATGGTGAGCGATGGGTTCATCCTCGCACTGGCATGGCTAGCGAGGAGGATTTGAGCAAGGAGACGGATTACACCAATGACTACAAGAAACACAAGTTCCTCG ACTTGAGCCGCCCACTGTTCCCTCAGATCTGGTACGGGGGCTTCAGCAAGGAGTTCTACCTTGATCAGGTTCATCGCCCTCGCCATTACAAGGGCGGCGAGTCTGCACCACTATTTGGAAACTTTCTCGAGCCCCTTTCCAAGACGCCTTGGTGGGTTGTGCCTGTGGCGTGGCTCCCCCCAGTTGCATACGGTACCTATTTGGCTAGAGAGGGCATGGACAGCACCTTCCAGGAGGTCTGCTA

[0015] The present invention provides a dsRNA for controlling crop anthracnose, transcribed from a target gene segment of the CsSCS7 gene of anthracnose fungus. The dsRNA sequence shown in SEQ ID No. 4 is reverse complementary to the nucleotide sequence of SEQ ID No. 1, the dsRNA sequence shown in SEQ ID No. 5 is reverse complementary to the nucleotide sequence of SEQ ID No. 2, and the dsRNA sequence shown in SEQ ID No. 6 is reverse complementary to the nucleotide sequence of SEQ ID No. 3.

[0016] Among them, the nucleotide sequence described in SEQ ID. No. 4 (Cytb5-dsRNA) is as follows (Note: T in the sequence listing represents U): AAUGACGAAUCCAACCAAGGAGUCGUCGAGAACUUCGUACGCAGCCUCGGAGUGGGGGUGGGAUGUCGGAUCGCGCAGGAUGGAUUCGAUGUCCUUGCCGCCGUAGUCGAAGACGAGGUCGGCGCCACCGGGAUGGUCCUGGGCGAAGUCGGUUACGUCGUAGACAUUUUUGCCAAUCGUAACAUAACAGGACUUCUUCGAAUUAUGUGCCUCGACCUCGGCGCGGGUGA

[0017] Among them, the nucleotide sequence of SEQ ID.No.5 (FA-dsRNA) is as follows (note: T in the sequence list represents U): UUAUUGCGUCUUGACAAUGGGAGGCAGUUCGGUGCCGAAAAUGCUAUCCCAGAACCGGCUGGUGACGCCAAAGCCAAGCUCAUAGUCAAGGAAGUGGUGCUGAAGGUGGUACUUCUUCAAUUCCUUGUACCAGAGCGGCAAGUUCUGGUGGUGAAGGAAGUAGUGCGUCAAGUCGUAGCAGAUGUAACCAAAGAUGCCUCCGCAAUAAACAGCGGUAGCGGCGUGCCAGCUGUACGAAAAAACCCAAUGAGCCAGCUUGUAGAACGGCGUGGCGAGAACAACAAAGAGUGUAGGAGGCAUGACGAGGCGAUACUUGUCCAUAGGCAGGUAAUGAUGGAUGCCGUGGAGGAGGAAAUGCAUGGUAAUGCCAACUCGGUUGUCCGGAAGCCACUUGUCAAGGUGGAAGAGGAAGCGGUGCAAGAUGUACUCGAUCAAGCUCCAGAGAAAGAAGCCGA

[0018] Among them, the nucleotide sequence described in SEQ ID. No. 6 (Mid-dsRNA) is as follows (Note: T in the sequence listing represents U): UAGCAGACCUCCUGGAAGGUGCUGUCCAUGCCCUCUCUAGCCAAAUAGGUACCGUAUGCAACUGGGGGGAGCCACGCCACAGGCACAACCCACCAAGGCGUCUUGGAAAGGGGCUCGAGAAAGUUUCCAAAUAGUGGUGCAGACUCGCCGCCCUUGUAAUGGCGAGGGCGAUGAACCUGAUCAAGGUAGAACUCCUUGCUGAAGCCCCCGUACCAGAUCUGA GGGAACAGUGGGCGGCUCAAGUCGAGGAACUUGUGUUUCUUGUAGUCAUUGGUGUAAUCCGUCCUUGCUCAAAUCCUCCUCGCUAGCCAUGCCAGUGCGAGGAUGAACCCAUCGCUCACCAUCCCAGAGC UCGCCAUUCUCAUUCAUCUUUGGCUCGUCCUCAUGCUCCUGGGUCUUGGCAGCGCUGUUGCCAUUGCCGUUCGCAUUCCCGUUCACAUGUCCAUUCGCUUUUCCGUUGGGCUUGUUGGCCGUCCCAUUGAUUG

[0019] Based on the above sequence information, the present invention provides an LDH-dsRNA nanoformulation for controlling anthracnose in crops. The nanoformulation comprises a dsRNA transcribed from a target gene segment represented by SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3, and a nano-layered double hydroxide. The combination of dsRNA and nano-layered double hydroxide prevents dsRNA degradation and increases its stability and durability.

[0020] Preferably, the nano-layered double hydroxide includes one or more of magnesium / aluminum layered double hydroxide, zinc / aluminum layered double hydroxide, nickel / iron layered double hydroxide, and nickel / aluminum layered double hydroxide.

[0021] Preferably, the nanoformulation may further comprise 1-5 w / w% SDS.

[0022] Preferably, the preparation method of the LDH-dsRNA nanoformulation comprises the following steps:

[0023] a. Preparation of layered double hydroxide working solution: dissolve nano-layered double hydroxide in water to prepare a solution.

[0024] b. Mix the layered double hydroxide solution and dsRNA, place in a 50±5°C water bath for 1-2 minutes, quickly transfer to a shaker and shake for 2-3 minutes, and then let it stand for 20-30 minutes.

[0025] The adsorption method involves mixing dsRNA with LDH, allowing the dsRNA to adsorb onto the LDH, thereby creating an LDH gene nanocomplex with therapeutic properties. By adjusting the preparation temperature, we increased the loading strength and capacity of LDH onto the dsRNA. This is likely due to temperature altering the arrangement of the nanomolecules, affecting the adsorption between the two and causing LDH to form an adsorption envelope around the RNA.

[0026] Preferably, 1-5 w / w% SDS is further added in step b.

[0027] Preferably, at least 1 μg of layered double hydroxide is mixed with every 1 μg of dsRNA.

[0028] On the other hand, the present invention also provides the use of the LDH-dsRNA nanoformulation in preventing and controlling anthracnose of crops.

[0029] The crops of the present invention are host plants of anthracnose, including but not limited to rubber trees, mangoes, bananas, etc. The pathogen of anthracnose includes rubber tree anthracnose fungus Colletotrichum siamense.

[0030] The present invention provides a method for preventing and treating anthrax by applying the LDH-dsRNA nano preparation, that is, the application method comprises spraying the LDH-dsRNA nano preparation on leaves.

[0031] Beneficial effects of the present invention:

[0032] The present invention adopts dsRNA and nanomaterial composite technology, takes the highly pathogenic anthrax fungus HN08 as the experimental material, firstly obtains the segmented dsRNA of the target gene through in vitro dsRNA synthesis technology, then compounded with the nanomaterial layered double hydroxide (LDH) to obtain a dsRNA nanocomposition for controlling crops, sprays the dsRNA nanocomposition on rubber tree leaves, inoculates the anthrax fungus HN08, measures the area of ​​the lesions, and obtains a composition of the target gene dsRNA and nano LDH that effectively controls anthrax in rubber tree leaves.

[0033] Methods for preparing LDH-gene nanocomplexes include coprecipitation, intercalation ion exchange, exfoliation-reconstruction, and adsorption. Adsorption is simple and easy to prepare, so it's currently the most commonly used method. However, this method suffers from low adsorption rates and weak binding between LDH and dsRNA. In the present invention, a centrifuge tube containing dsRNA and LDH is placed in a 45-55°C water bath for 1-2 minutes, then quickly transferred to a high-speed vortex shaker for 2-3 minutes and allowed to stand for 20-30 minutes to form LDH-dsRNA nanoparticles. This method achieves a higher adsorption rate for dsRNA and secures the binding between LDH and dsRNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 This is the result of electrophoresis detection of transcription products.

[0035] Figure 2 Electropherogram for screening the optimal fusion ratio of dsRNA and LDH.

[0036] Figure 3 This is a diagram showing the preventive and therapeutic effect of dsRNA on anthrax. DETAILED DESCRIPTION

[0037] In order to better understand the technical content of the present invention, specific examples are provided below to further illustrate the present invention.

[0038] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0039] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0040] The layered double hydroxides described in the present invention include magnesium / aluminum layered double hydroxide, zinc / aluminum layered double hydroxide, nickel / iron layered double hydroxide, and nickel / aluminum layered double hydroxide. The layered double hydroxide described in the following examples is magnesium / aluminum layered double hydroxide (MgAl-LDH two-dimensional layered double metal hydroxide), which was purchased from Nanjing Xianfeng Nanomaterial Technology Co., Ltd.

[0041] Example:

[0042] 1. Previous studies by the inventors' team have shown that the anthrax fatty acid hydroxylase CsSCS7 is a key factor in the mycelial growth of filamentous fungi such as anthrax. This gene may have the potential to be a target for the prevention and control of filamentous fungal diseases such as anthrax. The protein encoded by this gene contains three key domains, namely Cytb5, FA and Mid. Based on the coding region sequences of the Cytb5, FA and Mid domains of the CsSCS7 protein, three pairs of specific primers were designed. Using the extracted DNA of the highly pathogenic wild-type strain HN08 as a template, three DNA fragments were amplified and obtained. After purification and gel electrophoresis, they were stored at -20°C for subsequent dsRNA synthesis. Primers CsCytb5-dsF / CsCytb5-dsR, CsFA-dsF / CsFA-dsR, and CsMid-dsF / CsMid-dsR amplified the Cytb5, FA and Mid segment sequences, respectively. The primer sequences are as follows:

[0043]

[0044] 2. dsRNA was synthesized in vitro using the T7 RNAi Transcription Kit from Nanjing Vazyme Biotech Co., Ltd. T7 RNAi transcribes RNA in vitro from a DNA template containing a T7 promoter using four NTPs as substrates. The method is as follows:

[0045] a. Configure the reaction system according to the table below (using the mixed template transcription solution as an example):

[0046]

[0047] b. Incubate in a PCR machine at 37°C for 4-6 hours.

[0048] c. Dilute 100 U / μL RNase T1 to 10 U / μL using RNase T1 Dilution Buffer.

[0049] Note: RNase T1 specifically degrades single-stranded RNA and the three G bases at the 5' end. The diluted RNase T1 must be used as soon as possible and should not be stored.

[0050] Components volume Transcription Product 20 μL <![CDATA[RNase-free H2O]]> 17μL DNase I 1 μL RNase T1 (10 U / μL) 2μL Total 40 μL

[0051] Note: After mixing, gently pipette to mix thoroughly and briefly centrifuge the reagent to the bottom of the tube.

[0052] d. Incubate at 37°C for 30 min.

[0053] e. Electrophoresis detection of transcription products, the results are as follows Figure 1Lane M is the DNADL2000 marker; lanes 1, 2, and 3 are Cytb5-dsRNA, Mid-dsRNA, and FA-dsRNA, respectively.

[0054] f. Product Purification

[0055] RNA was purified using magnetic beads.

[0056] (1) Remove RNAClean Beads from 4°C and allow to equilibrate at room temperature for 30 minutes. Mix thoroughly by inverting or vortexing before use.

[0057] (2) Add 80 μL of magnetic bead solution to the transcription product and pipette more than 10 times to mix the solution thoroughly.

[0058] (3) Incubate at room temperature for 8 minutes to allow the RNA to fully bind to the magnetic beads.

[0059] (4) Place the PCR tube on a magnetic rack for approximately 5 minutes. After the solution has clarified, carefully remove the supernatant, taking care not to disturb the magnetic beads when aspirating the supernatant.

[0060] (5) Keeping the PCR tube on the magnetic stand, add 200 μL of freshly prepared 80% ethanol, taking care not to disturb the magnetic beads. Incubate at room temperature for 30 seconds and carefully remove the supernatant. Repeat this step once.

[0061] (6) Open the lid and air-dry the magnetic beads for 5-10 minutes. Dry until there is no moisture on the surface of the beads. Excessive drying will affect the elution of RNA.

[0062] (7) Remove the PCR tube from the magnetic stand, add 40 μL of RNase-free H2O, use a pipette to blow off the magnetic beads on the tube wall, mix thoroughly, and incubate at room temperature for 3 minutes.

[0063] (8) Place the PCR tube on a magnetic rack. After the solution has clarified, carefully transfer the supernatant to a new RNase-free EP tube, avoiding the magnetic beads. To prevent the magnetic beads from affecting subsequent experiments, reserve 1-2 μL of solution when transferring the product to prevent the magnetic beads from being absorbed.

[0064] (9) Detect the A260 absorbance of the product, determine its concentration, and store the purified product at -20°C.

[0065] 3. Preparation of anthrax inoculum: Use an inoculation needle to pick up the wild-type strain HN08 of rubber tree anthrax fungus and inoculate it into CM solid culture medium. After culturing for 5 days at 28°C, scrape the fresh edge mycelium and inoculate it into PD liquid culture medium. Place it in a shaker at 28°C and culture it at 180rpm for 5 days. After the strain produces conidia, use a pipette to draw 2mL of conidia suspension in a clean bench, filter it with filter cloth into a 2mL centrifuge tube, centrifuge it at 5000rpm for 5min to separate the supernatant, resuspend the spore pellet with ddH2O, centrifuge it again, repeat the washing three times, and finally collect the spores by centrifugation. Add 2mL of ddH2O to the centrifuge tube and adjust the concentration of the spore suspension to 10 using a hemocytometer. 4 pcs / ml, for future use.

[0066] 4. Application of dsRNA in the prevention and control of anthrax.

[0067] The specific implementation methods are as follows:

[0068] The concentration of synthesized dsRNA was diluted to 200 μg / mL, 6 μL of dsRNA was added dropwise to the rubber tree leaves, and 10 4 / mL of Siamese anthracnose spore suspension was added, and the experimental results were observed 4 days after inoculation. A total of 4 treatment groups were set up, (1) treatment with clean water as the control; (2) Cytb5-dsRNA treatment; (3) Mid-dsRNA treatment; (4) FA-dsRNA treatment. 30 leaves were treated in each experiment, and repeated 3 times. The inoculation results showed that compared with the water control, the lesion area of ​​the inoculation point where dsRNA was added decreased, and the pathogenicity of the inoculation point where Cytb5-dsRNA (nucleotide sequence is shown in SEQ ID No.4) was most significantly reduced. This preliminarily indicates that dsRNA can reduce the infection of anthracnose on rubber leaves, and the interference effect of the Cytb5-dsRNA segment is the best ( Figure 3 ).

[0069] 5. Binding of nanomaterial layered double hydroxide (LDH) to dsRNA

[0070] a. Preparation of layered double hydroxide working solution: Dissolve the nanomaterial LDH in DEPC water to a final concentration of 50 μg / mL.

[0071] b. Binding of LDH and dsRNA: Pipette 1 μg of dsRNA into nine clean centrifuge tubes. Add 1, 5, 8, 10, 20, 50, 80, and 100 μL of 50 μg / mL LDH working solution to each tube, in that order. Place the tubes in a 50 ± 5°C water bath for 1-2 minutes. Quickly transfer to a high-speed vortex shaker for 2-3 minutes and allow to stand for 20-30 minutes. The dsRNA will then adsorb onto the LDH surface, forming stable LDH-dsRNA nanoparticles. Detect unadsorbed dsRNA by agarose gel electrophoresis, and select the optimal fusion ratio based on the electrophoresis results.

[0072] c. Figure 2 Electrophoresis diagram for screening the optimal fusion ratio of dsRNA and LDH. Lane 1 is dsRNA, lane 2 is LDH working solution, and lanes 3-11 are LDH-dsRNA nanoformulations with different fusion ratios of 1 μg dsRNA and 1, 5, 8, 10, 20, 50, 80 and 100 μL of 50 μg / ml LDH working solution. Figure 2 It was found that lane 7 was the optimal fusion ratio of dsRNA and layered double hydroxide. After the fusion of layered double hydroxide and dsRNA, no excess dsRNA was precipitated, that is, the optimal fusion ratio was when the volume mass ratio of layered double hydroxide and dsRNA was 20 μL:1 μg.

[0073] 6. Application of LDH-dsRNA Nanoformulations in the Prevention and Treatment of Anthrax

[0074] The specific implementation methods are as follows:

[0075] The study analyzed the effects of dsRNA and LDH-dsRNA nanomaterials on the prevention and treatment of anthrax, and designed four treatment groups. The four groups sprayed with naked-dsRNA were: (1) water as the control treatment; (2) Cytb5-dsRNA; (3) Mid-dsRNA; (4) FA-dsRNA; the four groups sprayed with LDH-dsRNA were: (1) blank nanomaterials as the control treatment; (2) Cytb5-dsRNA-LDH nanomaterials treatment; (3) Mid-dsRNA-LDH treatment; (4) FA-dsRNA-LDH treatment. Each group treated 30 leaves of plants, and the experiment was repeated 3 times. The inoculation results are shown in Figure 3Compared with naked-dsRNA on the left, the lesion area of ​​the inoculation point where dsRNA-LDH was added decreased, and the effect was obvious. The lesion area of ​​naked-Cytb5-dsRNA, naked-Mid-dsRNA and naked-FA-dsRNA was 23.42%, 35.36% and 36.73% smaller than that of the control treatment (only inoculated with anthracnose); the lesion area of ​​Cytb5-dsRNA-LDH, Mid-dsRNA-LDH and FA-dsRNA-LDH was 76.47%, 80.86% and 76.60% smaller than that of the control treatment, respectively. The lesion area of ​​the three LDH-dsRNA nanoagents was reduced by 53.05%, 45.5% and 39.87% respectively compared with the lesion area of ​​dsRNA treatment. This shows that dsRNA-LDH can effectively reduce the infection of anthracnose on rubber leaves and has a good protective effect ( Figure 3 ).

[0076] 7. Temperature Selection for Preparation of LDH-dsRNA Nanoformulations

[0077] Referring to the preparation method in Section 5 above, three treatment groups were designed. 1 μg of dsRNA and 20 μL of LDH working solution were placed in three centrifuge tubes. The tubes were placed in a water bath at 25°C, 50°C, and 75°C, respectively, and allowed to stand for 1-2 minutes. The tubes were then quickly transferred to a high-speed vortex oscillator for 2-3 minutes and allowed to stand for 20-30 minutes. At this point, dsRNA was adsorbed onto the surface of LDH, forming stable LDH-dsRNA nanoparticles. Agarose gel electrophoresis was used to detect the adsorption of dsRNA by LDH at different temperatures. The results showed that 50°C was the optimal temperature. After the layered double hydroxide and dsRNA were fused at a ratio of 20 μL:1 μg, no excess dsRNA precipitated at this temperature.

[0078] 8. Improved performance of LDH-dsRNA nanoformulations

[0079] Referring to the preparation method in Section 5 and the control experiment in Section 6, three treatment groups were designed. These included adding 1 w / w% SDS, 1 w / w% vinyltriethoxysilane, and no addition during the mixing of LDH and dsRNA. The results showed that in the group with 1 w / w% SDS added, no excess dsRNA precipitated after the layered double hydroxide and dsRNA were fused at a ratio of 10 μL:1 μg. Furthermore, the LDH-dsRNA nanoparticles demonstrated significantly better control and prevention effects against anthrax than the other two groups (p < 0.01). The optimal ratio for the other two groups was 20 μL:1 μg, indicating that the addition of 1 w / w% SDS was beneficial for enhancing LDH's adsorption of dsRNA, allowing it to adsorb large amounts of dsRNA. Further analysis determined that the optimal addition amount of 1 w / w% SDS was 1% to 5%.

[0080] The above descriptions are only some embodiments of the present invention and are not intended to limit the present invention. Any modifications made within the spirit and principles of the present invention shall fall within the scope of protection of the present invention.

Claims

1. An LDH-dsRNA nanoformulation for preventing and treating anthrax in crops, characterized in that: It includes dsRNA transcribed from the target gene segment shown in SEQ ID. No. 1, SEQ ID. No. 2 or SEQ ID. No. 3, and nano-layered double hydroxide; the nucleotide sequence of the dsRNA is shown in SEQ ID. No. 4, SEQ ID. No. 5 or SEQ ID. No.

6.

2. The LDH-dsRNA nanoformulation according to claim 1, characterized in that The nano-layered double hydroxide is magnesium / aluminum layered double hydroxide.

3. The LDH-dsRNA nanoformulation according to claim 1, characterized in that Also includes 1~5w / w% SDS.

4. The LDH-dsRNA nanoformulation according to claim 1, characterized in that The preparation method of the LDH-dsRNA nanoformulation comprises the following steps: a. Preparation of a layered double hydroxide working solution: dissolving the nano-layered double hydroxide in water to prepare a solution; b. Mix the layered double hydroxide solution and dsRNA, incubate in a 50±5°C water bath for 1-2 minutes, quickly transfer to a shaker and shake for 2-3 minutes, then let it sit for 20-30 minutes.

5. The LDH-dsRNA nanoformulation according to claim 4, characterized in that In step b, 1-5 w / w% SDS was also added.

6. The LDH-dsRNA nanoformulation according to claim 4, characterized in that For every 1 μg of dsRNA, at least 1 μg of layered double hydroxide was mixed.

7. Use of the LDH-dsRNA nanoformulation according to any one of claims 1 to 6 in preventing and treating anthracnose of rubber trees.

8. The use according to claim 7, characterized in that The anthracnose pathogens include Colletotrichum siamense.

9. The application according to claim 7, characterized in that: The application method is to spray the LDH-dsRNA nanoformulation on leaves.

Images