A strain of natriuretic vibrio with high amylase production and its application

Abstract

The invention discloses a high-yield amylase-requiring sodium vibrio and its application. The sodium vibrio is named Vibrio natriegens GZUAS951015, which has been deposited in the Guangdong Provincial Microbial Culture Collection Center with a deposit number of GDMCC No.63888. The sodium vibrio has high salt tolerance, can be applied to salinized soil remediation and management, has a fast reproduction rate, can be used as a chassis cell for industrial production, shortens the culture time, improves production efficiency, reduces energy consumption, and can be widely used in the industrial production of amylase. The fermentation medium of the strain is simple and easy to obtain, low in cost, can reduce the cost of raw materials, and increase the yield of strains. The amylase produced by the strain can maintain a high activity within the range of pH 4.0-10.0, and has a wide pH adaptation range.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a high-yield amylase-requiring natrium vibrio and application thereof. Background Art

[0002] Amylase is a general term for enzymes that can hydrolyze starch, glycogen and related polysaccharides. It is used in the food industry, textile industry, brewing, fermentation, medicine and other industries. Amylase is widely present in animals, plants and microorganisms. It is divided into low-temperature enzymes, medium-temperature enzymes and high-temperature enzymes according to different reaction temperatures. The application of microorganisms to produce industrial amylase has gradually become a hot topic in the field of enzyme engineering. It is known that many bacteria and fungi can produce amylase, such as Bacillus subtilis, Bacillus licheniformis, Bacillus amyloliquefaciens, etc., and fungi such as Aspergillus niger, Gibberella intermedia, Trichoderma longibrachiatum, etc.

[0003] As land resources are gradually depleted, it is urgent to develop new resources. The ocean accounts for about 71% of the earth's surface area, and the natural resources in the ocean are rich and varied. Due to the special ecological environment of the ocean (high pressure, high salt, low temperature, oligotrophic), marine animals, plants and microorganisms have a certain degree of halophilia.

[0004] Amylase has a wide range of applications. In the textile field, amylase can improve bleaching and dyeing effects, reduce dye usage and reduce environmental pollution; in the medical field, amylase can be used as a diagnostic reagent, etc. Due to the wide application of amylase, it is required not only to have high amylase activity, but also to have high acid-base stability. Due to the special ecological environment of the ocean, it is very necessary to develop amylase-producing microorganisms in the ocean and use them in industrial production. Summary of the invention

[0005] The purpose of the present invention is to provide a high-yield amylase-requiring natrium vibrio.

[0006] Another object of the present invention is to provide a high-yield amylase-requiring natrium vibrio for use in salinized soil remediation and treatment; for use as a chassis cell in the industrial production of amylase; for use in the preparation of bleaching agent and dyeing agent textile products; and for use in the preparation of diagnostic reagent pharmaceutical products.

[0007] The present invention is achieved through the following technical solutions:

[0008] The high-yield amylase-requiring sodium vibrio of the invention is named as Vibrio natriegens GZUAS951015, and has been deposited in Guangdong Microbiological Culture Collection Center with a deposit number of GDMCC No: 63888.

[0009] The high-yield amylase-producing Vibrio natrium of the present invention can be used in any of the following ways:

[0010] (1) Application in the remediation of salinized soil;

[0011] (2) Application as chassis cells in industrial production of amylase;

[0012] (3) Application in the preparation of bleaching and dyeing textile products;

[0013] (4) Application in the preparation of diagnostic reagents and pharmaceutical products.

[0014] The application (1) of the present invention is used for the restoration and management of salinized soil, specifically, is used for the preparation of salinized soil restoration and management improver products.

[0015] The pH range in which the amylase produced in application (2) of the present invention can maintain relatively high activity is: pH 4.0-10.0.

[0016] The method for separating and purifying high-yield amylase-producing Vibrio natrii of the present invention comprises the following steps:

[0017] 1) Sample collection

[0018] Collect intertidal seawater and intertidal plant rhizosphere soil, add 30% glycerol in equal volume to the water sample, mix well and store in a sealed container at 4°C;

[0019] 2) Sample pretreatment

[0020] Take 10g of soil sample and place it in a 250mL shaking bottle filled with 100mL of physiological saline and glass beads, and shake it at 30℃ and 180r for 20min to make the sample evenly dispersed;

[0021] 3) Enrichment culture

[0022] After the sample was evenly dispersed by shaking and allowed to stand for 5 minutes, the supernatant was added to a 250 mL shake flask containing 100 mL of 2216E liquid culture medium, and the growth was observed at 30°C and 180 rpm for 48 hours.

[0023] 4) Separation and purification

[0024] Take the enriched culture solution to make 1.0×10 -4 ~1.0×10 -8Gradient dilution was performed, and 100ul of each concentration was spread on the screening medium with starch as the sole carbon source after mixing. Three plates were spread in parallel for each concentration and incubated at 30°C for 48h. Then, colonies with different colony morphologies that could produce transparent circles were picked and streaked multiple times on the screening medium for strain purification. A strain with fast growth rate, good growth state and large transparent circle was obtained, which was numbered GZUAS951015 and stored at -80°C.

[0025] The beneficial effects of the present invention are as follows:

[0026] 1. The Vibrio natriegens GZUAS951015 strain isolated and purified by the present invention is a marine bacterium with high salt tolerance and can be applied to salinized soil remediation. Test data show that it grows vigorously in a 2%-7% NaCl environment and maintains a high enzyme activity. When fermenting, seawater is used as a raw material, which reduces the cost of raw materials, reduces the risk of contamination during the fermentation process, and improves economic benefits and efficiency.

[0027] 2. The Vibrio natriegens GZUAS951015 strain isolated and purified by the present invention has a fast reproduction speed. It enters the logarithmic growth phase after 2 hours of cultivation, the mid-logarithmic growth phase after 5 hours of cultivation, and the stable phase after 10 hours of cultivation. The shortest generation time is less than 10 minutes, and the growth rate is twice that of Escherichia coli. It is the fastest growing bacterium known so far and may replace Escherichia coli to become a new model strain.

[0028] 3. The Vibrio natriegens GZUAS951015 strain isolated and purified by the present invention has a fast reproduction speed and can be used as a chassis cell for industrial production, thereby shortening the culture time, improving production efficiency, reducing energy consumption, and can be widely used in the industrial production of amylase.

[0029] 4. The fermentation medium of the Vibrio natriegens GZUAS951015 strain separated and purified by the present invention is simple, easy to obtain, and low in cost, which can reduce the cost of raw materials and increase the yield of strains.

[0030] 5. The amylase produced by the Vibrio natriegens GZUAS951015 strain separated and purified by the present invention can maintain a relatively high activity within the pH range of 4.0-10.0 and has a wide pH adaptability range.

[0031] Storage information description:

[0032] The isolated strain was named: Vibrio natriegens GZUAS951015

[0033] Depository: Guangdong Microbiological Culture Collection Center

[0034] Storage address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou

[0035] Deposit date: October 14, 2023

[0036] Deposit number: GDMCC No: 63888 BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 :The colony morphology of Vibrio natrii on NA

[0038] Figure 2 :The morphology of Vibrio natriuresis on TCBS medium

[0039] Figure 3 :Need to check the size of Vibrio natrium

[0040] Figure 4 : Results of starch degradation by Vibrio natrium using dilute iodine solution staining

[0041] Figure 5 :The transparent circle of Vibrio natriuresis on starch plate

[0042] Figure 6 : Growth curve of Vibrio natriuresis

[0043] Figure 7 : Phylogenetic tree of Vibrio natriuresis

[0044] Figure 8 :DNS method to measure enzyme activity reaction phenomenon

[0045] Fig. 9 : pH value test results of the produced amylase

[0046] Fig.10 :Results of salt tolerance test of Vibrio natriuresis DETAILED DESCRIPTION

[0047] Example 1

[0048] The Vibrio natriegens was named Vibrio natriegens GZUAS951015 and has been deposited in Guangdong Microbiological Culture Collection Center with the deposit number: GDMCC No: 63888.

[0049] Example 2

[0050] Application of Vibrio natrii in the remediation of salinized soil;

[0051] Application of Vibrio natrii as chassis cells for industrial production of amylase;

[0052] Application of Vibrio natrii in the preparation of textile products such as bleaching agents and dyeing agents;

[0053] Application of Vibrio natriuresis in the preparation of diagnostic reagent pharmaceutical products.

[0054] Example 3 Application of amylase production

[0055] (1) Fermentation medium formula: 10 g peptone, 10 g soluble starch, 20 g NaCl, dissolved in 1000 mL distilled water, pH natural, sterilized at 121°C for 20 min.

[0056] (2) The Vibrio natriegens GZUAS951015 strain was activated and inoculated into a seed culture medium, cultured at 30°C and 180 r / min for 48 h, inoculated into a fermentation medium at a 0.5% inoculum, cultured at 30°C and 180 r / min for 3 d, centrifuged at 4°C and 10,000 r / min for 5 min, and the enzyme activity of the supernatant was measured by the DNS method to be 375.25±34 U / mL.

[0057] Experimental example

[0058] In order to further verify the feasibility of this application, the invention team conducted a series of experiments, as follows:

[0059] Unless otherwise specified, the materials and reagents used in the experiments can be purchased from commercial channels.

[0060] Experimental Example 1 Screening Method for Vibrio natriuresis

[0061] 1. Sample Collection

[0062] The samples of Vibrio natrium required for this screening were collected from intertidal seawater and intertidal plant rhizosphere soil in Haikou City, Hainan Province. Glycerol with an equal volume concentration of 30% was added to the water samples, mixed and stored in a sealed container at 4°C.

[0063] 2. Sample Pretreatment

[0064] 2.1 After the sample arrives at the laboratory, first check whether the packaging is damaged. After confirming that the sample packaging is intact, store it in a 4℃ refrigerator.

[0065] 2.2 Take 10g of soil sample and place it in a 250mL shaking flask containing 90mL of physiological saline and glass beads. Oscillate at 30℃ and 180r for 20min to make the sample evenly dispersed.

[0066] 3. Enrichment Culture

[0067] 3.1 Preparation of 2216E liquid culture medium

[0068] Peptone 5.0g / L, yeast powder 1.0g / L, ferric citrate 0.1g / L, sodium chloride 19.45g / L, magnesium chloride 5.98g / L, sodium sulfate 3.24g / L, calcium chloride 1.8g / L, potassium chloride 0.55g / L, sodium carbonate 0.16g / L, potassium bromide 0.08g / L, strontium chloride 0.034g / L, boric acid 0.022g / L, sodium silicate 0.004g / L, sodium fluoride 0.0024g / L, ammonium nitrate 0.0016g / L, disodium hydrogen phosphate 0.008g / L, pH 7.6±0.2 (25℃), sterilize at 121℃ for 20min for use.

[0069] 3.2 Shake flask culture and observation

[0070] After the sample was allowed to stand for 5 minutes, the supernatant was added to a 250 mL shake flask containing 100 mL of 2216E liquid culture medium. The shake flask was cultured at 30°C and 180 rpm for 48 hours to observe the growth.

[0071] 4. Separation and purification

[0072] 4.1 Take the enriched culture solution and make 1.0×10 -4 ~1.0×10 -8 Gradient dilution was performed, and 100ul of each concentration was spread on the screening medium with starch as the sole carbon source after mixing. Three plates were spread in parallel for each concentration, and inverted and cultured at 30℃ for 48h.

[0073] The above screening medium formula: soluble starch 10g / L, peptone 10g / L, sodium chloride 20g / L, pH 8.6±0.2 (25°C), sterilized at 121°C for 20min for use;

[0074] 4.2 Select colonies with different colony morphology that can produce transparent circles and streak them on the screening medium for multiple times to purify the strain. Figures 4 to 5 .

[0075] 4.3 A strain with fast growth rate, good growth state and large transparent zone was obtained, numbered GZUAS951015 and stored at -80℃.

[0076] The growth curve determination process is as follows:

[0077] 1) The strain Vibrio natriegens GZUAS951015 was removed and activated, and a well-growing colony was picked with a sterilized inoculation loop and placed in 2216E liquid culture medium, and cultured in a shaking flask at 30°C and 180 rpm for 6 hours for later use.

[0078] 2) Take 10ul of the activated bacterial liquid and inoculate it into a conical flask containing 100mL of 2216E liquid culture medium. This is the bacterial suspension at time 0.

[0079] 3) Using 2216E liquid culture medium as the reference solution, measure the OD value of the bacterial suspension at time 0 at a wavelength of 600 nm.

[0080] 4) Place the conical flask in a constant temperature shaker and culture at 30℃ for 180 rpm. Take samples every 2 hours to measure the OD value.

[0081] The growth curve was drawn with the culture time as the horizontal axis and the OD value as the vertical axis. Figure 6 .

[0082] Depend on Figure 6 It can be seen that Vibrio natriegens GZUAS951015 has a fast reproduction speed. It enters the logarithmic growth phase after 2 hours of cultivation, the mid-logarithmic growth phase after 5 hours, and the stable phase after 10 hours. The shortest generation time is less than 10 minutes, and the growth rate is twice that of Escherichia coli. It is the fastest growing bacterium known so far and may replace Escherichia coli to become a new model strain.

[0083] Experimental Example 2: Identification of bacterial species

[0084] The isolated and screened target strains were observed for colony morphology and identified for physiological and biochemical characteristics according to the Manual of Systematic Identification of Common Bacteria and Bergey's Manual of Systematic Bacteriology.

[0085] 1. Morphological identification

[0086] The strain GZUAS951015 was cultured on a 2% NaCl NA plate at 30°C for 48 hours, and the colonies were irregularly round, medium-sized, and moist yellowish. The strain GZUAS951015 was cultured on a 2% NaCl NA plate at 30°C for 48 hours, and the colonies were irregularly round, medium-sized, and moist yellowish. The Gram staining result was negative, and the colonies were short rod-shaped, slightly curved, and 0.42-0.57um×0.98-1.4um in size when observed under a 100x oil microscope. Figures 1 to 3 .

[0087] 2. Physiological and biochemical characteristics

[0088] See Table 1.

[0089] Table 1 Physiological and biochemical characteristics of Vibrio natriuresis GZUAS951015

[0090]

[0091] Note: - is negative, + is positive, and F is fermentation type

[0092] 3. Molecular Biological Identification

[0093] The Vibrio natriegens GZUAS951015 strain was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing was performed using universal primers 27F and 1492R. The sequences were, 27F: 5-AGAGTTTGATCCTGGCTCA G-3; 1492R: 5-GGTTACCTTGTTACGACTT-3;

[0094] The 16S rDNA sequence obtained is as follows:

[0095] GTCGAGCGGAAACGAGTTAACTGAACCTTCGGGGGACGTTAACGGCG

[0096] TCGAGCGGCGGACGGGTGAGTAATGCCTAGGAAATTGCCCTGATGTGGGG

[0097] GATAACCATTGGAAACGATGGCTAATACCGCATGATGCCTACGGGCCAAA

[0098] GAGGGGGACCTTCGGGCCTCTCGCGTCAGGATATGCCTAGGTGGGATTAG

[0099] CTAGTTGGTGAGGTAAGGGCTCACCAAGGGCGACGATCCCTAGCTGGTCTG

[0100] AGAGGATGATCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGG

[0101] GAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCA

[0102] TGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGTCGTGA

[0103] GGAAGGTAGAGGGGTTAATAGATGCATTATTTGACGTTAGCGACAGAAGA

[0104] AGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCGAG

[0105] CGTTAATCGGAATTACTGGGCGTAAAGCGCATGCAGGTGGTTTGTTAAGTC

[0106] AGATGTGAAAGCCCGGGGCTCAACCTCGGAATAGCATTTGAAACTGGCAG

[0107] ACTAGAGTACTGTAGAGGGGGGTAGAATTTCAGGTGTAGCGGTGAAATGC

[0108] GTAGAGATCTGAAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAGATA

[0109] CTGACACTCAGATGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTG

[0110] GTAGTCCACGCCGTAAACGATGTCTACTTGGAGGTTGTGGCCTTGAGCCGT

[0111] GGCTTTCGGAGCTAACGCGTTAAGTAGACCGCCTGGGGAGTACGGTCGCA

[0112] AGATTAAAACTCAAATGAATTGACGGGGGCCCGCACAAGCGGTGGAGCAT

[0113] GTGGTTTAATTCGATGCAACGCGAAGAACCTTACCTACTCTTGACATCCAG

[0114] AGAACTTTCCAGAGATGGATTGGTGCCTTCGGGAACTCTGAGACAGGTGC

[0115] TGCATGGCTGTCGTCAGCTCGTGTTGTGAAATGTTGGGTTAAGTCCCGCAA

[0116] CGAGCGCAACCCTTATCCTTGTTTGCCAGCGAGTAATGTCGGGAACTCCAG

[0117] GGAGACTGCCGGTGATAAACCGGAGGAAGGTGGGGACGACGTCAAGTCA

[0118] TCATGGCCCTTACGAGTAGGGCTACACACGTGCTACAATGGCGCATACAG

[0119] AGGGCGGCCAACTTGCGAAAGTGAGCGAATCCCAAAAAGTGCGTCGTAGT

[0120] CCGGATTGGAGTCTGCAACTCGACTCCATGAAGTCGGAATCGCTAGTAATC

[0121] GTGGATCAGAATGCCACGGTGAATACGTTCCCGGGCCTTGTACACACCGC

[0122] CCGTCACACCATGGGAGTGGGCTGCAAAAGAAGTAGGTAGTTTAACCTTC

[0123] GGGGGGACGCTT

[0124] The sequence was compared by BLAST and found to be highly homologous to multiple Vibrio.sp strains, with a similarity of 99.79% to ATCC 14048 and 99.72% to CCUG 16373. The phylogenetic tree of GZUAS951015 was constructed using MEGAⅩ software and it was found that strain GZUAS951015 was close to ATCC 14048 and CCUG 16373 (see Figure 7 Based on the morphological, physiological and biochemical characteristics of the strain and the results of 16S rDNA sequence comparison, it was identified as Vibrio natriegens.

[0125] Experimental Example 3: Functional verification of Vibrio natriuresis

[0126] (1) The strain Vibrio natriegens GZUAS951015 was removed and activated, and a well-growing colony was picked with a sterile inoculation loop and placed in 2216E liquid culture medium, and cultured in a shaking flask at 30°C and 180 rpm for 6 hours for later use.

[0127] (2) Inoculate the fermentation medium at an inoculum rate of 0.5% (v / v), culture at 30°C and 180 r / min with shaking for 72 h, take the fermentation broth and centrifuge at 10,000 rpm and 4°C for 105 min. The supernatant is the crude enzyme solution.

[0128] (3) Take 1 mL of crude enzyme solution in a test tube, keep it at 40℃ for 5 min, add 1 mL of 1% soluble starch solution (preheated to 40℃ in advance), react at 40℃ for 10 min, add 2 mL of DNS reagent, boil in water for 5 min, cool to room temperature and adjust the volume to 25 mL, measure the absorbance at 540 nm and calculate the enzyme activity, and calculate the amount of reducing sugar produced by the standard curve using a maltose mass meter. Enzyme activity unit (U): The amount of enzyme required to catalyze the production of 1 μmol of reducing sugar per minute is one enzyme activity unit.

[0129] 1) Fermentation medium formula: 10g peptone, 10g soluble starch, 20g NaCl, dissolved in 1000mL distilled water, pH natural, sterilized at 121℃ for 20min. The medium is simple, easy to obtain and low in cost.

[0130] 2) After the activation of Vibrio natriegens GZUAS951015 strain, inoculate it into the seed culture medium, culture it at 30℃180r for 48h, inoculate it into the fermentation medium at a 0.5% inoculum, culture it at 30℃180r for 3d, centrifuge it at 4℃10000r for 5min, and measure the enzyme activity of the supernatant by DNS method. The reaction phenomenon of DNS method for measuring enzyme activity is shown in Figure 8 .

[0131] Results: The enzyme activity was 375.25±34U / mL, indicating that the amylase produced by Vibrio natriegens GZUAS951015 strain was high in yield; the amylase could maintain a high activity in the pH range of 4.0-10.0 (see Fig. 9 ), indicating that the amylase produced by Vibrionatriegens GZUAS951015 strain has a wide pH adaptability range.

[0132] Experimental Example 4 Salt tolerance test of strains

[0133] Using seawater as raw material.

[0134] 1. Take out the strain Vibrio natriegens GZUAS951015 from -80℃ and activate it. Use a sterilized inoculation loop to pick up well-growing colonies in 2216E liquid culture medium and culture them in a shaking flask at 30℃ and 180r for 6 hours for later use.

[0135] 2. Prepare fermentation medium with concentrations of 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, and 8%, and dispense into 250mL conical flasks with a volume of 100mL per bottle. Sterilize at 121℃ for 20min for later use.

[0136] 3. Inoculate the activated strain into the fermentation medium at a rate of 0.5%, and culture in a shaking flask at 30°C and 180r for 3 days.

[0137] 4. Determine the OD value of the bacterial solution under different NaCl concentration conditions. (The results are shown in Fig.10 )

[0138] Results: The strain Vibrio natriegens GZUAS951015 is a marine bacterium with high salt tolerance and can be used for salinized soil remediation. The experimental data showed that it grew vigorously in a 2%-7% NaCl environment (see Fig.10 ), and maintain a high enzyme activity. This shows that the experimental method uses seawater as raw material during fermentation, which can not only reduce the cost of raw materials, but also reduce the risk of contamination during the fermentation process, thereby improving economic benefits and efficiency.

[0139] Although the present invention has been described in detail above by means of general description, specific implementation methods and experiments, it is obvious to those skilled in the art that some modifications or improvements can be made to the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A high-yield amylase-demanding vibrio natrium, characterized in that: The Vibrio natriegens is named Vibrio natriegens GZUAS951015, and has been deposited in Guangdong Microbiological Culture Collection Center with the deposit number: GDMCC No: 63888.

2. Use of the high-yield amylase-producing Vibrio natriuresis as claimed in claim 1 in producing amylase.

3. The use according to claim 2, characterized in that: The pH value range in which the produced amylase can maintain a relatively high activity is: pH 4.0-10.0.

Images