A fluorescent quantitative PCR detection method for specific detection of Trichoderma harzianum

Abstract

The invention discloses a detection method for specifically detecting Trichoderma harzianum based on SYBR Green dye method fluorescence quantitative PCR technology, the main contents of which are to extract total DNA of microorganisms in a sample to be tested, screen chit33 gene fragments that can be used for specific primer design through whole genome comparison, design specific primers ThspF / ThspR; optimize and establish a fluorescence PCR detection reaction system and reaction procedure, and determine the detection result according to the CT value and amplification curve. The fluorescence PCR detection method provided by the invention can quickly detect Trichoderma harzianum in a sample, the method is simple, accurate, and has good application value.

Description

Technical Field

[0001] The invention belongs to the field of biological pesticides or microorganisms, and particularly relates to a fluorescent quantitative PCR detection method for specifically detecting Trichoderma harzianum. Background Art

[0002] Microorganisms widely present in nature are a treasure trove of resources with great development potential and are closely related to humans. Currently, microbial products are widely used in many fields such as food, medicine, agriculture, and environmental protection. Since microorganisms are tiny, most species are difficult to observe with the naked eye, which limits the development and application of microorganisms. With the development of my country's microbial industry, the detection methods of microbial products are obviously insufficient, and it is urgent to establish a relevant microbial quality detection system.

[0003] Trichoderma harzianum is the most widely used microbial species. It has a high preventive effect on a variety of crop diseases, and also has the functions of decomposing agricultural waste, improving plant resistance, and promoting crop yields. Trichoderma harzianum is widely registered and used in microbial pesticides and fertilizers, but there are currently few detection technologies for Trichoderma harzianum, and the existing technologies have disadvantages such as long detection cycles and large errors.

[0004] Existing detection technologies for Trichoderma harzianum are mostly based on spore morphology. Trichoderma harzianum spores are very similar to other Trichoderma species, making detection difficult and causing large errors. The development of molecular detection technology for detecting Trichoderma harzianum can make up for the shortcomings of existing detection technologies.

[0005] The existing molecular detection technology for Trichoderma harzianum mainly uses conventional PCR. After the microbial DNA in the sample is extracted, PCR is performed using specific primers. The PCR product also needs to be subjected to agarose gel electrophoresis and the specific bands are observed under a gel imager. This method has a long detection cycle and is time-consuming and labor-intensive.

[0006] The existing fluorescent PCR detection of Trichoderma harzianum can only detect Trichoderma fungi or one of its strains, but cannot detect all strains of Trichoderma harzianum, which limits the scope of application.

[0007] The reported method for applying the fluorescence detection technology of Trichoderma harzianum is the probe-based fluorescence quantitative PCR technology. In addition to specific primers, the system also requires probe primers.

[0008] The currently disclosed detection systems for Trichoderma harzianum mainly include microscope counting, conventional PCR, and TaqMan probe fluorescent PCR, which have problems such as large errors, low efficiency, long cycles, and large amounts of detection reagents. Among them, the disclosed fluorescent PCR method can only detect Trichoderma fungi or one of its strains, but cannot detect all strains of Trichoderma harzianum.

[0009] In summary, it is necessary to establish an efficient, accurate and economical Trichoderma harzianum detection system. Summary of the invention

[0010] Based on the technical problems existing in the technical background, the present invention provides a fluorescent quantitative PCR detection method for specifically detecting Trichoderma harzianum.

[0011] To achieve the above purpose, the present invention adopts the following technical solution:

[0012] A fluorescent quantitative PCR detection method for specifically detecting Trichoderma harzianum, using ThspF / ThspR as specific primers, and performing qualitative detection of Trichoderma harzianum according to CT value and amplification curve through fluorescent PCR detection;

[0013] ThspF:GGGTGTGTTCGTCCACTCAT, ThspR:

[0014] GTCGGGGAAAAGGCTCAAGA.

[0015] The detection group had a Ct value of ≤40 and an exponential amplification curve; the control group had a Ct value of >40 and no exponential amplification curve appeared, and the detection group was determined to be positive.

[0016] Specifically:

[0017] A. Use the CTAB method to extract the microbial DNA in the sample to be tested;

[0018] B. Use ThspF / ThspR as specific primers;

[0019] C. The reaction system was 20 μl, including 2×ChamQ Universal SYBR qPCR Master Mix, DNA working solution, ThspF (10 μM), ThspR (10 μM), and ddH2O;

[0020] D. The reaction procedure was 95°C pre-denaturation for 1 min, 94°C denaturation for 30 s, 56°C-60°C annealing for 30 s, 72°C extension for 30 s, and denaturation, annealing and extension were repeated for 40 cycles;

[0021] E. Result judgment standard: The Ct value of the test group is ≤40, and an exponential amplification curve appears; the Ct value of the control group is >40, and no exponential amplification curve appears, and the test group is judged to be positive.

[0022] A kit for detecting Trichoderma harzianum, the kit containing specific primers ThspF / ThspR.

[0023] The advantages of the present invention are:

[0024] The invention is based on the SYBR Green dye method fluorescence PCR technology of Trichoderma harzianum detection system, designs specific primers based on the chitinase gene chit33 gene, and establishes the SYBR Green dye method fluorescence PCR detection technology of Trichoderma harzianum by optimizing the reaction program. The result is directly determined according to the Ct value and the amplification curve without the need for electrophoresis. The technology has the advantages of short detection cycle, reagent saving, small error, etc., and provides quality evaluation and detection technology for the development and application of Trichoderma harzianum products. It also provides an efficient detection technology for the quality control of biological pesticides with Trichoderma harzianum as the main active microorganism, and has good application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 1 is a schematic diagram of the specific dissolution curve of the detection system designed by the present invention, wherein ① is the target detection sample, ②③④⑤⑥⑦⑧⑨⑩ are the control strains, wherein ①: Trichoderma harzianum; ②: Trichoderma longibrachiatum; ③: Trichoderma virens; ④: Paecilomyces lilacinus; ⑤: Aspergillus niger; ⑥: Aspergillus flavus; ⑦: Penicillium chrysogenum; ⑧: Penicillium oxalicum; ⑨: Alternaria alternata; ⑩: Fusarium oxysporum.

[0026] Figure 2 1 is a schematic diagram of the specific amplification curve of the detection system designed by the present invention, wherein ① is the target detection sample, ②③④⑤⑥⑦⑧⑨⑩ are the control strains, wherein ①: Trichoderma harzianum; ②: Trichoderma longibrachiatum; ③: Trichoderma virens; ④: Paecilomyces lilacinus; ⑤: Aspergillus niger; ⑥: Aspergillus flavus; ⑦: Penicillium chrysogenum; ⑧: Penicillium oxalicum; ⑨: Alternaria alternata; ⑩: Fusarium oxysporum.

[0027] Figure 3 It is a schematic diagram of the sensitivity dissolution curve of the detection system designed in the present invention, wherein ①②③④⑤⑥ are 10μg / ml, 10ng / ml, 100pg / ml, 10pg / ml, 100fg / ml and 10fg / ml respectively.

[0028] Figure 4 It is a schematic diagram of the sensitivity amplification curve of the detection system designed by the present invention, wherein ①②③④⑤⑥ are 10μg / ml, 10ng / ml, 100pg / ml, 10pg / ml, 100fg / ml and 10fg / ml respectively.

[0029] Figure 5 It is a schematic diagram of amplification curves of the detection system designed by the present invention for detecting four types of Trichoderma harzianum samples, wherein ①: 200 million spores / g wettable powder A; ②: 300 million spores / g wettable powder; ③: 100 million spores / g water dispersible granules; ④: 300 million spores / g wettable powder B.

[0030] Figure 6It is a schematic diagram of the dissolution curve of four samples of Trichoderma harzianum detected by the detection system designed by the present invention, wherein: ①: 200 million spores / g wettable powder A; ②: 300 million spores / g wettable powder; ③: 100 million spores / g water dispersible granules; ④: 300 million spores / g wettable powder B. DETAILED DESCRIPTION

[0031] The specific implementation modes of the present invention are further described below in conjunction with examples. It should be noted that the specific implementation modes described here are only for illustrating and explaining the present invention, and are not limited to the present invention.

[0032] Example 1

[0033] Determination of Trichoderma harzianum-specific primers:

[0034] Based on the comparison of the whole genome sequence of Trichoderma harzianum with other microorganisms, the chitinase gene (chit33) was selected as the target fragment, and specific primers suitable for fluorescent PCR detection of Trichoderma harzianum were designed. The target fragments are as follows:

[0035] GATATCCATGGATGCTTACGTGGGGGAACGCAGAGTGGGAGAAGGAT

[0036] CACGGTTGAGTGTATTTGAGAGCAGTACGAGATAACTCAATAGAAGC

[0037] AAACACACTGTCTAGCATTAATCTCAATTAGATCAGCAAGATCGATCT

[0038] GGAGAAGCAATCACCCATCACGCGCATCACCACGTCCAACTACCTA

[0039] CACCGGTTAGCCGCCCATCACCACCAACGAGCCGCCGGATCTCTCTCC

[0040] AGCCTTGAATCTCTCCGAGGCCGACTCACTCACCCCGCAGCACATCTT

[0041] CAACGGTACTTGAGGGTATCATTTCGGAATCACTATTGGTTCCTCTCCAT

[0042] ATCCTACCTAGGAGAGAAGGAGAGTGAATAAGCGGTGCTTTTCAATTA

[0043] TACCTTGCTCACCTCTCCCACGTGAGCGCCGATGACACCCGATAATAG

[0044] TAGTAGTTTTTACATGCTTCCCCACGATAAAGTCAAACCGTGTTAAA

[0045] GAAACGCACAGTCCAGAGTTTATCCTAACTATTAGGGGCATCCCTG

[0046] CGGCGGTCCTTCTGCAGGGGTGTGTTCGTCCACTCATGAAGCATCTCC

[0047] GTGCTCTCTATGCCGAAGCGGGAAGCTCATATGCTGAGGGAGGGCTA

[0048] ACCATAGCGATACGCTTCTTGAGCCTTTTCCCCGACTGGTGGGATGTAT

[0049] CCTCTTTAAGTGCTTACTTTGCGCTTAAAGATGAAAAGAATTGAAAGC

[0050] AAGTTTTTGGTATTGTTTGCCGTAATAACTGCTCTGATACTCTTTCTTTAT

[0051] TGATGTTACCGTTGCAGAGGTGATTATGGTGCATCGCGTGGAGATGCC

[0052] ACGATGAGAGGGAATCAGCCGCAATCCTTCTTTGTTTGCGAGGCCACG

[0053] GCTGGCTGTGGTAGTCGGCTAGATACACTCTGACGACGTGTGTTGTGC

[0054] AACTCAAGCTCGCCGAACAAAGTTGATCATCTAGGATCATTTCAGTCT

[0055] CATACATGAACACCGAATTTGATGATGTCTGAGCTTAACCGGTGCTCA

[0056] ATTACACGCACCCTGTCTAGGCCTCCATGAAGGTTCATTCATATTGATC

[0057] AACTCTATTTGCACTAGCTTGGATGTTTGAACCCATCCATGCCATAATA

[0058] TGGAATCTTACTCAAAATCGGGTGTTTGGATGCTGCCCAAGTAGGTAG

[0059] GAGGTTGTCACACCCTGGTTCCTCCACAAACCTTACATGTACATACAT

[0060] GATGAAGACAGGTCATGATCCTCAATCCTCCAATCAGATCTTGGTATAT

[0061] GTTTCCCCCGCGAATGGCCCTGGTTTACTTTTGTCTCTCACGATTCTTG

[0062] GGTATCATCATCATGTACATGAACACATAATACTCGCATGCAAACACAT

[0063] CCTCTTATCACCATTGACAAGCTGCGTTCCCTATGTATAGATGGCAAGA

[0064] TATACGCTGGAGGCATCCAATTACCAACACGGTAGATATACCGAGGCA

[0065] CGATGAGCGAGTATAATGCGTACAAAGCGGTAAAGATTAAGCGACTTT

[0066] GACTGTACCACTGAGTACATAGCCATCCGAGCACATGTATGTCATGTC

[0067] AAAACCCCTGATGTTTCGGGGCCTTGACTAACCTACCTGTCTCGGCAC

[0068] ACTCGTCCAGATGCGACCAACCTTCTTCTTTGCTACCTTGAGCATTAAT

[0069] GGATCATGTCACCTAGCGAAGTCTCTATAGCTAACCACTGCATAGATCT

[0070] CAACCGATAACGTCCTTCAAAAGCCGATATAGTGAGCCGATGGGGCTA

[0071] TTACTGACGCCGACACTCCTCTATACCTTCTCAGTTAAAGGTAGCATG

[0072] GCTCCATCACGAGTTCATCATGACCCCCGTTTCGCCTCGTCCCTTCGCC

[0073] CGGCGGCAAGCGCAAAGAAGTTCCAATGCCACGTATGCTCAGAAACC

[0074] TGATGTAGCATCGTGTAAGAGAGCGGGGGAATATTCCTCCCCATTGCT

[0075] CTTACATGTTCAACTTGAGAGAGGATATAAAAAGCTCTTGGTCCGACC

[0076] CTGTGAGGTGGCACGCTGCTTGTTCGTCATCAAAAACATATTCGTTTC

[0077] GGATCCGATAGCCTCAGCATCCCTATAGCCAGGATG

[0078] Primer:

[0079] ThspF:GGGTGTGTTCGTCCACTCAT

[0080] ThspR:GTCGGGGAAAAGGCTCAAGA

[0081] Example 2

[0082] Total DNA extraction of sample microorganisms, taking Trichoderma harzianum as an example:

[0083] Accurately weigh 0.05 g of dried mycelium and place it in a 2 ml centrifuge tube. Add 0.4 g of sterile quartz sand and grind with liquid nitrogen. Add 500 μl CTAB extract and 10 μl β-mercaptoethanol were mixed, incubated at 65°C for 30 min, inverted 3 times during the period, centrifuged at 12000 r / min for 10 min, supernatant was taken, and water bathed at 37°C for 1 h; 24 anhydrous ethanol and potassium acetate KAC (5 mol / L) were added, mixed, ice bathed for 1 h, 500 μl chloroform isoamyl alcohol was added, mixed and centrifuged at 12000 r / min for 10 min, and supernatant was taken; 500 μl phenol / chloroform / isoamyl alcohol was added, mixed, centrifuged at 12000 r / min for 10 min, and supernatant was extracted again with 500 μl chloroform isoamyl alcohol; 500 μl isopropanol was added to the supernatant, and precipitated at -20°C for 60 min; centrifuged at 12000 r / min for 10 min, supernatant was discarded, and the precipitate was washed with 75% ethanol, dried in an ultra-clean workbench, and redissolved in 20 μl TE buffer. That is, the Trichoderma harzianum DNA working solution to be detected is obtained.

[0084] Then, DNA working solutions of Trichoderma longibrachiatum, Trichoderma virens, Paecilomyces lilacinus, Aspergillus niger, Aspergillus flavus, Penicillium chrysogenum, Penicillium oxalicum, Alternaria alternata, and Fusarium oxysporum were obtained according to the above method (all strains are commercially available), and then the specificity of the detection system was determined;

[0085] The reaction system was 20 μl, including 2× ChamQ Universal SYBR qPCR Master Mix, DNA working solution, ThspF (10 μM), ThspR (10 μM), and ddH2O;

[0086] The reaction program was pre-denaturation at 95°C for 1 min, denaturation at 94°C for 30 s, annealing at 56°C–60°C for 30 s, and extension at 72°C for 30 s, with denaturation, annealing, and extension repeated for 40 cycles;

[0087] Result judgment criteria: The test group Ct value ≤ 40, and an exponential amplification curve appeared; the control group Ct value > 40, and no exponential amplification curve appeared, and the test group was judged to be positive.

[0088] The melting curve of the target test sample of this detection system has a single peak, the TM value is between 83 and 84, and the characteristic peak is obvious, which proves that the product is single and the primer is highly specific; the melting curve of the control strain is wavy and no single peak appears. The test results are shown in Figure 1The Ct value of the target test sample of the detection system was 27.46, which was less than 40, and the amplification curve had obvious exponential amplification characteristics, proving that the detection system can effectively detect Trichoderma harzianum; the Ct values ​​of the control strains were 46.34, 46.02, 45.95, 47.17, 46.42, 47.59, 48.08, 49.29, and 47.79, all greater than 40, and no amplification curve with exponential amplification characteristics appeared. The test results are shown in Figure 2 .

[0089] Example 3: Determination of the sensitivity of the detection system

[0090] The Trichoderma harzianum DNA working solution obtained in Example 2 was diluted with TE buffer to 10 μg / ml, 10 ng / ml, 100 pg / ml, 10 pg / ml, 100 fg / ml and 10 fg / ml for the detection system, respectively.

[0091] Then, fluorescence PCR detection was performed using the detection system, which consisted of 20 μl, including 2×ChamQUniversal SYBR qPCR Master Mix, DNA working solution, ThspF (10 μM), ThspR (10 μM), and ddH2O;

[0092] The reaction program was pre-denaturation at 95°C for 1 min, denaturation at 94°C for 30 s, annealing at 56°C–60°C for 30 s, and extension at 72°C for 30 s, with denaturation, annealing, and extension repeated for 40 cycles;

[0093] Single-peak dissolution curves appeared in all treatments with different concentrations, indicating that the target microorganisms could be detected in all six concentrations. Figure 4 The Ct values ​​of the detection system for 10μg / ml, 10ng / ml, 100pg / ml, 10pg / ml, 100fg / ml, and 10fg / ml were 27.39, 26.53, 28.07, 28.24, 26.28, and 26.11, respectively. The exponential amplification curves appeared in the different concentration treatments, indicating that the target microorganisms could be detected in the six concentration treatments. The test results are shown in Figure 5 .

[0094] Example 4 Detection of commercially available samples by the detection system

[0095] Fluorescence PCR detection was performed on different commercially available Trichoderma harzianum-containing agents using the detection system, which consisted of 20 μl of 2×ChamQ Universal SYBR qPCR Master Mix, DNA working solution, ThspF (10 μM), ThspR (10 μM), and ddH2O;

[0096] The reaction program was pre-denaturation at 95°C for 1 min, denaturation at 94°C for 30 s, annealing at 56°C–60°C for 30 s, and extension at 72°C for 30 s, with denaturation, annealing, and extension repeated for 40 cycles;

[0097] In this example, four different commercially available Trichoderma harzianum-containing agents were tested: ① 200 million spores / g, wettable powder, Shanghai Wanlihua Biotechnology Co., Ltd.; ② 300 million spores / g A, wettable powder, American Biotechnology Co., Ltd.; ③ 100 million spores / g, water dispersible granules, Chengdu Tepu Biotechnology Co., Ltd.; ④ 500 million spores / g B, wettable powder, American Biotechnology Co., Ltd.

[0098] Depend on Figure 5 It can be seen that the Ct values ​​of the system for the four test samples were 27.63, 28.38, 28.69, and 28.94, all less than 40, and the amplification curve had obvious exponential amplification characteristics. Figure 6 It can be seen that the dissolution curves of the four test samples have single peaks, TM values ​​are between 85 and 87, and the characteristic peaks are obvious, indicating that the detection system designed in the present invention can be applied to the specific detection of Trichoderma harzianum.

Claims

1. A fluorescent quantitative PCR detection method for specifically detecting Trichoderma harzianum, characterized in that: Using ThspF and ThspR as specific primers, fluorescent PCR was used to qualitatively detect Trichoderma harzianum according to the CT value and amplification curve. ThspF: GGGTGTGTTCGTCCACTCAT, ThspR: GTCGGGGAAAAGGCTCAAGA; A. Use the CTAB method to extract the microbial DNA in the sample to be tested; B. ThspF and ThspR were used as specific primers; C. The reaction system is 20 μL, including 2×ChamQ Universal SYBR qPCR Master Mix, DNA working solution, 10 μM ThspF, 10 μM ThspR, and ddH2O; D. The reaction procedure was 95°C pre-denaturation for 1 min, 94°C denaturation for 30 s, 56°C-60°C annealing for 30 s, 72°C extension for 30 s, and denaturation, annealing and extension were repeated for 40 cycles; E. Result judgment standard: The Ct value of the test group is ≤40, and an exponential amplification curve appears; the Ct value of the control group is >40, and no exponential amplification curve appears, and the test group is judged to be positive.

2. A kit for detecting Trichoderma harzianum, characterized in that: The kit contains the specific primers ThspF and ThspR described in claim 1.

Images