RPA primer set, kit and application for endothelial herpes simplex virus

Abstract

The present invention relates to an RPA primer set, a kit and an application for endothelial herpes simplex virus, and relates to the technical field of virus detection. The primer set comprises: an upstream primer: 5'-GTACCTATAATGGAGGCCGAAAAGACAGCTAT-3' (SEQ ID NO: 2); a downstream primer: 5'-AACCGTAATGTATCTCGTCACCCCGCCATCTG-3' (SEQ ID NO: 7). The primer set can be used to achieve specific, stable, sensitive and efficient detection of endothelial herpes simplex virus, can be applied to grassroots on-site detection, and has important value in endothelial herpes simplex virus.

Description

Technical Field

[0001] The present invention relates to the technical field of virus detection, in particular to an RPA primer set, a kit and an application thereof for endothelial herpes simplex virus. Background Art

[0002] The Asian elephant (Elephas maximus) is a globally endangered species and a first-class protected animal in my country. There are only about 250 of them in China. Various disturbances such as habitat loss and fragmentation, human-elephant conflict, and illegal poaching have made the living environment of Asian elephants increasingly severe, causing their population to decline continuously. The emergence of infectious diseases has brought new challenges to the already difficult conservation of Asian elephants. Infection with elephant endotheliotropic herpesviruses (EEHV) can cause systemic hemorrhagic disease, resulting in acute death of elephants with a very high mortality rate. It is one of the main factors threatening the sustainable development of Asian elephant populations, especially captive populations.

[0003] The commonly used laboratory molecular detection methods for herpes virus include ordinary PCR and real-time fluorescence quantitative PCR. The above methods have higher requirements on laboratory equipment and professional skills of researchers, and detection methods such as PCR require a time of about 4 hours, and factors such as false positives or unsuccessful sequencing may occur, resulting in detection errors or no results. However, the herpes simplex virus is fatal to young elephants. The disease develops rapidly and quickly, and the elephant may die before the laboratory diagnosis results are obtained. This is very unfavorable for the clinical prevention and control of the herpes simplex virus, and the herpes simplex virus has different genotypes, which may cause the virus to mutate. Therefore, it is urgent to develop a method for rapid detection of the herpes simplex virus, which is of great significance for the protection of Asian elephants. Summary of the invention

[0004] In view of the above problems, the present invention provides an RPA primer set for endothelial herpes simplex virus. The primer set can achieve specific, stable, sensitive and efficient detection of endothelial herpes simplex virus, can be applied to grassroots on-site detection, and has important value in endothelial herpes simplex virus.

[0005] In order to achieve the above object, the present invention provides a RPA primer set for herpes endotheliophilus, the primer set comprising:

[0006] Upstream primer: 5'-GTACCTATAATGGAGGCCGAAAAGACAGCTAT-3' (SEQ ID NO: 2);

[0007] Downstream primer: 5'-AACCGTAATGTATCTCGTCACCCCGCCATCTG-3' (SEQ ID NO: 7).

[0008] Recombinase polymerase isothermal amplification technology (RPA) is a isothermal amplification technology involving recombinase, single-stranded DNA binding protein and strand displacement DNA polymerase. Amplification can be completed in 20-30 minutes at 37°C-42°C. It has the advantages of strong specificity, higher sensitivity than PCR, simple operation, and low requirements for instruments and equipment. Therefore, the inventors proposed to use RPA technology to detect herpes simplex virus, and use the GB gene sequence of herpes simplex virus as the amplification target sequence to design the primer sequence. However, the inventors found in the research process that any primer sequence that does not use the GB gene sequence as the amplification target sequence can achieve good amplification and detection effects. After experimental screening, the inventors proposed the above-mentioned RPA primers. The above-mentioned primer group can achieve specific, stable, sensitive and efficient detection of herpes simplex virus, can be applied to grassroots on-site detection, and has important value in herpes simplex virus.

[0009] The present invention also provides the use of the RPA primer set in preparing a reagent and / or a kit for detecting E. endotheliotropic herpes virus.

[0010] The present invention also provides a kit for detecting E. endotheliotropic herpes virus, the kit comprising an RPA system, and the RPA system comprises the RPA primer set.

[0011] In one embodiment, the working concentration of the RPA primer set is 0.4-0.55 μM.

[0012] The working concentration is the concentration at which the above-mentioned primer set can achieve the expected effect when used. It can be understood that when preparing products containing the above-mentioned primer set, those skilled in the art can prepare a mother solution or a reserve solution with a higher concentration, and then dilute it when it is used. The mother solution or the reserve solution and its concentration are all within the protection scope of the present invention.

[0013] In one embodiment, the RPA system further includes a recombinase, a single-stranded binding protein, and a DNA polymerase.

[0014] The present invention also provides a non-diagnostic method for detecting endotheliotropic herpes simplex virus, comprising the following steps: extracting DNA from a sample to be tested, and performing RPA reaction using the kit.

[0015] In one embodiment, the reaction conditions of the RPA reaction include: mixing the RPA system, amplifying at 37-40° C. for 3-7 min, mixing, centrifuging, amplifying at 37-40° C. for 20-30 min, and terminating the reaction.

[0016] The kit containing the above primer set is combined with the RPA amplification method to specifically amplify the GB gene sequence. The constructed method for detecting herpes simplex endothelioma virus is simple, rapid, accurate and less invasive. The electrophoresis bands determined by the results are clear and bright, and the time consumption is shorter than that of conventional PCR. The appearance of an electrophoresis band at 250bp indicates that the sample to be tested contains herpes simplex endothelioma virus.

[0017] In one embodiment, the sample to be tested includes blood and / or liver tissue.

[0018] In one embodiment, the sample to be tested is taken from an Asian elephant or an African elephant.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The RPA primer set, kit and application for elephant endothelial herpesvirus of the present invention can detect Asian elephant or African elephant endothelial herpesvirus infection quickly, accurately and less invasively with a small amount of blood or liver tissue, and the minimum detection limit is 2×10 -1 The whole process does not rely on expensive precision instruments, takes a short time, and the identification results are accurate and practical. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The electrophoresis diagram of the amplification effect of some primer sets detected by RPA; M is DL2000 DNA Marker; 1, 2, 3, 4, 5, and 6 use E. endothelioma virus-positive DNA as template, and 7 uses ddH2O as template; 1 is the amplification result of the F1 / R1 primer set; 2 is the amplification result of the F1 / R2 primer set; 3 is the amplification result of the F2 / R3 primer set; 4 is the amplification result of the F2 / R4 primer set; 5 is the amplification result of the F3 / R4 primer set; 6 is the amplification result of the F4 / R4 primer set; 7 is the negative control.

[0022] Figure 2 This is the optimal reaction temperature screening diagram for RPA detection; M is DL2000 DNA Marker; 1, 2, 3, 4, 5 use E. endothelioma virus-positive DNA as template, and F1 / R2 combination as amplification primers; 1 is the amplification result at 30℃, 2 is the amplification result at 35℃, 3 is the amplification result at 37℃, 4 is the amplification result at 39℃, and 5 is the amplification result at 42℃.

[0023] Figure 3The results of electrophoresis for the sensitivity of RPA detection of endothelial herpes simplex virus; M is DL2000 DNAMarker; 1 is 2×10 5 copies / μL E. endothelial herpes virus-positive DNA was used as template; 2×10 4 copies / μL E. endothelial herpes virus-positive DNA was used as template; 3 using 2×10 3 copies / μL E. endothelial herpes virus-positive DNA was used as template; 4 using 2×10 2 copies / μL E. endothelial herpes virus-positive DNA was used as template; 5 using 2×10 1 copies / μL E. endothelial herpes virus-positive DNA was used as template; 6 used 2×10 0 copies / μL E. endothelial herpes virus-positive DNA was used as template; 7 used 2×10 -1 copies / μL E. endothelial herpes virus-positive DNA was used as template; 8 using 2×10 -2 copies / μL of EHV-positive DNA was used as template. 1, 2, 3, 4, 5, 6, 7, and 8 all used the F1 / R2 combination as amplification primers.

[0024] Figure 4 The electrophoresis results of repeated detection of E. endothelioma virus RPA repeatability test within the batch; M is DL2000DNA Marker; 1-8 repeated within the batch, the same sample was tested at the same time, and the F1 / R2 combination was used as the amplification primer and E. endothelioma virus positive DNA was used as the template.

[0025] Figure 5 Figure 9 is the electrophoresis result of repeated detection of EHV RPA among batches; M is DL2000 DNA Marker; 9-16 are the same samples, which were tested every 2 days, using F1 / R2 combination as amplification primers and EHV positive DNA as template.

[0026] Figure 6The results of specific electrophoresis of RPA for herpes simplex virus; M is DL2000 DNA Marker; 1 uses human herpes virus HSV-1 positive DNA as template; 2 uses pseudorabies virus positive DNA as template; 3 uses mouse herpes virus positive DNA as template; 4 uses human herpes virus (HSV-2) positive DNA as template; B uses turkey herpes virus (HVT) positive DNA as template; C uses avian Marek's virus (MDV) positive DNA as template; "+" uses elephant endothelial herpes virus positive DNA as template; "-" uses ddH2O as template. 1, 2, 3, 4, B, C, +, and - all use F1 / R2 combination as amplification primers.

[0027] Figure 7 The results of RPA electrophoresis of clinical samples of elephant endothelial herpesvirus; M is DL2000 DNAMarker; 1 uses elephant endothelial herpesvirus-positive DNA as template; 2 uses the DNA of clinically symptomatic Asian elephant blood sample (YZX56) as template; 3 uses the DNA of African elephant liver tissue sample (YZX515) preserved in the Guangzhou Zoo sample bank as template; 4 uses the DNA of randomly collected elephant blood sample preserved in the Guangzhou Zoo sample bank; 5 uses ddH2O as template; 1, 2, 3, 4, 5 all use F1 / R2 combination as amplification primers.

[0028] Figure 8 It is the electrophoresis result of common PCR detection of clinical samples, where M is DL2000 DNA Marker; 1 is the DNA template of African elephant liver tissue sample (YZX515) stored in the sample bank of Guangzhou Zoo; 2 is the DNA template of randomly collected elephant blood sample stored in the sample bank of Guangzhou Zoo; 3 is the DNA of clinically symptomatic Asian elephant blood sample (YZX56); 4 is the DNA template of randomly collected elephant blood sample stored in the sample bank of Guangzhou Zoo; 1 and 2 use SEQ ID NO: 10 and SEQ ID NO: 11 as amplification primers; 3 and 4 use SEQ ID NO: 12 and SEQ ID NO: 13 as amplification primers. DETAILED DESCRIPTION

[0029] In order to facilitate the understanding of the present invention, the present invention will be described more fully below with reference to the relevant drawings. The preferred embodiments of the present invention are given in the drawings. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0031] Unless otherwise specified, the reagents, materials, and equipment used in this example are all commercially available; the experimental methods are all conventional experimental methods in the art unless otherwise specified.

[0032] Example

[0033] 1. Obtain the amplified target sequence.

[0034] Asian elephant liver tissue and other pathological materials were obtained from the Guangzhou Zoo Biobank, and the GB gene sequence of elephant endothelial herpesvirus was obtained by self-sequencing, as shown below.

[0035] The GB gene sequence of the EHV is as follows:

[0036] ATGTCATTTACGGATCAGACATATACTCGATCCTGTATGCACACATGCATCACGCATG

[0037] ATCCTCGTGTTTACCGTATCGTTTTTGTTTTACTAATGCTACTGCTAGACAATAATAGTGTG

[0038] TTCTGTCAAAGCGAAATAAAGTGATCGAAATTAAAAAAGATGAAGAAATATGGCCTTA

[0039] TCGTATATGTTCGGGTATGTCACAAGCCACGGATATCGTCAGATTTGGTAGAAATGTACAA

[0040] TGTCCTGAATACTCGCCAAAGGACGAAGGTACCGAAGGTATTTTGCTCATCTATAAGCCA

[0041] AATATAGTTCCTTACATATTTCCCGTGAGAATCTATTATAAAGAACTTACGATTAGATACAG

[0042] ATACGCTGATGTTTTTTCATACTATGACATGGGAGATGTAACCAAAAAAGTACCTATAATG

[0043] GAGGCCGAAAAGACAGCTATAGACGCGTTCGGACACTGTTGGTCGGCCGCGAGGTATG

[0044] TTGAAAACGAGGCGTATATAGACGCGTATGATGGCGACGAGGCCAATCATACGGTGCCT

[0045] TTCATGCTCGGATACCAAAATCCAGATGGCGGGGTGACGAGATACATTACGGTTGATTCA

[0046] CACAGGCCGTGTTTGCCGGGTACATGGATACGGAAAACCTGTACGACGGTCAACTGTAT

[0047] CGTTACTGACACTATCGGAAAGTCTAGATACCCTTATGACTTTTTCGCAATATCCACGGG

[0048] GGAGATAGTGGACGGATCCCCCTTCTATAACGGTAAAAATAACAAAAAATTTTCAGAAC

[0049] CTTCTACAAAATTCAAGGTGTATAACGACTACGAGAGATTACAGGACCTGACTGTAACA

[0050] GTGTCTACTAAAAAGAAGACATTTCCTCAGATAGCGTTTCTCGAAAAAAGGGATTATAGT

[0051] ATTGCGTGGGAAGTCAAGGATGAACAGCAAGCGCCATGTCAATACGTCTTATGGAAAGC

[0052] CTCTACAGAAGCCCTCATGACAAAAACCGTAAACAAAACATATCATTTTACCTCACGAG

[0053] AGTTAACTGCTACTTTTGGGTCAGATGACAAAGAAGAGTTAAAATTAGCCGAAAAATAT

[0054] CCATGTGTTTATAAAGATGCGAAAGAAACGTTGGAAAAAATGTTTTCCCAAAATCTAAA

[0055] GGACACGCACGTGTTGGACACCGATAGCGATAAAAAAAATTATTCGTATATGAGTCAGG

[0056] GCGGATTAATACTTGTATTTCAACCCGTTAAAAACAAACAAGTTGTACAATTGATGAATA

[0057] TTACACATCTTTTGAATACTACGCATGCCAATGTAACAAGTCGACGAAGAAAAAGAGAC

[0058] GCGAATACTGCTAGCGCTAAGGGCATCTATGATTTGTATGCCGACTTAAACGTGGCGCAG

[0059] GTTCAATTTGCATTTAACACCCTCAGGACGTATATAAACCAGGCCTTGATGAGTATAGCC

[0060] GACGCGTGGTGTCGAGATCAAAAGAGAACTAATGAGATATGGGGAATAATAAGCAAGAT

[0061] CAACCCGTCTGCCGCACTGTCAGCCATATTCGATAAGCCTGTTTCGGCGCGTTATCTTGG

[0062] TGATGTAATATCGATCTCAAAATGTATCAATGTGGATCAGGAATCGGTTAGGATCTACCAG

[0063] AGCTTGAAAGTGCCTAAAACCGGAGAGGAATGGGGAGACCGGTTACAGTGCTACAGCA

[0064] GGCCCCTGGTAACGTTTAGATTAAATAACGAAACGGCGAGCACCGTGCGTACGGGACAG

[0065] TTGGGAACCGACAACGAGATCCTACTCGGTAACTATCGCACAGAACTATGTCAGGAGAA

[0066] CTCTATACGGTACTTTATAGCGGGACTGCAAATACACGTTTTTCAGGACCACGAGTTTTAT

[0067] CACACCATAAAGCTGCGAGACGTAGACATAGTTGATACCTTTGTGCATCTTAATATATCCT

[0068] TTTTACATAACATAGATTTTCAGATGCTGAGACTATATACTCAGGAGGAGCAGTACGCTTC

[0069] CAGGCTACTAGATTTAGAAACGTTATTGAGAGATTTTAACACGTACAGACAGAAGATCTA

[0070] TAAGTTGGAACAGGCCATAATAAGTAGGCCATATGTTCCCCCTGCTGGTATGCAACAAGC

[0071] ACTACAGGGTCTCACGGGCGTGGGCAATGTCATCACGGGTACCCTGGGGGCTATGCAAT

[0072] CACTGGTGTCTGGGGTAGCATCGTTTCTACAGAATCCTTTTGGGGGTACGCTTAGCATCA

[0073] TTCTTATTGGTTGCATCATAGTCGGAGTCATCATAATATATAATAGAATGAATCAATCCCGT

[0074] GGCAGTCCCATCGATTATTACTTCCCGTATGTTAATCAGACACTCCCACAGAGGCAGATG

[0075] CAACAACACGTGGGCGATCCACCCTCATATGAGGAGAGTACAGGAGGTTCCTCTACGTA

[0076] CTCAAAGGAGGATGCCCTGTCTATGTTAAAGGCTATGCAAGAGCTGGATAAATCTGAAA

[0077] AACAAGCTCAGATAGAAGCTGCGAAATCAGAACCTTCTATAATAGACCGCATACGGCGC

[0078] AGAGGATACACAGCGCTTAGGTCGATGAACGTTTAG (SEQ ID NO: 1)

[0079] 2. Primer screening for RPA detection of E. endothelial herpesvirus.

[0080] Multiple upstream primers and downstream primers were designed using the software oligo7.0. Some primer sequences are shown below. The four upstream primers and four downstream primers in Table 1 were combined into six primer pairs. Table 2 shows the PRA detection amplification system. Among them, the DNA template came from a DNA sample positive for E. endothelioma virus stored in the Guangzhou Zoo laboratory.

[0081] Table 1 Primer set for RPA detection of herpes simplex virus

[0082] Primer name Serial number Primer sequence (5'-3') F1 SEQ ID NO: 2 GTACCTATAATGGAGGCCGAAAAGACAGCTAT F2 SEQ ID NO: 3 GGTGTATAACGACTACGAGAGATTACAGGACC F3 SEQ ID NO: 4 GGGATTATAGTATTGCGTGGGAAGTCAAGGAT F4 SEQ ID NO: 5 CATGTCAATACGTCTTATGGAAAGCCTCTACA R1 SEQ ID NO: 6 TTTGGTATCCGAGCATGAAAGGCACCGTATGA R2 SEQ ID NO: 7 AACCGTAATGTATCTCGTCACCCCGCCATCTG R3 SEQ ID NO: 8 ATCCTTGACTTCCCACGCAATACTATAATCCC R4 SEQ ID NO: 9 ATATTTTTCGGCTAATTTTAACTCTTCTTGT

[0083] Table 2 PRA detection amplification system

[0084]

[0085]

[0086] RPA reaction tubes, reaction buffer, and MgAc solution were purchased from Twist DX, UK. Basic kit; wherein, RPA freeze-dried enzyme powder (including recombinase, single-stranded binding protein and DNA polymerase) is present in the RPA reaction tube. When used, it is dissolved with reaction buffer, and the entire RPA amplification reaction is carried out in the RPA reaction tube.

[0087] ddH2O: purchased from Thermo Fisher Scientific, USA;

[0088] After fully mixing, 2.5ul of MgAc solution (280mM) was added to each reaction tube, and the mixture was reacted at 39°C for 5min, mixed again, centrifuged, and reacted at 39°C for 30min, and then placed on ice to terminate the reaction. After the reaction, agarose gel electrophoresis was performed, and the electrophoresis band appearing at 250bp represented the endothelial herpes virus. Among them, the band size of lane 3 was significantly different from the target size (250bp), and the amplification efficiency of the remaining lane 2 was higher than that of the other lanes, that is, the primer set F1 / R2 had the highest amplification efficiency (SEQ ID NO: 2, SEQ ID NO: 7), and the results are shown in FIG. Figure 1The specificity of the primer sets corresponding to the remaining lanes was poor. Therefore, after comprehensive consideration, primer set F1 / R2 was selected for subsequent experiments.

[0089] 3. Screening of reaction temperature for herpes virus RPA detection.

[0090] The amplification system in Table 3 was used to screen the RPA reaction temperature, and five temperature gradients of 30°C, 35°C, 37°C, 39°C, and 42°C were set. After fully mixing, 2.5ul of MgAc solution (280mM) was added to each reaction tube, and the reaction was carried out at 30°C, 35°C, 37°C, 39°C, and 42°C for 5min, mixed again, centrifuged, and reacted at 30°C, 35°C, 37°C, 39°C, and 42°C for 30min, and then placed on ice to terminate the reaction. The amplified product was subjected to gel electrophoresis, and it can be seen that the bands at 39°C are the clearest (see Figure 2 ).

[0091] Table 3 RPA amplification system

[0092]

[0093] 4. Sensitive detection of herpes simplex virus by RPA.

[0094] The sensitivity test was performed using the amplification system in Table 3. The herpes simplex virus DNA template was diluted to 2×10 5 copies / μL, 2×10 4 copies / μL, 2×10 3 copies / μL, 2×10 2 copies / μL, 10 1 copies / μL, 2×10 0 copies / μL, 2×10 -1 copies / μL, 2×10 -2 After the samples were fully mixed, 2.5ul of MgAc solution (280mM) was added to each reaction tube, and the mixture was reacted at 39℃ for 5min. The mixture was mixed again, centrifuged, and reacted at 39℃ for 30min. The reaction was then terminated on ice and agarose gel electrophoresis was performed. The results showed that the established RAP detection method could detect 2×10 -1 copies / μL of nucleic acid, see Figure 3 .

[0095] 5. Repeatability detection of herpes virus RPA.

[0096] The primer set F1 / R2 selected in this example, the optimal reaction temperature, and the reaction system in Table 3 were used for repeatability testing. The same sample was added at the same time, and the same sample was added every 2 days. The results showed that the established RPA system had good intra-batch and inter-batch repeatability. For details, see Figure 4 and Figure 5 .

[0097] 6. Elephant herpes virus RPA specific detection.

[0098] The optimal primer set F1 / R2, optimal temperature, and amplification system of this embodiment were used for RPA specific detection. The samples to be tested included positive DNA of avian Marek's virus (MDV), turkey herpes virus (HVT), pseudorabies virus (PRV), human herpes virus (HSV-1, HSV-2), and mouse herpes virus (MHV). The results are as follows Figure 6 As shown, the established RPA detection method for herpes simplex virus is highly specific.

[0099] 7. RPA testing of clinical samples.

[0100] Clinical samples include sample numbers YZX56, YZX515 and clinical random samples. YZX56 is a blood sample of an Asian elephant with clinical disease symptoms, YZX515 is an elephant liver tissue preserved in the Guangzhou Zoo sample, and clinical random samples are blood samples of Asian elephants randomly collected during the breeding and management process in the Guangzhou Zoo sample bank.

[0101] 1. Conventional PCR tests were performed on YZX56, YZX515, and randomly collected clinical samples. The reaction system, amplification reaction procedure, and primer set of conventional PCR tests are shown below.

[0102] Reaction system: Premix Ex Taq 12.5 μL, 515-2S, 515-2A 1 μL each (or 56-5S, 56-5A), template 1 μL, ddH2O supplemented to 25 μL.

[0103] The conventional PCR amplification reaction program is: 95°C pre-denaturation for 3 min, 30 cycles; 95°C denaturation for 30 s; 54°C annealing for 30 s; 72°C extension for 20 s; 72°C extension for 10 min.

[0104] The primers used for conventional PCR detection are shown in the following table.

[0105] Table 5 Conventional PCR detection primer sequences

[0106] Primer name Serial number Primer sequence (5'-3') YZX515-2S SEQ ID NO: 10 CCTTTCAAGCCGTCCATC YZX515-2A SEQ ID NO: 11 TGTCCACCGTGCTGATGT YZX56-5S SEQ ID NO: 12 CCTTTCTGTCCGTTCACC YZX56-5A SEQ ID NO: 13 GTTCTGCGGGTCCTTTAT

[0107] Primers YZX515515-2S / A (SEQ ID NO: 10, SEQ ID NO: 11) were used to detect sample YZX515 and random samples, and the target fragment size was about 530 bp. YZX 56-5S / A (SEQ ID NO: 12, SEQ ID NO: 13) was used to detect sample YZX56 and random samples, and the target fragment size was about 760 bp. The PCR product was detected by 1% agarose gel electrophoresis. The results are as follows Figure 7 The sequencing product was subsequently sent to the company for sequence determination, which confirmed that it was a herpes simplex virus gene sequence. The conventional PCR test results of YZX56 and YZX515 were positive, and the conventional PCR test results of random clinical samples were negative.

[0108] 2. The optimal primer set F1 / R2, optimal temperature, amplification system, reaction conditions, etc. of this embodiment were used to perform RPA clinical sample testing. The test results are shown in Figure 8 Among them, YZX56 and YZX515 were positive, and random clinical samples were negative. The results were consistent with those of conventional PCR tests.

[0109] 8. Summary

[0110] The RPA primer set F1 / R2 of the present invention can achieve specific, stable, sensitive and efficient detection of endothelial herpes virus. 5 copies / μL, 2×10 4 copies / μL, 2×10 3 copies / μL, 2×10 2 copies / μL, 10 1 copies / μL, 2×10 0 copies / μL, 2×10 -1 copies / μL, 2×10 -2 The dilution concentration was 2 × 10 copies / μL and RPA amplification was performed to confirm that the minimum detection limit was 2 × 10 -1 The RPA primers were used to detect positive DNA of other herpes viruses, including avian Marek's virus (MDV), turkey herpes virus (HVT), pseudorabies virus (PRV), human herpes virus (HSV-1, HSV-2), and mouse herpes virus (MHV), and no positive results were found, proving that the method of the present invention has high specificity. The RPA detection primer set can be used in on-site detection of elephants infected with endothelial herpes virus, and has important application value in the detection of elephant endothelial herpes virus.

[0111] At the same time, the RPA detection method of the present invention is easy to operate, does not require complex and expensive instruments, is fast and efficient, and can be completed within 60 minutes from sample extraction to result determination, and the timeliness is higher than that of the TaqMan real-time fluorescence quantitative PCR method. The RPA detection primers of the present invention are combined with the RPA amplification technology to achieve rapid and instant detection of endothelial herpes virus, thereby solving the defects of time-consuming, labor-intensive and high-cost herpes virus detection before, improving the detection sensitivity and specificity, reducing labor and equipment costs, and shortening the detection cycle. This rapid detection technology can be promoted and applied to the rapid diagnosis of herpes virus, and has good practical significance and broad market prospects.

[0112] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0113] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A kit for detecting herpes simplex virus, characterized in that: The kit includes an RPA system, wherein the RPA system includes an RPA primer set for endothelial herpes simplex virus; the RPA primer set includes: Upstream primer: 5'-GTACCTATAATGGAGGCCGAAAAGACAGCTAT-3' (SEQ ID NO: 2); Downstream primer: 5'-AACCGTAATGTATCTCGTCACCCCGCCATCTG-3' (SEQ ID NO: 7).

2. The kit according to claim 1, characterized in that The working concentration of the RPA primer set is 0.4-0.55 μM.

3. The kit according to claim 1, characterized in that The RPA system also includes a recombinase, a single-stranded binding protein, and a DNA polymerase.

4. Use of the RPA primer set described in claim 1 in preparing a reagent for detecting E. endotheliotropic herpes virus.

Images