In vitro preparation method of human mesenchymal stem cells

By adding a combination of BET/BRD4 bromodomain inhibitors and TGF-β/ALK inhibitors to a specific basal culture medium and combining it with matrix protein coating, the problem of preparing mesenchymal stem cells with stable quality and uniformity in vitro was solved, and the efficient and rapid preparation of mesenchymal stem cells with immunomodulatory activity was achieved.

CN118360242BActive Publication Date: 2025-09-16XELLSMART BIOMEDICAL (SUZHOU) CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310056468.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-01-19
Publication Date
2025-09-16
Estimated Expiration
2043-01-19

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently and quickly prepare mesenchymal stem cells of stable source and uniform quality in vitro, and traditional methods have problems such as low induction efficiency and strong heterogeneity.

Method used

Mesenchymal stem cells are prepared by adding a combination of a BET/BRD4 bromodomain inhibitor and a TGF-β/ALK inhibitor to a specific basal culture medium, preferably using Xeno-Free human mesenchymal stem cell culture medium or α-MEM culture medium supplemented with platelet extract, controlling the cell density and time during the induction of differentiation, and coating with matrix proteins such as Laminin-521.

Benefits of technology

The efficient and rapid preparation of mesenchymal stem cells of stable source and uniform quality in vitro has been achieved. The positive rate of cell surface markers CD73, CD90 and CD105 is higher than 95%, and they have immunomodulatory activity and osteogenic and adipogenic differentiation capabilities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118360242B_ABST
    Figure CN118360242B_ABST
Patent Text Reader

Abstract

The present invention discloses an in vitro preparation method of human mesenchymal stem cells. The method comprises the following steps: using MSC culture medium supplemented with chemical small molecules to induce iPSC-derived MSCs; after the iPSC cell confluence reaches 40%, the culture medium containing chemical small molecules is replaced; after 8-10 days of induction, the cells are collected and passaged; and the cells are cultured to the P1 generation, showing uniform fibroblast-like, spindle-shaped or fusiform cells. The prepared hiPSC-MSCs meet the relevant phenotypes of mesenchymal stem cells, wherein the positive rates of CD73, CD90 and CD105 are higher than 95%, and the cells have immunomodulatory activity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology and is related to cell therapy technology and products, and specifically relates to an in vitro efficient preparation method and application of human mesenchymal stem cells. Background Art

[0002] Mesenchymal stem cells (MSCs) are cells with high proliferation, self-renewal, mesodermal differentiation, and the ability to secrete angiogenic and growth-promoting factors. They also have the ability to migrate to inflammatory sites, are low immunogenic, and non-tumorogenic. MSCs exhibit powerful immunoregulatory and angiogenic functions, showing application prospects for the treatment of various diseases and becoming candidates for cell therapy.

[0003] Traditional mesenchymal stem cells (MSCs) are mostly derived from tissues such as bone marrow, fat, placenta, umbilical cord, cord blood, and dental pulp. MSCs from different tissue sources exhibit diverse biological effects and demonstrate promising therapeutic efficacy in a variety of diseases. However, their preparation is challenging due to quality control, high heterogeneity, and varying epigenetic imprinting between cells derived from different tissues. Furthermore, they face limitations such as batch-to-batch variability, donor source, proliferation patterns, and collection methods. These factors hinder the industrialization, large-scale preparation, and clinical application of MSCs.

[0004] Currently, mesenchymal stem cells (MSCs) with a stable source and uniform quality have become a hot topic of research. Induced pluripotent stem cells (iPSCs) possess the ability to self-renew indefinitely and differentiate into all cell types of an individual. They are derived by reprogramming terminally differentiated somatic cells into pluripotent stem cells through the introduction of specific transcription factors. Therefore, they do not involve ethical issues. Furthermore, they possess the ability to differentiate into all three germ layers, have low immunogenicity, are easily accessible, have uniform quality, and are amenable to industrial production. These properties have generated significant interest in stem cell, epigenetic, and biomedical research.

[0005] There are many methods for inducing the differentiation of iPSC into MSC in the prior art, mainly including MSC culture medium conversion culture method, embryoid body differentiation method, specific differentiation method, signal pathway inhibitor method and platelet lysate method. All of the above methods can induce iPSC-derived mesenchymal stem cells to obtain human induced pluripotent stem cell-derived mesenchymal stem cells (hiPSC-MSC), but they are easily restricted by conditions such as induction cycle and induction efficiency, making it difficult to obtain qualified mesenchymal stem cells of uniform quality. A variety of small molecule inducers have also been reported for inducing the differentiation of iPSC into MSC. For example, CN111826348A reported that AZD5153 was added to the basal culture medium (3% fetal bovine serum, DMEM-F12 culture medium) to induce iPSC to differentiate into MSC cells. However, it is believed that the induction efficiency of AZD5153 alone is not high. Therefore, it is recommended to use two chemical small molecules, LLY-507 and AZD5153, to treat iPSC in combination to induce differentiation into MSC. Summary of the Invention

[0006] To address the aforementioned problems in the prior art and achieve efficient and rapid in vitro production of mesenchymal stem cells from a stable source and of uniform quality, the inventors of the present disclosure conducted a series of experiments to screen and verify numerous factors that may affect differentiation induction. They surprisingly discovered that adding a BET / BRD4 bromodomain inhibitor to a specific basal culture medium can produce unexpectedly superior differentiation induction effects, thereby completing the present invention. Specific aspects of the present invention include:

[0007] In a first aspect, the present invention provides a mesenchymal stem cell differentiation induction medium, comprising a basal medium and a BET / BRD4 bromodomain inhibitor; the basal medium is selected from one or more of Xeno-Free human mesenchymal stem cell medium, StemGro mesenchymal stem cell serum-free medium, and α-MEM medium supplemented with platelet extract;

[0008] Preferably, the basal culture medium comprises a Xeno-Free human mesenchymal stem cell culture medium supplemented with 10-15% Xeno-Free additives; more preferably, the basal culture medium comprises a Xeno-Free human mesenchymal stem cell culture medium supplemented with 10% Xeno-Free additives;

[0009] Preferably, the basal culture medium comprises an α-MEM culture medium supplemented with 10-15% platelet extract; more preferably, the basal culture medium comprises an α-MEM culture medium supplemented with 10% platelet extract.

[0010] Preferably, the BET / BRD4 bromodomain inhibitor is selected from compounds containing a triazole pyridine group.

[0011] Further preferably, the BET / BRD4 bromodomain inhibitor is selected from JQ1, 1-BET151, 1-BET762 (GSK525762), OTX-015, TEN-010 (JQ2), CPI-203, CPI-0610, olinone (CCT244747), RVX-208, ABBV-744, AZD5153, MT-1 (CASNo: 2060573-82-0) and MS645.

[0012] More preferably, the BET / BRD4 bromodomain inhibitor comprises AZD5153; preferably, the concentration of AZD5153 is 5-15 nM, and more preferably the concentration is 5 nM.

[0013] In some specific embodiments of the present invention, the differentiation induction medium further comprises a TGF-β / ALK inhibitor;

[0014] Preferably, the TGF-β / ALK inhibitor is selected from SB431542, SB-505124, A-83-01, GW6604, IN-1130, Ki26894, LY2157299, LY364947 (HTS-466284), LY550410, LY573636, LY580276, NPC-30345, SB-505124, SD-093, Sm16, SM305, SX-007, Antp-Sm2A, LY2109761.

[0015] Preferably, the TGF-β / ALK inhibitor comprises SB431542; the preferred concentration of SB431542 is 5-10 μM, and the further preferred concentration is 10 μM.

[0016] In a specific embodiment of the present invention, the differentiation induction medium comprises α-MEM medium supplemented with 10% platelet extract, and further comprises 5 nM AZD5153 and 10 μM SB431542.

[0017] A second aspect of the present invention provides a mesenchymal stem cell differentiation induction kit, which comprises the above-mentioned differentiation induction medium.

[0018] A third aspect of the present invention provides a method for inducing differentiation of mesenchymal stem cells, comprising:

[0019] 1) Initial cell digestion and inoculation into pretreated culture plates;

[0020] 2) Cultivating using the differentiation induction medium described in the first aspect of the present invention or the differentiation induction kit described in the second aspect.

[0021] Preferably,

[0022] The initial cells in step 1) are embryonic stem cells or induced pluripotent stem cells, preferably induced pluripotent stem cells;

[0023] The pretreatment in step 1) is to coat the culture plate with Laminin-521, more preferably, the culture plate is coated with Laminin-521 at a final concentration of 5 μg / mL;

[0024] The seeding density described in step 1) is 15000-20000 / cm 2 ;

[0025] The culture in step 2) is to perform differentiation induction culture using the differentiation induction medium described in the first aspect of the present invention or the differentiation induction kit described in the second aspect of the present invention after the cell confluence reaches 40-80%;

[0026] The culturing time in step 2) is 8-10 days;

[0027] Preferably, in step 2), α-MEM medium containing 10% platelet extract is used as the induction medium, and the culture time is 8-10 days, more preferably 10 days;

[0028] Preferably, in step 2), a Xeno-Free human mesenchymal stem cell culture medium is used as the induction culture medium, and the culture time is 8-10 days, more preferably 10 days.

[0029] In some specific embodiments of the present invention, the differentiation induction method further comprises:

[0030] 3) The mesenchymal stem cells obtained in step 2) are cultured in a culture flask coated with Laminin-521, Gelatin or Vitronectin.

[0031] In some specific embodiments of the present invention,

[0032] The cell seeding density in step 3) is 5000-50000 / cm 2 ;

[0033] The culture medium used in step 3) is Xeno-Free human mesenchymal stem cell culture medium or α-MEM culture medium supplemented with platelet extract;

[0034] The coating conditions in step 3) are: coating the culture flask with Laminin-521 at a final concentration of 1-2.5 μg / mL or Gelatin at a final concentration of 0.1% (w / v) at room temperature; the coating time is preferably 30 minutes.

[0035] In a specific embodiment of the present invention, the differentiation induction method comprises:

[0036] 1) Initial cell digestion was performed to prepare single cell suspension and the cells were centrifuged at 15000 / cm 2 The cells were seeded at a density of 100 μg / mL onto culture plates pre-treated with Laminin-521;

[0037] 2) culturing with a differentiation induction medium containing α-MEM medium supplemented with 10% platelet extract, 5 nM AZD5153, and 10 μM SB431542;

[0038] 3) The mesenchymal stem cells obtained in step 2) were cultured in culture flasks at a seeding density of 50,000 / cm 2 The culture medium used was α-MEM medium supplemented with 10% platelet extract, and the culture flask was pre-coated with Gelatin at a final concentration of 0.1% (w / v) at room temperature for 30 minutes.

[0039] The fourth aspect of the present invention provides a mesenchymal stem cell, which is prepared by the differentiation induction method described in the third aspect of the present invention.

[0040] The fifth aspect of the present invention provides a pharmaceutical composition comprising the mesenchymal stem cells described in the fourth aspect of the present invention and a pharmaceutically acceptable carrier.

[0041] The sixth aspect of the present invention provides use of the mesenchymal stem cells described in the fourth aspect of the present invention or the pharmaceutical composition described in the fifth aspect of the present invention in regenerative medicine or cell therapy.

[0042] The seventh aspect of the present invention provides use of the mesenchymal stem cells described in the fourth aspect of the present invention or the pharmaceutical composition described in the fifth aspect of the present invention in the preparation of regenerative medicine or cell therapy products.

[0043] Beneficial effects

[0044] The present invention realizes the efficient and rapid in vitro preparation of mesenchymal stem cells hiPSC-MSCs of stable source and uniform quality; the hiPSC-MSCs prepared by the present invention meet the relevant phenotypes of mesenchymal stem cells, among which the positive rates of CD73, CD90 and CD105 are higher than 95%, and at the same time have immunomodulatory activity and the ability to differentiate into osteoblasts and adipocytes. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 The results of secretion factor detection in Example 13 are shown.

[0046] Figure 2A-2B The results of osteogenic differentiation induction of iPSC cells are shown. Figure 2A Figure 2 shows osteoblasts. Figure 2B Cells in the control group.

[0047] Figure 3A-Figure 3B The results of adipogenic differentiation induction of iPSC cells are shown. Figure 3A This is a diagram of adipocytes. Figure 3B Cells in the control group. DETAILED DESCRIPTION

[0048] The following examples are provided to fully disclose some common techniques for implementing the present invention and are not intended to limit the scope of the present invention. While the inventors have made every effort to ensure the accuracy of the parameters (e.g., amounts, temperatures, etc.) in the examples, some experimental errors and deviations should be taken into account.

[0049] Unless otherwise specified, the drugs and reagents mentioned in the examples are all commercially available products.

[0050] Terms and Definitions

[0051] All patents, patent applications, scientific publications, manufacturer's product specifications, etc. cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. Unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, terms related to biochemistry, molecular biology, microbiology, and cell and tissue culture, protein and nucleic acid, etc., used herein are terms widely used in the relevant fields. In addition, definitions and explanations of relevant terms are provided below to facilitate a better understanding of the present invention.

[0052] As used herein, the expressions "comprise," "include," "contain," and "have" are open ended and mean the inclusion of the listed elements, steps, or components but not the exclusion of other unlisted elements, steps, or components. The expression "consisting of excludes any element, step, or component not specified. The expression "consisting essentially of means that the scope is limited to the specified elements, steps, or components, plus optional elements, steps, or components that do not significantly affect the basic and novel properties of the claimed subject matter. It should be understood that the expressions "consisting essentially of" and "consisting of are encompassed within the meaning of the expression "comprising."

[0053] As used herein, unless the context indicates otherwise, the singular form of the expression "a", "an" or "the" includes plural references. The term "one or more" or "at least one" encompasses 1, 2, 3, 4, 5, 6, 7, 8, 9 or more. The enumeration of ranges of values ​​herein is merely a shorthand method for individually referring to each different value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into this specification as if it were individually enumerated herein. Unless expressly stated otherwise, the numerical values ​​or ranges shown herein are modified by "about" to indicate the numerical value or range listed or claimed ±20%, ±10%, ±5% or ±3%. Unless otherwise indicated, in the method steps described herein, the identifiers such as 1), 2) ..., i), ii).., a), b), ... are merely examples of distinction and do not imply that the method steps are performed in such an order.

[0054] The term "pluripotent cell" refers to a cell that can self-renew and proliferate while maintaining an undifferentiated state and can be induced to differentiate into a specialized cell type under appropriate conditions. As used herein, the term "pluripotent stem cell" has the potential to differentiate into any one of the following three germ layers: endoderm (such as stomach connection, gastrointestinal tract, lungs, etc.), mesoderm (such as muscle, bone, blood, urogenital tissue, etc.) or ectoderm (such as epidermal tissue and nervous system tissue). The term "pluripotent stem cell" as used herein also includes "induced pluripotent stem cells" or "iPSC", a pluripotent stem cell derived from non-pluripotent cells. Exemplary human pluripotent stem cell lines include H1 human pluripotent stem cell lines and H9 human pluripotent stem cell lines. As used herein, the term "totipotency" refers to the ability of cells to form a complete organism. For example, in mammals, only the fertilized egg and the first cleavage stage blastomere are totipotent. In one embodiment, pluripotent stem cells as described herein do not have totipotency and will not form a complete organism.

[0055] Human induced pluripotent stem cells: Induced pluripotent stem cells (iPS cells, iPSC cells) refer to pluripotent stem cells that are reprogrammed from terminally differentiated somatic cells by introducing specific transcription factors.

[0056] Mesenchymal stem cells (MSCs): Mesenchymal stem cells (MSCs) are cells with high proliferation ability, self-renewal ability, ability to differentiate into mesoderm, ability to secrete angiogenic factors and growth-promoting factors, ability to migrate to inflammatory sites, low immunogenicity and non-tumorogenicity.

[0057] iMSC: Mesenchymal stem cells derived by inducing iPSC cells.

[0058] AZD5153: AZD5153 is a potent and selective BET / BRD4 bromodomain inhibitor; the IC50 value of interfering with BRD4 is 1.7nM. Its chemical structure is (CAS No.: 1869912-39-9):

[0059]

[0060] Y-27632: Y27632 is a highly potent, cell-permeable, reversible, and selective Rho-associated protein kinase inhibitor with a Ki value of 140 nM for p160ROCK.

[0061] SB431542: A Src family kinase inhibitor, a TGF-β signaling pathway inhibitor, and a potent ALK5 inhibitor (with an IC50 value of 94nM). It can inhibit TGF-β-mediated SMAD protein activation, cell proliferation, and cell motility, and can effectively inhibit the migration and invasion of cells induced by growth factor β1 in primary and secondary cancer cells.

[0062] BET / BRD4 bromodomain inhibitors: The BET family of bromodomain-containing proteins ("BET bromodomains") includes four proteins: BRD2, BRD3, BRD4, and BRD-t. These proteins contain tandem bromodomains that bind to two closely spaced acetylated lysine residues, thereby increasing the specificity of the interaction. BRD4 is involved in numerous physiological processes, including cell proliferation, apoptosis, chromatin assembly and reorganization, inflammation, and oxidative stress, and is a key player in gene regulatory networks. Small molecule BRD4 inhibitors can downregulate multiple transcription factors, including C-MYC, and exhibit promising anti-tumor effects. BRD4 small molecule inhibitors have a high affinity for bromodomains and can be divided into two categories based on their binding mechanism: monovalent and bivalent inhibitors. Currently, research on BRD4 small molecule inhibitors primarily focuses on monovalent inhibitors. Monovalent BRD4 inhibitors bind to either BD1 or BD2 and are categorized based on their chemical structure into triazoles, isoxazoles, quinolinones, pyridones, and tetrahydroquinolines. On the one hand, the present invention prefers compounds containing a triazole pyridine group; on the other hand, 1-BET151, 1-BET762 (GSK525762), OTX-015, TEN-010 (JQ2), CPI-203, CPI-0610, olinone (CCT244747), RVX-208, ABBV-744, AZD5153, MT-1 (CAS No: 2060573-82-0) and MS645 are preferred.

[0063] TGF-β / ALK inhibitors: The transforming growth factor-β (TGF-β) signaling pathway is involved in numerous cellular processes in both mature organisms and developing embryos, including cell growth, differentiation, apoptosis, cell homeostasis, and other cellular functions. TGF-β / ALK inhibitors include SB431542, SB-505124, A-83-01, GW6604, IN-1130, Ki26894, LY2157299, LY364947 (HTS-466284), LY550410, LY573636, LY580276, NPC-30345, SB-505124, SD-093, Sm16, SM305, SX-007, Antp-Sm2A, and LY2109761.

[0064] Example 1 Culture and passage of primary cells

[0065] This example uses iPSC cells as the initial cells, and the culture and passage procedures are as follows:

[0066] Laminin-521-coated culture plates: Prepare the laminin-521 stock solution (Cat. No. LN521-05, BioLamina) and dilute it with DPBS (containing calcium and magnesium) to a final concentration of 5 μg / mL. Add the diluted laminin-521 to the culture plates and place in a refrigerator at 2-8°C overnight for coating. Remove from the refrigerator 30 minutes before use and preheat in a 37°C incubator until ready to use.

[0067] Cell recovery: Transfer the thawed iPSC cell suspension to a new 15mL centrifuge tube and gently add human induced pluripotent stem cell complete medium (StemFit03 complete medium, manufacturer: Ajinomoto) equilibrated to room temperature to the cell suspension, gently shaking the centrifuge tube while adding. Transfer the 15mL centrifuge tube containing the iPSC cell suspension to a low-speed refrigerated centrifuge and centrifuge at room temperature for 3 minutes at a centrifugal force of 300g. After centrifugation, discard the supernatant and add human induced pluripotent stem cell complete medium (StemFit03 complete medium, manufacturer: Ajinomoto) containing 10μM Y27632 (Y-27632, Selleck, catalog number: S1049) to resuspend the cells and gently pipette. According to the counting results, the cells are counted at 15,000-20,000 / cm 2 Density seed cells onto preheated culture plates and culture in a 37°C, 5% CO2 incubator. Change the medium every 20-24 hours. Subculture cells when cell confluence reaches over 80%.

[0068] Cell passaging: Remove the cell culture plate from the incubator and wash the cells once with DPBS (without calcium and magnesium). Add ReLeSR digestive enzyme (manufacturer: Stemcell; catalog number: 100-0484) to the culture plate to digest the cells for 3-5 minutes. Observe the dissociation of cell colonies under a microscope. After the cells are completely dissociated, add human induced pluripotent stem cell complete medium (StemFit03 complete medium, manufacturer: Ajinomoto) and gently blow the cell suspension. Take out another blank culture plate preheated to 37°C from the incubator and add the cell suspension at a volume ratio of 1:15-20. Place in a 37°C CO2 incubator and culture overnight. Change the cell medium every 20-24 hours. When the cell coverage reaches more than 80%, start the next cell passaging.

[0069] Example 2 Induced small molecule screening

[0070] 1. Small molecule component settings are shown in Table 1

[0071] Table 1 Small molecule component settings and sources

[0072] Small chemical molecules Final concentration Item No. factory GSK126 10nM S7061 Selleck EPZ005687 10nM S7004 Selleck UNC-1999 10nM S7165 Selleck A(DZNeP)Hcl 10nM S7120 Selleck AZD5153 10nM S8344 Selleck LLY-507 10nM S7575 Selleck SB431542+CHIR99021 10μM+2μM S1067,S1263 Selleck SB431542+LLY-507 10μM+10nM S1067,S7575 Selleck SB431542+AZD5153 10μM+10nM S1067,S8344 Selleck SB431542+GSK126 10μM+10μM S1067,S7061 Selleck SB431542+GSK126+LLY-507 10μM+10μM+10nM S1067,S7061,S7575 Selleck SB431542+GSK126+AZD5153 10μM+10μM+10nM S1067,S7061,S8344 Selleck

[0073] 2. Experimental Procedure: iPSC cells from Example 1, reaching 40% confluency, were cultured with MSC culture medium (α-MEM + 10% platelet extract (UltraGRO™-Advanced, Catalog No.: HPCFDCRL50, Manufacturer: Helios BioScience)) containing various small molecule components. Induction was initiated at 2 mL / well, with the medium changed daily during induction. The grouping of culture medium containing various small molecule components is detailed in Table 1. iPSC cells were induced using the culture medium containing the small molecule components described in Table 1 for 8-10 days, after which the induced cells were harvested and passaged. Cells were washed twice with DPBS, followed by digestion with 0.5 mL of TripLE (Manufacturer: Gibco, Catalog No.: 12563-029) added to each well. After approximately 5 minutes of digestion, 2 mL of DMEM / F12 medium was added to each well to terminate the digestion. The cell suspension was collected and transferred to a 15 mL centrifuge tube and centrifuged at 300 g at 20°C for 5 minutes. After centrifugation, discard the supernatant and resuspend the cells for counting. 2 The cells were seeded into the culture flask at a density of 10000 / cm2 to obtain P0 cells. The next cell passage was performed when the cell confluence reached 80%. 2 The cells were inoculated into culture flasks and subcultured. The cells obtained after each subculture were named P1, P2, P3, and so on until Pn. The cell surface marker expression and cell doubling of cells harvested after induction with each medium containing small molecule components were compared.

[0074] 3. Analysis of screening results: The cell doublings and doubling times during the differentiation phase are shown in Table 2. The doubling times during the differentiation phase refer to the cell number doublings from the time the differentiation induction medium is added to the cell number after the differentiation induction process is completed. The doubling time during the differentiation phase refers to the time required for the cell number to double after the induction of the differentiation induction medium. The Pn doublings refer to the cell number doublings after the Pn to Pn+1 phases, and the Pn time refers to the time (in hours) for the cell number to double during the Pn to Pn+1 phases.

[0075] Table 2 Multiplication of mesenchymal stem cells induced by different small molecule reagents

[0076]

[0077] The comparison of the expression of specific surface markers of mesenchymal stem cells is shown in Table 3

[0078] Table 3 Expression of specific surface markers of mesenchymal stem cells induced by different small molecules

[0079]

[0080] 4. Screening conclusion

[0081] Based on the cell doubling and surface marker expression of each group under different induction small molecule conditions, it was confirmed that the cell doubling induced by the AZD5153 small molecule group and the SB431542+AZD5153 small molecule combination group was significantly better than that induced by other small molecules. The expression of cell surface markers in the harvested cells, that is, the proportion of cells expressing specific surface markers on the surface of P1 generation cells, reached the ideal value.

[0082] Example 3 Complete medium screening

[0083] 1. See Table 4 for details on complete culture medium screening

[0084] Table 4 Complete medium screening of each group of culture media and their sources

[0085]

[0086] 2. Experimental steps: Take iPSCs with a culture fusion degree of 40%, replace the culture medium with different MSC complete culture medium containing SB431542+CHIR99021 small molecules to start induction, 2mL / well, and change the medium every day during the induction period. After induction for 8-10 days, collect and passage the induced cells. Wash the cells twice with DPBS, add 0.5mL TrypLE to each well for digestion, and add 2mL DMEM / F12 to each well for about 5 minutes to stop digestion. Collect the cell suspension and transfer it to a 15mL centrifuge tube, centrifuge at 300g, 20℃ for 5 minutes. After centrifugation, discard the supernatant and resuspend for counting. According to the counting results, press 50,000 / cm 2 The cells were seeded into culture flasks. The MSC culture medium used in the maintenance phase was the same as that used in the induction process. When the cell confluence reached 80%, the cells were passaged at 10,000 / cm 2 Cells were seeded in various MSC culture media. Cell surface marker expression and cell doublings were compared between the different MSC culture media. The Pn multiple refers to the multiple increase in cell number from the Pn to Pn+1 culture phase, and the Pn time refers to the time (in hours) it takes for the cell number to double from the Pn to Pn+1 culture phase.

[0087] 3. Filter results

[0088] The cell doubling situation is shown in Table 5:

[0089] Table 5 Multiplication of mesenchymal stem cells obtained in different complete culture media

[0090]

[0091] The comparison of the expression of specific surface markers of mesenchymal stem cells is shown in Table 6:

[0092] Table 6 Expression of cell surface markers in different culture systems

[0093]

[0094]

[0095] 4. Screening conclusion

[0096] By comparing the doubling and surface marker expression of mesenchymal stem cells induced and cultured with different complete culture media, it was determined that the doubling and surface marker expression of the control group culture medium were in line with expectations.

[0097] Example 4 Complete medium screening

[0098] 1. Complete medium screening The types and sources of the culture medium used are shown in Table 7

[0099] Table 7 Culture medium types and sources for complete culture medium screening

[0100] Complete medium brand Item No. α-MEM + 10% platelet extract self made NA StemGro Mesenchymal Stem Cell Serum-Free Medium BasalMedia T321KJ Xeno-Free Human Mesenchymal Stem Cell Medium Ezes Bio AC1001003PRF

[0101] 2. Experimental steps: Take the iPSC cells with a cell fusion degree of 40% in Example 1, replace the culture medium with a different complete culture medium containing 10nM AZD5153 to start induction, add 2mL of culture medium to each well, and change the culture medium every day during the induction period. After induction for 8-10 days, collect and passage the induced cells. After passage, wash the cells twice with DPBS, add 0.5mL of TripLE to each well for digestion, and add 2mL of DMEM / F12 culture medium to each well after digestion for about 5 minutes to terminate digestion. Collect the cell suspension and transfer it to a 15mL centrifuge tube, and centrifuge it at 300g, 20℃ for 5 minutes. After centrifugation, discard the supernatant and resuspend and count. According to the counting results, press 50000 / cm 2 The cells were seeded into the culture flask. When the cell confluence reached 80%, the next cell passage was performed at 10000 / cm 2 The cells were inoculated in various MSC culture media and the cell surface marker expression and cell doubling of cells harvested from different MSC sources in complete culture media were compared.

[0102] 3. Analysis of screening results

[0103] Cell doublings are shown in Table 8. The differentiation doubling time refers to the time it takes for cells to double in number after induction of the differentiation medium. The Pn doubling time refers to the time it takes for cells to double in number after induction of the differentiation medium. The Pn doubling time refers to the time it takes for cells to double in number after induction of the differentiation medium. The Pn doubling time refers to the time it takes for cells to double in number after induction of the differentiation medium. The Pn time refers to the time it takes for cells to double in number during the Pn to Pn+1 culture period (unit: hours).

[0104] Table 8 Multiplication of mesenchymal stem cells induced by different complete culture media

[0105]

[0106] The comparison of the expression of specific surface markers of mesenchymal stem cells is shown in Table 9:

[0107] Table 9 Expression of specific surface markers of mesenchymal stem cells induced by different complete culture media (%)

[0108] Complete medium Cell passage CD73+ CD90+ CD105+ Xeno-Free Human Mesenchymal Stem Cell Medium P1 98.23 98.31 96.51 StemGro Mesenchymal Stem Cell Serum-Free Medium P1 89.58 99.76 93.59 α-MEM + 10% platelet extract P1 98.71 99.43 90.45

[0109] 4. Screening conclusion

[0110] By comparing the doubling and surface marker expression of mesenchymal stem cells induced and cultured with different complete culture media, it was determined that the doubling and surface marker expression of the three groups of culture media, that is, the proportion of cells expressing specific cell surface markers, all reached ideal values.

[0111] Example 5 Confirmation of the induction cycle of complete medium 1

[0112] 1. Experimental steps: Take iPSC cells with a cell fusion degree of 40% in culture, replace the culture medium with MSC complete culture medium containing AZD5153 (α-MEM culture medium containing 10% platelet extract) for induction, add 2 mL of culture medium to each well, and change the medium every day during the induction period. Induce for 6 days, 8 days, and 10 days respectively, and collect and passage the induced cells after the induction. After passage, wash the cells twice with DPBS, add 0.5 mL of TripLE to each well for digestion, and add 2 mL of DMEM / F12 culture medium to each well after digestion for about 5 minutes to terminate digestion. Collect the cell suspension and transfer it to a 15 mL centrifuge tube, centrifuge at 300 g, 20°C for 5 minutes. After centrifugation, discard the supernatant and resuspend for counting. According to the counting results, press 50,000 / cm 2 Cell density: Inoculate cells into culture flasks. When the cell confluence reaches 80%, the next cell passage is performed, and the passage density is 10,000 / cm 2 . The expression of cell surface markers and cell doublings during the induction cycle were compared. The differentiation stage expansion multiple refers to the expansion multiple from the time the differentiation induction medium is added to the number of cells after the differentiation induction process is completed. The differentiation stage doubling time refers to the time required for the number of cells to double after the induction of differentiation medium. The Pn multiple refers to the multiple increase in the number of cells after the culture stage from Pn to Pn+1. The Pn time refers to the time (unit: hour) for the number of cells to double during the culture stage from Pn to Pn+1.

[0113] 2. Analysis of experimental results

[0114] The cell doubling situation is shown in Table 10

[0115] Table 10: Multiplication of mesenchymal stem cells obtained at different induction cycles

[0116]

[0117] The comparison of the expression of specific surface markers of mesenchymal stem cells is shown in Table 11:

[0118] Table 11 Expression of surface markers of mesenchymal stem cells obtained at different induction cycles

[0119]

[0120] 3. Conclusion

[0121] By comparing mesenchymal stem cells obtained under the same induction conditions with different induction cycles, it was confirmed that the expected effect could be achieved when the AZD5153 small molecule induction cycle was 10 days.

[0122] Example 6 Confirmation of induction cycle 2 in complete medium

[0123] 1. Experimental steps: Take iPSCs with a cell fusion rate of 40% in culture, replace the culture medium with Xeno-Free human mesenchymal stem cell culture medium containing AZD5153 components for induction, 2 mL of culture medium per well, and change the medium every day during the induction period. Induce for 6 days, 8 days, and 10 days respectively, and collect and passage the induced cells. After passage, wash the cells twice with DPBS, then add 0.5 mL of TripLE to each well for digestion. After digestion for about 5 minutes, add 2 mL of DMEM / F12 culture medium to each well to terminate digestion. Collect the cell suspension and transfer it to a 15 mL centrifuge tube, centrifuge at 300 g, 20°C for 5 minutes. After centrifugation, discard the supernatant and resuspend for counting. According to the counting results, press 50,000 / cm 2 Cell density: Inoculate cells into culture flasks. When the cell confluence reaches 80%, proceed to the next cell passage. The passage density is 10,000 / cm 2 The expression of cell surface markers in cells harvested during the induction cycle was compared.

[0124] 2. Results Analysis

[0125] Comparison of the expression of specific surface markers of mesenchymal stem cells is shown in Table 12

[0126] Table 12 Expression of surface markers of mesenchymal stem cells obtained at different induction cycles

[0127]

[0128] 3. Conclusion

[0129] By comparing mesenchymal stem cells obtained under the same induction conditions with different induction cycles, it was confirmed that the expected effect can be achieved when the AZD5153 small molecule induction cycle is 8-10 days.

[0130] Example 7 Confirmation of the concentration of supplement 2 in complete medium

[0131] 1. Experimental steps: iPSC cells were cultured at 15,000 / cm 2The cells were seeded in a 6-well cell culture plate, and induction was started when the cell confluence reached 40%. The culture medium was replaced with a culture medium containing AZD5153 components (Xeno-Free human mesenchymal stem cell basal medium + 10% additive (Xeno-Free human mesenchymal stem cell additive, product number: AC-1001003, manufacturer: Ezes Biological)) for induction. The medium was changed once a day during the induction period. After 10 days of induction, the induced cells were collected and passaged. After passage, the cells were washed twice with DPBS, and then 0.5 mL of TripLE was added to each well for digestion. After about 5 minutes of digestion, 2 mL of DMEM / F12 culture medium was added to each well to terminate the digestion. The collected cell suspension was transferred to a 15 mL centrifuge tube and centrifuged at 300 g and 20°C for 5 minutes. After centrifugation, the supernatant was discarded and the cells were resuspended and counted. According to the counting results, 50,000 / cm 2 Cells were seeded into culture flasks using the following culture media: Xeno-Free Human Mesenchymal Stem Cell Basal Medium + 10% Supplement, Xeno-Free Human Mesenchymal Stem Cell Basal Medium + 15% Supplement, and Xeno-Free Human Mesenchymal Stem Cell Basal Medium + 20% Supplement. Cells were passaged when the cell confluence reached 80%, with a seeding density of 10,000 cells / cm. 2 Comparison of iMSC cell doubling and surface marker expression at different additive ratios. Pn multiples refers to the multiple increase in cell number from Pn to Pn+1, and Pn time refers to the time (in hours) it takes for the cell number to double from Pn to Pn+1.

[0132] 2. Analysis of screening results

[0133] The cell doubling situation is shown in Table 13:

[0134] Table 13 Multiplication of iMSCs cultured at different additive concentrations

[0135]

[0136] The comparison of the expression of specific surface markers of mesenchymal stem cells is shown in Table 14:

[0137] Table 14 Expression of cell surface markers at different cell seeding densities at the end of induction

[0138]

[0139]

[0140] 3. Conclusion

[0141] Comparison of cell doubling time and surface marker expression in culture media with varying additive ratios confirmed that increasing the additive ratio reduced doubling time and improved cell doubling. However, surface marker expression after long-term passage showed that increasing additive concentrations affected CD90 expression. Based on these test results, the optimal additive ratio for Xeno-Free human mesenchymal stem cell culture medium was determined to be 10-15%, with the optimal additive ratio being 10%.

[0142] Example 8 Confirmation of the concentration of induced small molecule components

[0143] 1. Experimental steps: Take iPSC cells with a cell confluence of 40% in culture, replace the culture medium with Xeno-Free human mesenchymal stem cell culture medium containing AZD5153 for induction, 2 mL of culture medium per well, and the final concentrations of AZD5153 are 5 nM, 10 nM, and 15 nM, respectively. Change the medium every day during the induction period. Induce for 8-10 days, and then collect and passage the induced cells. After passage, wash the cells twice with DPBS, then add 0.5 mL of TripLE to each well for digestion. After digestion for about 5 minutes, add 2 mL of DMEM / F12 culture medium to each well to terminate digestion. Collect the cell suspension and transfer it to a 15 mL centrifuge tube. Centrifuge at 300 g and 20°C for 5 minutes. After centrifugation, discard the supernatant and resuspend and count. According to the counting results, press 50,000 / cm 2 The cells were seeded into the culture flask. When the cell confluence reached 80%, the next cell passage was carried out, and the seeding density was 10000 / cm 2 The cell doubling and surface marker expressions of iMSCs induced by different AZD5153 component concentrations were compared.

[0144] 2. Results Analysis

[0145] The comparison of the expression of specific surface markers of mesenchymal stem cells is shown in Table 15:

[0146] Table 15 Expression of surface markers of mesenchymal stem cells obtained at different induction cycles

[0147]

[0148] 3. Conclusion

[0149] By comparing the mesenchymal stem cells obtained by induction with different small molecule concentrations during the same induction cycle, it was confirmed that when the AZD5153 component induction cycle was 8-10 days, the concentration of 5-15nM could achieve the expected effect, and the optimal induction concentration was 5nM.

[0150] Example 9 Induction end seeding density confirmation

[0151] 1. Experimental steps: Take iPSC cells with a cell confluence of 40% in culture, replace the culture medium with Xeno-Free human mesenchymal stem cell culture medium containing AZD5153 components to start induction, 2mL / well, and change the medium every day during the induction period. After 10 days of induction, the induced cells were collected and passaged. Wash the cells twice with DPBS, add 0.5mL TrypLE to each well for digestion, and add 2mL DMEM / F12 culture medium to each well after digestion for about 5 minutes to terminate the digestion. Collect the cell suspension and transfer it to a 15mL centrifuge tube, centrifuge at 300g, 20℃ for 5 minutes. After centrifugation, discard the supernatant and resuspend and count. According to the counting results, count 5000, 10000, 20000, 30000, 40000, and 50000 / cm respectively. 2 Cell density: Inoculate cells into culture flasks. When the cell confluence reaches 80%, proceed to the next cell passage. The inoculation density is 10,000 / cm 2 The iMSC cell doublings and surface marker expression were compared at different seeding densities. The Pn multiple refers to the multiple increase in cell number after the Pn to Pn+1 culture phase, and the Pn time refers to the time (in hours) it takes for the cell number to double during the Pn to Pn+1 culture phase.

[0152] 2. Analysis of screening results

[0153] The cell doubling situation is shown in Table 16:

[0154] Table 16 Comparison of cell doublings obtained at different cell seeding densities at the end of induction

[0155]

[0156] Comparison of the expression of specific surface markers of mesenchymal stem cells is shown in Table 17

[0157] Table 17 Expression of cell surface markers at different cell seeding densities at the end of induction

[0158]

[0159]

[0160] 3. Conclusion

[0161] After induction, different cell seeding densities had no significant effect on subsequent cell proliferation and surface marker expression. Seeding density 5000 / cm 2 -50000 / cm 2 All results are in line with expectations.

[0162] Example 10 Confirmation of the starting node of iPSC induction

[0163] 1. Experimental steps: iPSC cells were cultured at 15,000 / cm 2 Inoculate in a 6-well cell culture plate, and start induction when the cell confluence reaches 10%, 20%, 40%, and 80%, respectively. Replace the culture medium with Xeno-Free human mesenchymal stem cell culture medium containing AZD5153 components for induction. Change the medium once a day during the induction period. After 10 days of induction, collect and passage the induced cells. After passage, wash the cells twice with DPBS, add 0.5mL TrypLE to each well for digestion, and add 2mL DMEM / F12 culture medium to each well for about 5 minutes to terminate the digestion. Collect the cell suspension and transfer it to a 15mL centrifuge tube, centrifuge at 300g, 20℃ for 5 minutes. After centrifugation, discard the supernatant and resuspend and count. According to the counting results, count 50,000 / cm 2 The cells were seeded into the culture flask. When the cell confluence reached 80%, the next cell passage was carried out, and the seeding density was 10000 / cm 2 . The iMSC cell doubling and surface marker expression were obtained by comparing different induction starting nodes. The differentiation stage expansion multiple is the expansion multiple of the cell number when the induction differentiation medium is added to the cell number after the induction differentiation process is completed, and the differentiation stage doubling time refers to the time required for the cell number to double after the induction differentiation medium is added. The Pn multiple refers to the multiple of the cell number increase after the culture stage from Pn to Pn+1, and the Pn time refers to the time (unit: hour) for the cell number to double during the culture stage from Pn to Pn+1.

[0164] 2. Analysis of screening results

[0165] Comparison of the expression of specific surface markers of mesenchymal stem cells at different induction starting points is shown in Table 18

[0166] Table 18 Expression of cell surface markers obtained at different induction starting nodes

[0167]

[0168] Comparison of mesenchymal stem cell doubling at different induction starting points is shown in Table 19

[0169] Table 19 Comparison of mesenchymal stem cell doubling at different induction starting points

[0170]

[0171] 3. Conclusion

[0172] Based on the mesenchymal stem cell doubling and surface marker expression obtained at different induction starting nodes, it can be confirmed that when induction begins when the iPSC fusion is lower than 40%, the harvested cell doubling and surface marker expression are lower than 40%-80% fusion, and the optimal starting induction node should be 40%-80%.

[0173] Example 11 iMSC coating solution screening

[0174] 1. Experimental steps: iPSC cells were cultured at 15,000 / cm 2 Seed in a 6-well plate, and start induction when the cell confluence reaches 40%. Replace the culture medium with a culture medium containing AZD5153 components (Xeno-Free human mesenchymal stem cell basal culture medium + 10% additives) to start induction. Change the medium once a day during the induction period. After 10 days of induction, collect and passage the induced cells. After passage, wash the cells twice with DPBS, add 0.5mL TrypLE to each well for digestion, and add 2mL DMEM / F12 culture medium to each well after about 5 minutes of digestion to stop digestion. Collect the cell suspension and transfer it to a 15mL centrifuge tube, and centrifuge it at 300g, 20℃ for 5 minutes. After centrifugation, discard the supernatant and resuspend and count. Laminin-521 (5μg / mL), Gelatin (0.1%), and Vitronectin (5μg / mL) were used to coat the culture flasks, respectively. The uncoated culture flasks were used as the control group. According to the counting results, the cells were counted at 50,000 / cm 2 The cells were seeded into culture flasks. When the cell confluence reached 80%, the cells were passaged and the seeding density was 8000 / cm 2 Cells were passaged using different coating solutions, and their effects on cell doubling and surface marker expression were compared. The Pn factor refers to the multiple increase in cell number from the Pn to Pn+1 stage, and the Pn time refers to the time (in hours) it takes for cells to double in number from the Pn to Pn+1 stage.

[0175] 2. Analysis of screening results

[0176] The cell doubling situation is shown in Table 20:

[0177] Table 20 iMSC cell doublings in different coating solutions

[0178]

[0179] The comparison of the expression of specific surface markers of mesenchymal stem cells is shown in Table 21:

[0180] Table 21 Expression of cell surface markers in cells cultured with different coating solutions

[0181]

[0182] 3. Conclusion

[0183] By using different coating solutions to culture iMSCs, the comparison results of each group showed that the effects of different coating solutions and the control group on cell multiplication and surface marker expression were in line with expectations.

[0184] Example 12 iMSC encapsulation condition screening

[0185] 1. Experimental steps: Laminin-521 (5 μg / mL), Laminin-521 (2.5 μg / mL), and Laminin-521 (1 μg / mL) were used to coat culture flasks at room temperature and 37°C, respectively. Uncoated culture flasks served as the control group. iMSC cells cultured to P3 were taken and plated at 8000 / cm 2 Seed cells onto culture flasks / plates coated with different Laminin-521 coating conditions. When cell confluency reached 80%, wash the cells twice with DPBS and add 0.5 mL of TripLE per well for digestion. After digestion, add 2 mL of DMEM / F12 medium per well to terminate the digestion. Collect the cell suspension, transfer it to a 15 mL centrifuge tube, and centrifuge at 300g, 20°C for 5 minutes. After centrifugation, discard the supernatant, resuspend, and count the cells. Compare digestion time, total cell count, and surface marker expression.

[0186] 2. Experimental results are shown in Table 22 and Table 23

[0187] Table 22 Preliminary screening results for confirmation of Laminin-521 coating conditions

[0188]

[0189] Table 23 Expression of iMSC surface markers in culture under different Laminin-521 coating conditions

[0190]

[0191] 3. Conclusion

[0192] Different coating times and temperatures had little effect on cell digestion. Laminin-521 concentration correlated with digestion time; increasing concentration increased digestion time. Different coating conditions had no effect on cell surface marker expression. The optimal concentration of laminin-521 was 1.0-2.5 μg / mL, digestion temperature was room temperature or 37°C, and coating time was 30 minutes.

[0193] Example 13 Detection of iMSC Secretion Factors

[0194] 1. Experimental steps: Take iPSC cells that have reached 40% confluency in culture and replace the culture medium with MSC culture medium containing different small molecule components (α-MEM + 10% platelet extract (UltraGRO TM -Advanced, catalog number: HPCFDCRL50, manufacturer: HeliosBioScience)) started induction, 2mL / well, and the medium was changed every day during the induction period. After 8-10 days of induction, the induced cells were collected and passaged. Wash the cells twice with DPBS, add 0.5mL TrypLE (manufacturer Gibco, catalog number 12563-029) to each well for digestion, and add 2mL DMEM / F12 culture medium to each well after digestion for about 5 minutes to stop digestion. Collect the cell suspension and transfer it to a 15mL centrifuge tube, centrifuge at 300g, 20℃ for 5 minutes. After centrifugation, discard the supernatant and resuspend for counting. .According to the counting results, press 50,000 / cm 2 The cells were seeded into culture flasks to obtain P0 cells. When the cell confluence reached 80%, the cells were passaged at 10,000 / cm 2 The cells were inoculated into culture flasks and subcultured until P3 cells were obtained. 5×10 iPSC cells without induction and iMSC cells induced to P3 were taken. 5 ,according to RNA was extracted according to the Cell / Tissue Total RNA Isolation Kit V2 instructions. The extracted RNA concentration was determined and used in downstream experiments. Reverse transcription was performed on 1 μg of RNA using the HiScript III RT SuperMix for qPCR (+gDNA wiper) Reverse Transcription Kit. After reverse transcription, 180 μL of DNase / RNase-free ultrapure water was added to 20 μL of cDNA as the qPCR template. Prepare a 96-well fluorescence quantitative plate and add the reaction mixture according to the components in Table 24.

[0195] Table 24 Fluorescence quantitative PCR reaction system

[0196] 2×ChamQ Universal SYBR qPCR Master Mix 5μL Primer-F (10 μM) 0.2μL Primer-R (10 μM) 0.2μL cDNA template 2μL <![CDATA[ddH2O]]> 2.6μL

[0197] After adding the reaction system to the 96-well plate, seal the plate with sealing film and centrifuge at 2000 rpm for 2 minutes. Turn on the qPCR instrument and set the parameters: Pre-incubation, 95℃ for 30 seconds. Amplification, 95℃ for 10 seconds, 60℃ for 30 seconds, 40 cycles. After the parameters are set, start the qPCR reaction. After the reaction is completed, read the data and use 2 -△△CTRelative gene expression levels were calculated. Using GAPDH as an internal reference gene, the expression of VEGF (vascular endothelial growth factor), FGF (basic fibroblast growth factor), IGF (insulin-like growth factor), HGF (hepatocyte growth factor), EGF (epidermal growth factor), BDNF (brain-derived neurotrophic factor), GDNF (glial cell line-derived neurotrophic factor), and NGF (nerve growth factor) was compared in iPSCs and iMSCs.

[0198] The details of each secretion factor and primer are as follows Table 25:

[0199] Table 25 Detailed sequences of secreted factors and fluorescent quantitative PCR primers

[0200] Primer Primer sequences VEGF-F AGGGCAGAATCATCACGAAGT VEGF-R AGGGTCTCGATTGGATGGCA FGF-F AGAAGAGCGACCCTCACATCA FGF-R CGGTTAGCACACACTCCTTTG IGF-F GCTCTTCAGTTCGTGTGTGGA IGF-R GCCTCCTTAGATCACAGCTCC HGF-F GCTATCGGGGTAAAGACCTACA HGF-R CGTAGCGTACCTCTGGATTGC EGF-F TGTCCACGCAATGTGTCTGAA EGF-R CATTATCGGGTGAGGAACAACC BDNF-F AAGAGCTGTTGGATGAGGACC BDNF-R TACTGAGCATCACCCTGGAC GDNF-F ACAAATGGCAGTGCTTCCTA GDNF-R CAGTTCCTCCTTGGTTTCATAG NGF-F GGCAGACCCGCAACATTACT NGF-R ACCTCGAAGTCCAGATCCTCAG GAPDH-F TCGGAGTCAACGGATTTGGT GAPDN-R TTGCCATGGGTGGAATCATA

[0201] 2. Secretion factor detection results: iMSCs express secretion factor genes such as IGF, NGF, GDNF and BDNF more than iPSCs (see Appendix Figure 1 ).

[0202] Example 14 iMSC immune function detection

[0203] 1. Take iMSCs of passage P3 and add 2×10 5 Cells / well were seeded in a twelve-well cell adherent culture plate and cultured for 20-24 hours before use.

[0204] 2. IDO-1 activity detection: The cultured iMSC cells were divided into an IFN-γ stimulation group and a non-IFN-γ stimulation group. After 24 hours of IFN-γ stimulation, the adherent iMSC cells were harvested and incubated with anti-IDO-1 antibody (Cat. No.: 566648, Manufacturer: BD) before flow cytometry analysis.

[0205] 3. Lymphocyte proliferation function test: CFDASE (CFSE for short)-labeled PBMCs were added to the cultured iMSC cells for co-culture, and the groups were as follows: PBMC, PBMC-CFSE, PBMC-CFSE+CD3Beads, PBMC-CFSE+CD3Beads+iMSC (iMSC:PBMC=1:5). After five days of co-culture, the PBMC cells in the supernatant were harvested. Among them, the PBMC-CFSE+CD3Beads experimental group used CD3 magnetic beads and the incubated PBMC-CFSE cells in a certain ratio, co-cultured for a certain time, and the CD3+T cells were harvested for detection on the machine; among them, the PBMC-CFSE+CD3Beads+iMSC experimental group used CD3 magnetic beads and the incubated PBMC-CFSE+iMSC cell suspension in a certain ratio and continued to incubate for a certain time, and the CD3+T cells were harvested for detection on the machine.

[0206] 4. Detection of Th1 and Th17 lymphocyte subset proliferation function. PBMCs were added for co-culture and divided into the following groups: PBMC, PBMC + iMSC (iMSC: PBMC = 1:5). After 3 days of co-culture, Leukocyte Activation Cocktail was added for stimulation for 4-6 hours. PBMCs in the supernatant were harvested and analyzed by flow cytometry. CD3+CD8-IFN-γ+ and CD3+CD8-IL-17-A+ cell populations were detected by flow cytometry, respectively.

[0207] 5. Functional detection of iMSC regulating Treg lymphocyte subset proliferation: 2×10 5 Cells / well were seeded into a twelve-well cell adherent culture plate and cultured for 20-24 hours before use. PBMCs were added for co-culture for 5 days and grouped as follows: PBMCs, PBMCs + iMSCs. After co-culture, PBMCs in the supernatant were harvested and analyzed by flow cytometry.

[0208] 6. All flow cytometry assays were performed using an Agilent NovoCyte 3000. Appropriate channels were selected based on experimental requirements. Gating was performed based on cell size and granularity to identify the target cell population. Furthermore, gates were drawn based on the fluorescence intensity of the isotype group within the target cell population. The results were analyzed using software to determine the positive rate ratio for each sample group.

[0209] 7. Test results are shown in Table 26

[0210] Table 26 iMSC immune function test results

[0211]

[0212] 8. Conclusion

[0213] The results showed that iMSCs had an inhibitory effect on CFSE lymphocyte proliferation, Th1 lymphocyte subset proliferation, and Th17 lymphocyte subset proliferation, with the inhibition rates for CFSE lymphocyte proliferation, Th1 lymphocyte subset proliferation, and Th17 lymphocyte subset proliferation being 87.45%, 76.78%, and 63.74%, respectively. iMSCs promoted the proliferation of Treg lymphocyte subsets with a promotion rate of 136.94%, which can significantly increase the proliferation of Treg cells. iMSCs can also express IDO-1. iMSCs can achieve immune regulatory function through the above-mentioned effects.

[0214] Example 15 Detection of iMSC osteogenic differentiation ability

[0215] 1. Experimental steps: Take iMSCs of passage P3 and add 1×10 5Cells were seeded / well in a 12-well cell adherent culture plate. Induction was started when the cell confluence was 90% to 100%. Complete culture medium was replaced in the uninduced group. Complete culture medium (MesenCult) was added at 1 mL / well in the induced group. TM Osteogenic Differentiation Kit (Human), Catalog No.: 05465, Manufacturer: Stemcell), continue culturing. Aspirate the old culture medium every 3 to 4 days, add fresh osteogenic induction complete medium or complete medium, and induce culture for 28 days. At the end of induction, aspirate the culture medium, wash once with PBS, add 1 mL / well of 4% paraformaldehyde solution, and let it stand at room temperature for 15 to 30 minutes. Aspirate the fixative, wash 2 to 3 times with water, slowly add 0.5 mL / well of Alizarin Red S staining solution, and let it stand at room temperature for 5 to 10 minutes. Wash with water 2 to 3 times, and finally add a small amount of water to cover the cells and observe under a microscope. Select representative stained fields and take pictures.

[0216] 2. Test results such as Figure 2A - Figure 2B As shown: The results showed that after iMSCs were differentiated into osteoblasts stained with Alizarin Red S staining solution, they had osteogenic differentiation ability.

[0217] Example 16 Detection of iMSC Adipogenic Differentiation Ability

[0218] 1. Experimental steps: Take iMSCs of passage P3 and add 1×10 5 Cells were seeded / well in a 12-well cell adherent culture plate. Induction was started when the cell confluence was 90% to 100%. Complete medium was replaced in the uninduced group. In the induced group, 1 mL / well of adipogenic complete medium ( Continue culturing in Human Mesenchymal Stromal Cell Adipogenic Differentiation Medium (Cat. No. MM201, Manufacturer: Quanshijin). Aspirate the old medium every 3-4 days and add fresh adipogenic induction complete medium or complete medium for 28 days. At the end of induction, aspirate the medium, wash once with PBS, add 1 mL / well of 4% paraformaldehyde solution, and incubate at room temperature for 15-30 minutes. Aspirate the fixative, wash 2-3 times with distilled water, add 1 mL / well of 60% isopropanol, and rinse for 5 minutes. Aspirate the isopropanol, wash 2-3 times with distilled water, add 0.5 mL / well of Oil Red O working solution, and incubate at room temperature for 20 minutes. Aspirate the Oil Red O working solution, wash 2-3 times with distilled water, and finally, add a small amount of distilled water (approximately 300 μL) to cover the cells and observe under a microscope. Select representative stained fields and photograph them.

[0219] 2. Test results such as Figure 3A - Figure 3BAs shown: The results showed that after iMSCs were differentiated into adipogenic induction medium, fat cells that could be stained with Oil Red O staining solution were obtained, and they had good adipogenic differentiation ability.

Claims

1. A mesenchymal stem cell differentiation induction medium, characterized in that: The differentiation induction medium comprises a basal medium and a BET / BRD4 bromodomain inhibitor; the basal medium is selected from a Xeno-Free human mesenchymal stem cell medium containing 10-15% Xeno-Free additives; the BET / BRD4 bromodomain inhibitor is AZD5153, and the concentration of AZD5153 is 5-15 nM.

2. The mesenchymal stem cell differentiation induction medium according to claim 1, wherein the concentration of AZD5153 is 5 nM.

3. The differentiation induction medium according to claim 1, wherein The differentiation induction medium further contains a TGF-β / ALK inhibitor, which is SB431542; the concentration of SB431542 is 5-10 μM.

4. The differentiation induction medium according to claim 3, wherein The concentration of SB431542 was 10 μM.

5. A kit for inducing differentiation of mesenchymal stem cells, characterized in that the kit contains the inducing differentiation medium according to any one of claims 1 to 4.

6. A method for inducing differentiation of mesenchymal stem cells, characterized in that: The differentiation method comprises: 1) Digest induced pluripotent stem cells and seed them onto culture plates pretreated with Laminin-521 at a density of 15,000-20,000 cells / cm 2 ; 2) After the cell confluence reaches 40-80%, the cells are cultured using the differentiation induction medium according to any one of claims 1 to 4 or the differentiation induction kit according to claim 5 for 8-10 days.

7. The method for inducing differentiation according to claim 6, further comprising: 3) The mesenchymal stem cells obtained in step 2) were cultured in culture flasks coated with Laminin-521 at a cell seeding density of 5000-50000 / cm 2 The culture flask was coated with Laminin-521 at a final concentration of 1-2.5 μg / mL at room temperature; the coating time was 30 minutes.

Citation Information

Patent Citations

  • Process for the preparation of foams

    EP0431542A2

  • In-vitro efficient preparation method and application of mesenchymal stem cells derived from human inducible pluripotent stem cells

    CN111826348A