KASP primer set for detecting wheat adult plant stripe rust resistance and application
By developing a KASP molecular marker closely linked to the wheat stripe rust resistance gene QYr076.jaas-4D.2 at the adult stage, the problem of easy loss of wheat stripe rust resistance was solved, enabling efficient and accurate genotyping and breeding-assisted selection, thus improving breeding efficiency and accuracy.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- JIANGSU ACAD OF AGRI SCI
- Filing Date
- 2024-02-29
- Publication Date
- 2026-05-01
AI Technical Summary
In existing technologies, wheat stripe rust resistance genes are easily lost, chemical control methods are harmful to the environment and health, and the problem of resistance loss when planting disease-resistant varieties is difficult to solve. There is a lack of effective molecular markers for identifying and discovering non-race-specific resistance genes.
We developed a KASP molecular marker closely linked to the wheat stripe rust resistance gene QYr076.jaas-4D.2 at the adult stage. PCR amplification and quantitative fluorescence detection were performed using the KASP primer set to achieve high-throughput and accurate genotyping.
It provides stable resistance gene resources, improves breeding efficiency, enables rapid screening of disease-resistant individual plants, achieves high-precision molecular marker-assisted selection, distinguishes between homozygous and heterozygous disease-resistant genotypes, and improves the efficiency and accuracy of breeding work.
Smart Images

Figure CN118374622B_ABST
Abstract
Description
KASP primer set for detecting stripe rust resistance in mature wheat and its application Technical Field
[0001] This invention relates to the field of bio-agriculture, and in particular to a molecular marker for detecting QTLs for resistance to stripe rust and its application method. Background Technology
[0002] Wheat stripe rust is a typical airborne disease that can spread in high-altitude air currents. It occurs during the seedling and mature stages of wheat and is prevalent in almost all wheat-growing regions worldwide. Once it occurs, wheat stripe rust severely disrupts normal wheat growth. In epidemic years, it causes significant yield and economic losses. Currently, there are two main control strategies for wheat stripe rust. One is chemical control, which has the advantages of rapid and strong effectiveness. Especially in years with widespread stripe rust, it can effectively reduce wheat yield losses. However, this method also has significant weaknesses; specifically, long-term use can lead to fungicide resistance in the pathogen and also have impacts on the environment and human health. Compared with chemical control, planting disease-resistant varieties is the most economical and environmentally friendly method; however, the loss of resistance to stripe rust is caused by variations in the virulence of the disease, which is a major problem in resistance breeding. Therefore, identifying and discovering wheat stripe rust resistance genes and developing molecular markers are of great significance for accelerating the breeding of disease-resistant varieties.
[0003] Due to racial differences in pathogen populations, many stripe rust resistance genes lose their effectiveness within a few years, such as Yr1-Yr4, Yr6-Yr10, Yr17, Yr20-Yr22, Yr24-Yr29, and Yr43. These resistance genes belong to the all-stage resistance (ASR) type (also known as seedling resistance), which has the disadvantage of being race-specific. In contrast, another type of resistance, adult plant resistance (APR), is non-race-specific and therefore more durable, which can effectively slow down the rate of resistance “loss” in wheat varieties, such as Libellula, a wheat variety grown in Longnan, Gansu, China, and Alpowa, grown in the Pacific Northwest of the United States. To date, 85 formally named stripe rust resistance genes and more than 200 QTLs have been identified, most of which are ASRs, with only a few being APRs. Therefore, it is of great significance to identify more APR resistance genes in wheat and its close wild relatives.
[0004] Kompetitive Allele Specific PCR (KASP) is a labeling technique for SNPs that identifies SNP genotypes through fluorescence signals. KASP primers consist of two forward competitive primers (each with a 5' end complementary to the fluorescent groups HEX and FAM) and one reverse universal primer. The two forward specific primers represent the two allele genotypes of the SNP and are each linked to adapter sequences containing the FAM and HEX fluorescent groups, respectively. The reverse universal primer is located on the opposite side of the SNP site and does not contain any adapter sequence. The forward primers specifically bind to DNA with the same genotype, and the two forward primers emit two different colors of fluorescence. The PCR reaction system contains universal sequences modified with fluorescent and quenching groups. During amplification and detection using specialized PCR reagents, if the template strand at that site is homozygous, a single matched fluorescence is emitted; if heterozygous, both fluorescences are emitted simultaneously. The fluorescence value of the product indicates which parent the genotype belongs to or whether it is heterozygous. KASP-based PCR amplification is simple, requires no electrophoresis detection, and greatly improves detection efficiency, meeting the requirements for high-throughput detection. Currently, KASP technology is widely used in genetic map construction, fine mapping, gene map-based cloning, germplasm detection, and marker-assisted selection breeding research in crops such as wheat, rice, corn, and soybean. Summary of the Invention
[0005] To address the aforementioned problems, the present invention aims to provide a KASP molecular marker and quantitative real-time PCR primers closely linked to QYr076.jaas-4D.2. These primers can amplify the stripe rust resistance QTL gene QYr076.jaas-4D.2 in the adult wheat line PI660076, providing a new gene resource for wheat stripe rust resistance breeding.
[0006] The second aspect of this invention is to provide the application of the above-mentioned KASP primers in detecting stripe rust resistance in mature wheat plants.
[0007] The objective of this invention is achieved through the following technical solution:
[0008] First, this application provides a KASP primer set for detecting resistance to stripe rust in mature wheat plants. This primer set consists of the KASP_6535 primer set and the KASP_9130 primer set. The KASP_6535 primer set consists of upstream primer 1, upstream primer 2, and universal primer 1, with nucleotide sequences as shown in SEQ ID NO.1-SEQ IN NO.3, respectively. The KASP_9130 primer set consists of upstream primer 3, upstream primer 4, and universal primer 2, with nucleotide sequences as shown in SEQ ID NO.4-SEQ IN NO.6, respectively.
[0009] This KASP primer set consists of KASP molecular markers closely linked to the wheat adult stripe rust resistance gene QYr076.jaas-4D.2, and comprises KASP_6535 and KASP_9130. These two molecular markers are co-located on wheat chromosome 4D with the wheat adult stripe rust resistance gene QYr076.jaas-4D.2, with a genetic distance of 7.41 cM.
[0010] The wheat stripe rust resistance gene QYr076.jaas-4D.2 at the mature stage originates from the stripe rust-resistant common wheat line PI660076. This gene is located on the wheat chromosome 4D, with a physical location of 379.77–436.91 Mb in the RefSeqv1.1 genome version. PI660076 is a high-generation inbred line resistant to stripe rust, bred from a cross between the Pakistani winter wheat variety PI 182111 and the susceptible spring wheat variety AVS (see the literature "Registration of 70 common spring wheat germlasm lines resistant to stripe rust. Wang et al. J. Plant Regist. 6:104-110, 2012").
[0011] QYr076.jaas-4D.2 exhibits stable resistance to wheat stripe rust, detectable in five environments; it contributes significantly, explaining 7.97%–39.19% of the reactive phenotypic variation and 8.77%–20.55% of the severity phenotypic variation.
[0012] The KASP molecular marker KASP_6535 was obtained by PCR amplification using three primers with nucleotide sequences as shown in SEQ ID NO. 1–3. These three primers consist of two upstream primers and one universal downstream primer. The 5' ends of the two upstream primers are modified with different fluorescent groups. The nucleotide sequences of the three primers are shown in SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3, respectively (the underlined portions represent the sequences of the fluorescent groups):
[0013] Upstream primer 1 (SEQ ID NO.1): GAAGGTGACCAAGTTCATGCTT TGAATGGAAATACAGGCAGTGCA;
[0014] Upstream primer 2 (SEQ ID NO.2): GAAGGTCGGAGTCAACGGAT TTGAATGGAAATACAGGCAGTGCC;
[0015] Universal primer 1 (SEQ ID NO.3): GTTTCCTTTTTTAATCGGTCAACCG;
[0016] The KASP molecular marker KASP_9130 was obtained by PCR amplification using three primers with nucleotide sequences as shown in SEQ ID NO. 4–6. These three primers consist of two upstream primers and one universal downstream primer. The 5' ends of the two upstream primers are modified with different fluorescent groups. The nucleotide sequences of the three primers are shown in SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6, respectively (the underlined portions represent the sequences of the fluorescent groups):
[0017] Upstream primer 3 (SEQ ID NO.4): GAAGGTGACCAAGTTCATGCT AAGGGGAAAAAAAGCCACTCCTT;
[0018] Upstream primer 4 (SEQ ID NO.5): GAAGGTCGGAGTCAACGGATT AAGGGGAAAAAAAGCCACTCCTC;
[0019] Universal primer 2 (SEQ ID NO.6): CCGGTGGTTGGCTATCTCTACGT;
[0020] The polymorphisms of the KASP molecular markers KASP_6535, which are closely linked to the wheat stripe rust resistance gene QYr076.jaas-4D.2 at the adult stage, are C / A, and the polymorphisms of KASP_9130 are A / G.
[0021] Secondly, this application provides the application of the aforementioned KASP primer set for detecting wheat stripe rust resistance at the adult stage in the detection of wheat stripe rust resistance at the adult stage. Specifically, by detecting the KASP markers flanking the wheat stripe rust resistance gene QYr076.jaas-4D.2 linked to it, the presence of QYr076.jaas-4D.2 in the hybrid progeny can be determined, thereby realizing its application in wheat stripe rust resistance breeding. The preferred wheat variety is the hybrid progeny of wheat PI660076.
[0022] Specifically, the aforementioned KASP molecular marker primer sets KASP_6535 and KASP_9130 were used to determine the genotype of the wheat samples to be tested:
[0023] 1) In KASP genotyping analysis, if the KASP molecular marker KASP_6535 shows red fluorescence in the sample, it indicates a homozygous genotype carrying the QYr076.jaas-4D.2 gene; if the sample shows green fluorescence, it indicates a heterozygous genotype C / A carrying the QYr076.jaas-4D.2 gene; and if the sample shows blue fluorescence, it indicates a susceptible genotype A / A carrying the QYr076.jaas-4D.2 gene.
[0024] 2) In KASP genotyping analysis, if the KASP molecular marker KASP_9130 shows blue fluorescence in the sample, it is a homozygous disease-resistant genotype A / A carrying the gene QYr076.jaas-4D.2; if the sample shows green fluorescence, it is a heterozygous genotype A / G carrying the gene QYr076.jaas-4D.2; and if the sample shows blue fluorescence, it is a disease-susceptible genotype G / G carrying the gene QYr076.jaas-4D.2.
[0025] If the molecular marker KASP_6535 allele is C / C and the molecular marker KASP_9130 allele is A / A, then the wheat being tested is determined to have resistance to adult stripe rust; if the molecular marker KASP_6535 allele is A / A and the molecular marker KASP_9130 allele is G / G, then the wheat being tested is determined to be a variety susceptible to adult stripe rust.
[0026] Third, this application provides the application of the above-mentioned KASP primer set for detecting wheat stripe rust resistance at adult stage in at least one of the following (1) to (3):
[0027] (1) Detection of wheat stripe rust resistance gene QYr076.jaas-4D.2 and its fine mapping and map-based cloning;
[0028] (2) Molecular marker-assisted selection of wheat stripe rust resistance gene QYr076.jaas-4D.2;
[0029] (3) Identify or breed wheat varieties resistant to stripe rust.
[0030] Fourth, this application provides a method for detecting resistance to stripe rust in mature wheat plants, the specific steps of which are as follows:
[0031] (1) Genomic DNA was extracted from the leaves of the wheat to be tested (preferably the hybrid offspring of wheat PI660076) as a template;
[0032] (2) PCR amplification of genomic DNA of the sample to be tested was performed using the KASP_6535 primer set and the KASP_9130 primer set, respectively, to obtain amplification products; the amplification products were centrifuged and the bottom of the PCR reaction plate was observed to ensure that there were no air bubbles.
[0033] (3) Use a real-time PCR instrument (Quan Studio 5) to scan the fluorescence signal of the PCR amplification product genotype;
[0034] (4) Perform genotypic analysis on the scan results using the software included with Quan Studio 5;
[0035] (5) Genotyping of wheat samples to be tested is performed according to polymorphic locus gene typing:
[0036] a) In KASP genotyping analysis, if the KASP molecular marker KASP_6535 primer set shows red fluorescence in the sample, it is a homozygous genotype C / C carrying the QYr076.jaas-4D.2 gene; if the sample shows green fluorescence, it is a heterozygous genotype C / A carrying the QYr076.jaas-4D.2 gene; if the sample shows blue fluorescence, it is a susceptible genotype A / A carrying the QYr076.jaas-4D.2 gene.
[0037] 2) In KASP genotyping analysis, if the KASP molecular marker KASP_9130 primer set shows blue fluorescence in the sample, it is a homozygous disease-resistant genotype A / A carrying the QYr076.jaas-4D.2 gene; if the sample shows green fluorescence, it is a heterozygous genotype A / G carrying the QYr076.jaas-4D.2 gene; and if the sample shows blue fluorescence, it is a disease-susceptible genotype G / G carrying the QYr076.jaas-4D.2 gene.
[0038] If the molecular marker KASP_6535 allele is C / C and the molecular marker KASP_9130 allele is A / A, then the wheat being tested is determined to have resistance to adult stripe rust; if the molecular marker KASP_6535 allele is A / A and the molecular marker KASP_9130 allele is G / G, then the wheat being tested is determined to be a variety susceptible to adult stripe rust.
[0039] In step (2) above, the PCR amplification reaction system (10 μl) for the KASP_6535 primer set is as follows: 2 μL template DNA (concentration of 30 ng / μL), 5 μL HiGeno 2x Probe Mix (Beijing Jiacheng Biotechnology Co., Ltd.), and KASP primer mixture 1 to 10 μl.
[0040] The above KASP primer mixture 1 is prepared as follows: upstream primer 1, upstream primer 2, universal primer 1 and ddH2O are mixed in a volume ratio of 12:12:30:46 and then homogenized. The concentrations of upstream primer 1, upstream primer 2 and universal primer 1 are all 100 μm.
[0041] The PCR amplification reaction system (10 μl) for the KASP 9130 primer set is as follows: 2 μL template DNA (concentration of 30 ng / μL), 5 μL HiGeno 2x Probe Mix (Beijing Jiacheng Biotechnology Co., Ltd.), and KASP primer mixture 2 to a final volume of 10 μl.
[0042] The above KASP primer mixture 2 is prepared as follows: upstream primer 3, upstream primer 4, universal primer 2 and ddH2O are mixed in a volume ratio of 12:12:30:46; the concentration of upstream primer 3, upstream primer 4 and universal primer 2 is 100 μm.
[0043] In step (2), the PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 61℃ gradient annealing and extension for 40 s, for a total of 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ in each cycle; 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, for a total of 30 cycles.
[0044] In this application, varieties with an IT (Influence Type) of 0-3 are classified as wheat varieties resistant to stripe rust at the adult stage, varieties with an IT of 4-6 are classified as wheat varieties moderately resistant to stripe rust at the adult stage, and varieties with an IT of 7-9 are classified as wheat varieties susceptible to stripe rust at the adult stage.
[0045] PI660076 is a spring wheat line. Previous studies have found that PI660076 exhibits resistance at the adult stage, thus necessitating the identification and mapping of its resistance QTLs. In this study, 208 F7 recombinant inbred lines were constructed by crossing PI660076 with AvS, and genotyping was performed genome-wide using a 15K SNP array. Combined with genotypic variation and phenotypic identification of stripe rust in the field (Figure 1), the stripe rust resistance gene in PI660076 was molecularly mapped. Simultaneously, a KASP marker was developed based on the SNP markers to facilitate subsequent high-throughput marker-assisted selection breeding.
[0046] Compared with existing molecular markers for wheat stripe rust, the advantages of this invention are:
[0047] (1) Good resistance to stripe rust: This invention discloses for the first time the adult-stage stripe rust resistance gene QYr076.jaas-4D.2 from the new common wheat line PI660076, located on wheat chromosome 4D. QYr076.jaas-4D.2 exhibits stable resistance to wheat stripe rust and can be detected in five environments; it contributes significantly, explaining 7.97%-39.19% of the reactive phenotypic variation and 8.77%-20.55% of the severity phenotypic variation. This gene has high utilization value in wheat stripe rust resistance breeding.
[0048] (2) High precision: This invention discloses KASP molecular markers KASP_6535 and KASP_9130 linked to the stripe rust resistance gene in mature wheat plants. These two molecular markers are flanking markers of QYr076.jaas-4D.2, with a genetic distance of 7.41 cM, indicating high linkage. During the breeding process, PCR amplification is performed using specific primer combinations of the above markers, resulting in high accuracy in marker-assisted selection of the stripe rust resistance gene QYr076.jaas-4D.2. (3) High detection throughput: The linked molecular markers disclosed in this invention are KASP markers, which can overcome the limitations of gel electrophoresis and increase the detection throughput by thousands of times. In marker-assisted breeding, disease-resistant individual plants can be quickly screened, improving the efficiency of breeding work.
[0049] (4) Codominant markers: Unlike those that can only distinguish between susceptible and resistant single plants, the linked molecular markers disclosed in this invention are codominant markers, which can distinguish between homozygous and heterozygous resistant genotypes that also show resistance to disease. They have higher accuracy in fine mapping, map-based cloning and marker-assisted breeding of the stripe rust gene QYr076.jaas-4D.2. Attached Figure Description
[0050] Figure 1 shows photographs of the stripe rust resistance of mature leaves of PI660076, AVS and some RIL populations.
[0051] Figure 2 shows the location of the wheat stripe rust resistance gene QYr076.jaas-4D.2 on chromosome 4DL during the adult stage of Example 1.
[0052] Figure 3 shows the genotyping results of wheat samples detected by KASP molecular markers KASP_6535 and KASP_9130 in Example 3; where A is the genotyping map of wheat samples detected by KASP molecular marker KASP_6535; and B is the genotyping map of wheat samples detected by KASP molecular marker KASP_9130. Detailed Implementation
[0053] To make the objectives, technical solutions, and superior effects of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. Any modifications or substitutions made to the methods, steps, or conditions of this invention without departing from the spirit and substance of this invention are within the scope of this invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.
[0054] Sources of biological materials in the examples:
[0055] PI660076 is a reported resistant spring wheat line, as described in the literature "Registration of 70 common spring wheat germplasm lines resistant to stripe rust. Wang et al. J. Plant Regist. 6:104-110, 2012"; the applicant's laboratory obtained it from the Wheat Research Institute of the College of Life Sciences and Engineering, Mianyang City, Sichuan Province.
[0056] AVS is a publicly available control spring wheat variety susceptible to wheat stripe rust, both domestically and internationally. It is susceptible to all known wheat stripe rust pathogens. The applicant's laboratory obtained it from the Wheat Research Institute of the College of Life Sciences and Engineering, Mianyang City, Sichuan Province. In the examples, after crossing PI660076 and AVS, the resulting hybrid F1 was self-pollinated to obtain the F2 population. Through multiple generations of self-pollination combined with greenhouse extension, up to the F7 generation, a recombinant inbred line population containing 208 families was obtained.
[0057] SNP microarray analysis of wheat 15K: Microarray analysis yielded 3494 polymorphic SNP loci among parents, which were used to construct a linkage map. The total length of the map was 14025.4 cM, with individual chromosomes ranging from 473.5 cM on chromosome 6D to 828.9 cM on chromosome 3B. The number of markers per chromosome varied from 40 on chromosome 4B to 710 on chromosome 2A, with an average of 166 SNP markers. The average distance between adjacent SNP markers ranged from 1.1 cM / marker on chromosome 2A to 16.8 cM / marker on chromosome 4B, with an average distance of 6.9 cM. This map was used to determine a significant association between SNP markers and stripe rust resistance.
[0058] All primers used in the following examples were synthesized by Nanjing Qingke Biotechnology Co., Ltd.
[0059] Example 1: Discovery of the stripe rust resistance gene QYr076.jaas-4D.2 in mature PI660076 plants.
[0060] 1. Identification of resistance to stripe rust in mature wheat plants
[0061] Stripe rust identification was conducted using natural field occurrence. Response tests of RIL populations and parents to naturally occurring stripe rust were performed in Mianyang, Sichuan (MY) in 2019, 2020, 2021, and 2022, and in Yangling, Shaanxi (YL) in 2020. In these field trials, each trial was designed using a randomized complete block design, with three replicates per location. Each experimental plot consisted of a single row 1 meter long, with a distance of 25 cm between adjacent rows. Approximately 40 RIL seeds were inoculated into each plot, and one parent was inoculated every 60 rows to test the uniformity of stripe rust infection. A row of AvS plants was sown around each plot as stripe rust inducers. Infection type (IT) and disease severity (DS) data were collected when some susceptible lines of the susceptible parent AvS and RIL populations were fully infected. The classification criteria for susceptibility response type (IT) were based on a 0-9 scale. Disease severity (DS) refers to the percentage of diseased area in the leaves (classified as 0%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%). The classification is based on Line & Qayoum, (1992) Virulence, aggressiveness, evolution, and distribution of races of Puccinia striiformis (the cause of stripe rust of wheat) in North America, 1968-87. Technical Bulletin Number 1788. United States Department of Agriculture, Agricultural Research Service. For genes with major resistance, a reaction type (IT) of 0-3 is generally considered a homozygous resistance genotype (resistant), an IT of 4-6 a heterozygous resistance genotype (moderately resistant), and an IT of 7-9 a homozygous susceptible genotype (susceptible).
[0062] Table 1. Classification of wheat population resistance (infectivity) to stripe rust.
[0063]
[0064] Figure 1 shows the stripe rust resistance of mature leaves of PI660076, AVS and some RIL populations.
[0065] 2. Construction of genetic linkage maps
[0066] Genotyping analysis of the RIL population was performed using a wheat 15K SNP chip, and a marker-score matrix was created in Excel. For map analysis, associations between disease trait data and marker data were calculated using the Integral Interval Mapping (ICIM) method and IciMapping v4.1 software. Marker loss was performed using the "Bin" function, and genetic mapping was performed using the Kosambi mapping function. Phenotypic variation and correlation analysis were also performed using SAS 9.0. QTL analysis was performed based on the linear mean of individual experiments in each location-year environment. The threshold likelihood ratio (LOD) was set to 2.5 to indicate the significance of QTLs (P < 0.01). The physical location of QTLs was determined based on the physical location of the SNP markers associated with the QTLs. The IWGCS reference sequence v1.1 was used as a reference for constructing the physical map.
[0067] 3. Locating the resistance sites for stripe rust in mature plants
[0068] Using the stripe rust phenotypic data of the above populations, the Inclusive Composite Interval Mapping-ADD (ICIM-ADD) method in QTL IciMapping v4.1 was used to detect stripe rust resistance loci under the condition of a threshold LOD ≥ 2.5, i.e., genetic linkage mapping of the stripe rust resistance gene. The results are shown in Figure 2. A major and stably expressed wheat stripe rust resistance gene was located in the 7.41 cM region on chromosome 4D, which the applicant named "QYr076.jaas-4D.2".
[0069] QYr076.jaas-4D.2 exhibits stable resistance to wheat stripe rust, detectable in five environments; it contributes significantly, explaining 7.97%–39.19% of the reactive phenotypic variation and 8.77%–20.55% of the severity phenotypic variation.
[0070] Example 2: Obtaining KASP molecular markers
[0071] 1. Development of KASP molecular markers
[0072] To integrate the SNP molecular marker information linked to the stripe rust resistance gene QYr076.jaas-4D.2 obtained from the genetic map, KASP marker primers were designed for the SNPs using the online platform PolyMaker (http: / / polymarker.info / ), and chromosome-specific markers were then selected. For the designed KASP marker sequences, FAM or HEX fluorescent adapter sequences were added to the 5' end of the two upstream primers. The FAM fluorescent adapter sequence was 5'—GAAGGTGACCAAGTTCATGCT—3', and the HEX fluorescent adapter sequence was 5'—GAAGGTCGGAGTCAACGGATT—3'.
[0073] 2. Polymorphism screening of KASP molecular markers
[0074] We selected 32 subgroups from the parental PI660076, AVS, and “AVS×PI660076” RIL populations to verify the polymorphism of the KASP marker.
[0075] 3. Obtaining tightly linked molecular markers KASP_6535 and KASP_9130
[0076] Genotypic analysis of the “AVS×PI660076” RIL population was performed using polymorphic KASP molecular markers obtained through screening. Combined with stripe rust phenotypic identification data from the RIL population, composite interval mapping was used to obtain a dense genetic map of the adult stripe rust resistance gene QYr076.jaas-4D.2. The gene QYr076.jaas-4D.2 was further mapped to the KASP markers KASP_6535 and KASP_9130, with a genetic distance of 7.41 cM, and a physical location of 379.77–436.91 Mb in the RefSeqv1.1 genome version.
[0077] Example 3: Application of KASP molecular markers KASP_6535 and KASP_9130 in selecting the stripe rust resistance gene QYr076.jaas-4D.2 in adult plants.
[0078] 1. Based on the phenotypic data of stripe rust resistance identification in the field, 208 families of the RIL population obtained by crossing AVS×PI660076 were selected.
[0079] 2. KASP molecular marker amplification was performed on the DNA of 208 selected families and 2 parents (AVS×PI660076). The specific method was as follows:
[0080] (1) Genomic DNA was extracted from the above materials using the modified CTAB method (Yan et al., 2003 Resistance gene analog polymorphism markers co-segregating with the Yr5 gene for resistance to wheat stripe rust. Theor Appl Genet 106:636-643) as a template;
[0081] (2) PCR amplification of genomic DNA of the test samples was performed using specific primer combinations of KASP molecular markers KASP_6535 and KASP_9130 to obtain amplification products;
[0082] (3) The specific primer combination in step (2) above is prepared into a primer mixture according to the following method: the upstream primer 1, upstream primer 2 and downstream primer with a primer concentration of 100 μm are mixed with ddH2O in a volume ratio of 12:12:30:46 to obtain the primer mixture.
[0083] (4) The PCR amplification reaction system is as follows: DNA 2 μL (concentration 30 ng / μL) -1 The total mixture consisted of 5 μL of HiGeno 2xProbe Mix, 0.14 μL of primer mixture, and 3.0 μL of ddH2O, with a total volume of 10 μL.
[0084] (5) The PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, 61℃ gradient annealing and extension for 40 s, for a total of 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ in each cycle; 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, for a total of 30 cycles.
[0085] (6) Centrifuge the amplification product and observe the bottom of the PCR reaction plate to ensure there are no air bubbles.
[0086] (7) Use a real-time PCR instrument (Quan Studio 5) to scan the genotype of PCR amplification products and detect fluorescence signals;
[0087] (8) Use the software included in Quan Studio 5 to perform genotypic analysis on the scan results;
[0088] (9) Genotyping of the test samples was performed according to the polymorphic site gene typing. The genotyping results are shown in Figure 3. In Figure 3, A is the genotyping diagram of wheat samples detected by KASP molecular marker KASP_6535; B is the genotyping diagram of wheat samples detected by KASP molecular marker KASP_9130.
[0089] The methods for determining genotype are as follows:
[0090] ① In KASP genotyping analysis, if the KASP molecular marker KASP_6535 shows red fluorescence in the sample, it indicates a homozygous genotype C / C carrying the QYr076.jaas-4D.2 gene; if it shows green fluorescence, it indicates a heterozygous genotype C / A carrying the QYr076.jaas-4D.2 gene; and if it shows blue fluorescence, it indicates a susceptible genotype A / A carrying the QYr076.jaas-4D.2 gene.
[0091] ② In KASP genotyping analysis, if the KASP molecular marker KASP_9130 shows blue fluorescence in the sample, it is a homozygous disease-resistant genotype A / A carrying the gene QYr076.jaas-4D.2; if the sample shows green fluorescence, it is a heterozygous genotype A / G carrying the gene QYr076.jaas-4D.2; and if the sample shows blue fluorescence, it is a disease-susceptible genotype G / G carrying the gene QYr076.jaas-4D.2.
[0092] The method for determining the resistant phenotype is as follows (same as the determination criteria in Example 1):
[0093] The responsiveness (IT) was determined using a 0-9 scale. When the IT value was 0-3, the plant was resistant; when the IT value was 4-6, the plant was moderately resistant; and when the IT value was 7-9, the plant was susceptible.
[0094] Table 2. KASP markers KASP_6535 and KASP_9130 were detected in the populations of the resistant parent PI660076, the susceptible parent AVS, and the recombinant inbred lines (RILs) produced by their crosses. Genotypes, response types (IT), severity (DS), and resistance / susceptibility results were also presented.
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105] The experimental results showed that among the 208 population samples, the correlation between genotype and disease resistance was good (Table 2). Specifically, those genotypes amplified by KASP_6535 to CC and KASP_9130 to AA were disease-resistant; those genotypes amplified by KASP_6535 to AA and KASP_9130 to GG were disease-susceptible (HS); and those genotypes amplified by KASP_6535 to CA and KASP_9130 to GA were moderately resistant.
[0106] The above results indicate that the KASP molecular markers KASP_6535 and KASP_9130 of the adult-stage stripe rust resistance gene of the present invention can be used to track and detect the QYr076.jaas-4D.2 resistance gene locus in the offspring of other winter and spring wheat varieties crossed with the donor line PI660076 of the stripe rust resistance gene QYr076.jaas-4D.2. Furthermore, the KASP markers used for screening have high detection throughput and are easy to automate, which is beneficial to improving the efficiency of breeding work for stripe rust resistance.
[0107] The above embodiments are merely preferred embodiments of the present invention and are not intended to limit the present invention. Any non-substantial modifications or changes made to the above embodiments by those skilled in the art without departing from the spirit and scope of the present invention shall fall within the scope of protection claimed by the present invention.
Claims
1. A KASP primer set for detecting resistance to stripe rust in mature wheat plants, characterized in that, The primer set consists of the KASP_6535 primer set and the KASP_9130 primer set; the KASP_6535 primer set consists of upstream primer 1, upstream primer 2 and universal primer 1 with nucleotide sequences as shown in SEQ ID NO.1-SEQ ID NO.3 in sequence; the KASP_9130 primer set consists of upstream primer 3, upstream primer 4 and universal primer 2 with nucleotide sequences as shown in SEQ ID NO.4-SEQ ID NO.6 in sequence.
2. The application of the KASP primer set for detecting stripe rust resistance in mature wheat as described in claim 1 in detecting stripe rust resistance in mature wheat; wherein the wheat is a hybrid progeny of wheat PI660076.
3. The application as described in claim 2, characterized in that, KASP detection and genotyping were performed on the wheat samples using primer sets KASP_6535 and KASP_9130, respectively: 1) KASP genotyping of the wheat samples was performed using primer set KASP_6535. If red fluorescence was observed, the wheat sample was homozygous for genotype C / C; if green fluorescence was observed, the wheat sample was heterozygous for genotype C / A; if blue fluorescence was observed, the wheat sample was carrier genotype A / A; 2) KASP genotyping of the wheat samples was performed using primer set KASP_9130. If blue fluorescence was observed, the wheat sample was homozygous for genotype C / C; if green fluorescence was observed, the wheat sample was heterozygous for genotype C / A; if blue fluorescence was observed, the wheat sample was heterozygous for genotype A / A. The homozygous resistant genotype is A / A; if green fluorescence is observed, the wheat being tested carries the heterozygous genotype A / G; if red fluorescence is observed, the wheat being tested carries the susceptible genotype G / G; if the KASP_6535 primer set shows genotype C / C and the KASP_9130 primer set shows genotype A / A, the wheat being tested is determined to have resistance to adult stripe rust; if the KASP_6535 primer set shows genotype A / A and the KASP_9130 primer set shows genotype G / G, the wheat being tested is determined to be a variety susceptible to adult stripe rust.
4. The application of the KASP primer set for detecting wheat stripe rust resistance at the adult stage as described in claim 1 in at least one of the following (1) or (2), wherein the wheat is a hybrid offspring of wheat PI660076: (1) detecting the wheat stripe rust resistance gene QYr076.jaas-4D.2 and its fine mapping and map-based cloning; (2) identifying or breeding stripe rust resistant wheat varieties.
5. A method for detecting resistance to stripe rust in mature wheat plants, the specific steps of which are as follows: (1) Extracting genomic DNA from the leaves of the wheat to be tested as a template, wherein the wheat is a hybrid offspring of wheat PI660076; (2) Using the KASP_6535 primer set and the KASP_9130 primer set to perform PCR amplification on the genomic DNA of the sample to be tested, respectively, to obtain amplification products; (3) Using a fluorescence quantitative PCR detector to scan the fluorescence signal of the genotype of the amplification product obtained in step (2); (4) Analyzing the fluorescence signal obtained in step (3): 4.1) In the detection using the KASP_6535 primer set, if the fluorescence signal of the amplification product shows red fluorescence, then the wheat to be tested is homozygous genotype C / C; if it shows green fluorescence, then the wheat to be tested is heterozygous genotype C / A; if blue fluorescence is displayed, the wheat being tested carries the susceptible genotype A / A; 4.2) In the detection using the KASP_9130 primer set, if the amplification product shows blue fluorescence, the wheat being tested is a homozygous resistant genotype A / A; if green fluorescence is displayed, the wheat being tested carries the heterozygous genotype A / G; if red fluorescence is displayed, the wheat being tested is a susceptible genotype G / G; if the KASP_6535 primer set detection result is genotype C / C, and the KASP_9130 primer set detection result is genotype A / A, then the wheat being tested is determined to have resistance to stripe rust at the adult stage; if the KASP_6535 primer set detection result is genotype A / A, and the KASP_9130 primer set detection result is genotype G / G, then the wheat being tested is determined to be a susceptible variety of stripe rust at the adult stage.
6. The method as described in claim 5, characterized in that, Step (2) refers to the PCR amplification as follows: 1) In the KASP_6535 primer set detection, the PCR reaction system is: 2 μL of template DNA with a concentration of 30 ng / μL, 5 μL of HiGeno2x Probe Mix, and KASP primer mixture 1 to 10 μL; the KASP primer mixture 1 is prepared as follows: upstream primer 1 with nucleotide sequence as shown in SEQ ID NO.1, upstream primer 2 with nucleotide sequence as shown in SEQ ID NO.2, universal primer 1 with nucleotide sequence as shown in SEQ ID NO.3, and ddH2O are mixed at a volume ratio of 12:12:30:46; the concentrations of upstream primer 1, upstream primer 2, and universal primer 1 are all 100 μM; The PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, gradient annealing and extension at 61℃ for 40 s, for a total of 10 cycles, with the annealing and extension temperatures decreasing by 0.6℃ in each cycle; 95℃ denaturation for 20 s, annealing and extension at 55℃ for 40 s, for a total of 30 cycles; 2) In the KASP_9130 primer set detection, the PCR reaction system was: 2 μL template DNA at a concentration of 30 ng / μL, 5 μL HiGeno2x Probe Mix, and KASP primer mixture 2 to a final volume of 10 μL; the KASP primer mixture 2 was prepared as follows: upstream primer 3 with nucleotide sequence as shown in SEQ ID NO.4, upstream primer 4 with nucleotide sequence as shown in SEQ ID NO.5, and upstream primer 5 with nucleotide sequence as shown in SEQ ID NO. The universal primer 2 shown in NO.6 was mixed with ddH2O at a volume ratio of 12:12:30:46; the concentrations of upstream primer 3, upstream primer 4, and universal primer 2 were all 100 μM; the PCR amplification program was as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, gradient annealing and extension at 61℃ for 40 s, for a total of 10 cycles, with the annealing and extension temperatures decreasing by 0.6℃ in each cycle; 95℃ denaturation for 20 s, annealing and extension at 55℃ for 40 s, for a total of 30 cycles.
Citation Information
Patent Citations
SNP molecular marker linked with wheat stripe rust resistance gene QYr.sicau-1B-1 and application thereof
CN109706263A
KASP molecular marker linked with wheat stripe rust resistant QTL and application
CN113897457A