Antigen for PEDV subunit vaccine, its preparation method and vaccine

By expressing and optimizing PEDV S protein in CHO-K1 cells, the antigen used for PEDV subunit vaccines was prepared, and the problems of slow production of antibodies and low immune protection efficiency of existing vaccines were solved, achieving the effect of rapid production of high-level antibodies and efficient immune protection.

CN118496325BActive Publication Date: 2025-06-27SOUTH CHINA AGRICULTURAL UNIVERSITY +2
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202410623114.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-20
Publication Date
2025-06-27
Estimated Expiration
2044-05-20

AI Technical Summary

Technical Problem

The existing PEDV vaccines produce slow antibodies, have large immune side reactions, and have low immune protection efficiency.

Method used

CHO-K1 cells were used to express PEDV S protein, and antigens used for PEDV subunit vaccines were prepared by optimizing gene sequence and expression vectors, and the vaccine was prepared by mixing them with adjuvant.

Benefits of technology

This vaccine can quickly induce pig herds to produce high levels of specific antibodies, have small immune side reactions, high immune protection efficiency, and better biosafety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118496325B_ABST
    Figure CN118496325B_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of molecular biology, and specifically discloses an antigen for a PEDV subunit vaccine, a preparation method thereof, and a vaccine. Among them, the amino acid sequence of the antigen is shown in SEQ ID NO: 1, and it can be stably expressed by CHO-K1 cells. The present invention also prepares a PEDV subunit vaccine based on this antigen. This vaccine has the advantages of quickly stimulating the body to produce antibodies, having small immune side reactions, high immune antibody levels, high immune protection efficiency, and better biological safety compared with other vaccines, which is beneficial to the prevention, control and purification of PEDV.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and particularly to an antigen for a PEDV subunit vaccine, a preparation method thereof, and a vaccine. Background Art

[0002] Porcine Epidemic Diarrhea Virus (PEDV) can cause porcine epidemic diarrhea, manifested as diarrhea, vomiting, dehydration, etc., and is one of the important pathogens causing diarrhea and death in piglets. Pigs in other stages can carry the virus continuously after infection, causing serious economic losses to the pig farming industry around the world. The main prevention and control measure for PED is to immunize sows so that sows can produce maternal antibodies to protect piglets. Currently, the commercial evolved PEDV vaccines are mainly inactivated vaccines and attenuated vaccines, which produce antibodies slowly, have relatively large immune side effects, and low immune protection efficiency. Summary of the Invention

[0003] The technical problem to be solved by the present invention is to provide an antigen for a PEDV subunit vaccine and a preparation method thereof, which can induce pigs to rapidly produce high levels of specific antibodies, have small immune side effects, and high immune protection efficiency.

[0004] The present invention also provides a PEDV subunit vaccine, which produces antibodies quickly, has small immune side effects, high immune antibody levels, high protection efficiency, and better biological safety.

[0005] To solve the above technical problems, the present invention provides an antigen for a PEDV subunit vaccine, and its amino acid sequence is as shown in SEQ ID NO: 1.

[0006] The present invention also provides a preparation method of the above antigen for a PEDV subunit vaccine, which includes:

[0007] (1) Synthesize an optimized gene sequence; wherein, the optimized gene sequence is obtained by introducing a Kozac sequence with a nucleotide sequence as shown in SEQ ID NO: 2 (GCCACC) and an IgG k sequence with a nucleotide sequence as shown in SEQ ID NO: 3 at the 3' end of the PEDV S protein gene sequence with the signal peptide deleted; introducing a TEV sequence with a nucleotide sequence as shown in SEQ ID NO: 4, a linker1 sequence with a nucleotide sequence as shown in SEQ ID NO: 5, a T4 foldon sequence with a nucleotide sequence as shown in SEQ ID NO: 6, a linker2 sequence with a nucleotide sequence as shown in SEQ ID NO: 7, and a 6His tag with a nucleotide sequence as shown in SEQ ID NO: 8 at the 5' end;

[0008] (2) Clone the synthesized optimized gene sequence into the eukaryotic expression vector pIRES2-EGFP to obtain the recombinant plasmid pIRES2-EGFP-S t ;

[0009] (3) Transfect the recombinant plasmid pIRES2-EGFP-S t into CHO-K1 cells and screen to obtain a cell line stably expressing the S protein;

[0010] (4) Culture the cell line stably expressing the S protein, collect the culture product, and purify it to obtain the antigen for the PEDV subunit vaccine.

[0011] Preferably, in one embodiment, step (2) includes:

[0012] (2.1) Add the restriction enzyme cleavage site ECOR I (GAATTC, SEQ ID NO: 10) to the 3' end of the optimized gene sequence, add the stop codon (TGA, SEQ ID NO: 11), and the enzyme cleavage site BamHI (GGATCC, SEQ ID NO: 12) to the 5' end to obtain a gene sequence with the nucleotide sequence shown in SEQ ID NO: 9.

[0013] (2.2) Perform double digestion on the eukaryotic expression vector pIRES2-EGFP with ECORⅠ and BamHI to obtain fragment I;

[0014] (2.3) Connect the gene sequence and fragment I with T4 DNA ligase to obtain a ligation product;

[0015] (2.4) Transform the ligation product into Escherichia coli DH5α, expand and multiply, and then extract the plasmid to obtain the recombinant plasmid pIRES2-EGFP-S t .

[0016] As an improvement of the above technical solution, step (3) includes:

[0017] (3.1) Transfect the recombinant plasmid pIRES2-EGFP-S t into CHO-K1 cells using the transfection reagent Nulen PlusTransTM Transfection Reagent (Shanghai Norlai Biotechnology Co., Ltd., CT801);

[0018] (3.2) Screen with G418 antibiotic 2 to 4 times to obtain a cell line stably expressing the S protein.

[0019] As an improvement of the above technical solution, step (4) includes:

[0020] (4.1) After culturing the cell line stably expressing the S protein for 48 - 60 h, collect the cell supernatant;

[0021] (4.2) After ultrafiltration and chromatographic purification of the cell supernatant, obtain the antigen for the PEDV subunit vaccine.

[0022] Correspondingly, the present invention also discloses a recombinant plasmid, which is the above-mentioned recombinant plasmid pIRES2-EGFP-S t .

[0023] Correspondingly, the present invention also discloses a cell line, which is the above-mentioned cell line stably expressing the S protein.

[0024] Correspondingly, the present invention also discloses a PEDV subunit vaccine, which comprises the above-mentioned antigen for the PEDV subunit vaccine and an adjuvant.

[0025] As an improvement of the above technical solution, the adjuvant is selected from one or more of adjuvant 201, aluminum hydroxide gel adjuvant, Tween, and Span

[0026] Correspondingly, the present invention also discloses a preparation method of a PEDV subunit vaccine for preparing the above-mentioned PEDV subunit vaccine, which comprises:

[0027] Dilute the above-mentioned antigen for the PEDV subunit vaccine to a preset concentration;

[0028] Mix and emulsify the adjuvant and the diluted antigen.

[0029] Specifically, in one embodiment, the antigen is diluted with PBS, and the diluted concentration is 0.05 - 0.3 mg / mL, preferably 0.1 - 0.2 mg / mL.

[0030] Specifically, in one embodiment, the diluted antigen and the adjuvant are emulsified under stirring conditions, the stirring speed is 500 - 10000 rpm, and the emulsification time is 3 - 15 min; preferably, the stirring speed is 500 - 800 rpm, and the emulsification time is 3 - 6 min.

[0031] Specifically, in one embodiment, the diluted antigen and the adjuvant are mixed evenly to obtain the finished vaccine.

[0032] Specifically, the volume ratio of the diluted antigen to the adjuvant is 10 - 20:3 - 20; preferably 10 - 20:10 - 20.

[0033] Implementing the present invention has the following beneficial effects:

[0034] Based on in-depth analysis of the PEDV S protein, the present invention successfully expressed the PEDV S trimer protein using CHO-K1 cells, and prepared a PEDV subunit vaccine with it as the antigen. This vaccine has the advantages of stimulating the body to produce antibodies quickly, having fewer immune side effects, a high level of immune antibodies, a high immune protection efficiency, and better biosafety compared to other vaccines, which is beneficial for the prevention, control, and purification of PEDV. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 It is a test result diagram of the transformed colonies in Example 1; among them, 1 to 7 are the selected colonies respectively;

[0036] Figure 2 It is a test result diagram of the supernatant of the transfected cell line in Example 1; among them, 1 is the supernatant of blank CHO cells, 2 is the precipitate of blank CHO cells, and 3 is the supernatant of the stable transfection cell line;

[0037] Figure 3 It is a test result diagram of the piglet immunization experiment in Example 3;

[0038] Figure 4 It is a test result diagram of the sow immunization experiment in Example 3. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0039] To make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below in conjunction with the drawings and specific embodiments.

[0040] Example 1 PEDV S Protein Antigen and Its Preparation Method

[0041] This example provides a PEDV S protein antigen, whose amino acid sequence is shown as SEQ ID NO: 1. Its specific preparation method includes the following steps:

[0042] (1) Delete the signal peptide from the S protein gene sequence (the obtained sequence is shown as SEQ ID NO: 12), then introduce Kozac and IgGκ at the 3' end, and introduce TEV, linker1, T4 foldon, linker2, and 6His tag sequences at the 5' end. After codon optimization, synthesize the expression gene sequence

[0043] Kozac-IgGκ-S-TEV-linker1-foldon-linker2-6*His; add restriction enzyme cleavage sites ECOR I and BamHI at both ends of the gene sequence, and synthesize the gene sequence (SEQ ID NO: 9).

[0044] (2) Use restriction endonucleases ECORⅠ and BamHI to double-digest the eukaryotic expression vector pIRES2-EGFP to obtain a fragment with a size of 5241 bp;

[0045] Specifically, the enzyme digestion system is as follows:

[0046] Component Volume / Quantity pIRES2-EGFP plasmid 3 μg ECORⅠ 1.5 μL BamHI 1.5 μL Buffer 3 μL <![CDATA[H2O]]> Total to 30 μL

[0047] The reaction conditions are as follows: react at 37 °C in a metal bath for 3 - 4 h.

[0048] (3) Ligate the synthesized gene sequence and the eukaryotic expression vector pIRES2 - EGFP fragment recovered by double enzyme digestion with T4 DNA ligase to obtain a ligation product;

[0049] Specifically, the ligation system is as follows:

[0050] Component Volume / Quantity Linearized pIRES2-EGFP vector 200 ng Synthesized S gene ~165 ng 1 μL T4-HC (NEB#M0202M) 1 μL Buffer 2 μL <![CDATA[H2O]]> Total to 20 μL

[0051] The ligation reaction conditions are as follows: ligate overnight at 4 °C.

[0052] (4) Transform the ligation product in step 1 into Escherichia coli DH5α, pick colonies and verify positive clones by PCR method, and sequence verify the target fragment;

[0053] Specifically, the transformation conditions are as follows: Place the ligation product on ice. After DH5α is melted on ice, add the ligation product to 100 μL of competent cells, gently flick the tube wall to mix evenly, immediately place it in a 45 °C water bath for heat shock for 45 s, transfer it to ice for 1 min, then spread the transformed competent cells on a KanR+LB culture dish, and place the culture dish upside down in a 37 °C incubator for overnight culture. When colonies the size of a pinhead are visible to the naked eye, pick single colonies for expanded culture and PCR identification.

[0054] The PCR reaction system used for sequencing is as follows:

[0055] Component Volume / Quantity Template (bacterial solution) 1 μg PF (AGTACATGACCTTATGGGAC), located on the vector 1 μL PR (CGGTGATGTTGACGAAGC), located on the S optimized sequence 1 μL Taq enzyme 2xMix 10 μL <![CDATA[H2O]]> Total to 20 μL

[0056] The PCR reaction conditions are as follows: pre - denaturation: 95 °C, 3 min; denaturation: 95 °C, 15 s; annealing: 55 °C, 15 s; extension: 72 °C, 5 min; final extension: 72 °C, 1 min.

[0057] The results of PCR identification are as Figure 1 shown, and the product size is 1904 bp.

[0058] (5) Expand the positive colonies with KanR+ resistant LB medium and then extract the plasmid with an endotoxin - free plasmid extraction kit (OMEGA, D6950 - 01) to obtain the recombinant plasmid, and transfect the recombinant plasmid into CHO - K1 cells with the chemical transfection reagent Nulen PlusTransTM TransfectionReagent;

[0059] (6) Continuously screen the transfected cells with G418 drug (concentration 700 μg / mL) until a single cell population grows, pick the single cell population for flow cytometry cloning. Wait until the single cells cover the 96-well plate, then transfer them to a 24-well plate for expansion. When the cells cover the cell wells, collect the supernatant. Select the cells with the best expression efficiency to continue expansion, preservation, and the second round of screening. After 3 rounds of screening, obtain the stable transfected cell line expressing the S protein;

[0060] Specifically, inoculate the transfected cells into Ham’s F-12K + 10% FBS + 1% penicillin-streptomycin medium, add G418 with a concentration of 700 μg / mL, and culture and screen under the conditions of 37°C and 5% CO2.

[0061] (7) Culture the stable transfected cells to express the S protein, and collect the supernatant after 48 - 60 h;

[0062] Among them, inoculate the stable transfected cell line expressing the S protein into Ham’s F-12K + 5% FBS + 1% penicillin-streptomycin medium, culture for 48 - 60 h under the conditions of 37°C and 5% CO2, and then collect the supernatant.

[0063] (8) Ultrafilter and purify the cell supernatant by affinity chromatography to obtain the S protein antigen.

[0064] (9) Conduct SDS-PAGE inspection and concentration determination on the S protein antigen. The results show that the protein purity is higher than 90%, and the concentration is 0.15 mg / mL (reference Figure 2 ).

[0065] Example 2

[0066] This example provides the preparation of a genetically engineered subunit vaccine against porcine epidemic diarrhea virus, including the following steps:

[0067] (1) Preparation of the aqueous phase: Dilute the S protein stock solution to the specified concentration with PBS.

[0068] (2) Emulsification: Take 1 part of the oil phase (different adjuvants) and stir, then slowly add 1 part of the aqueous phase, and fuse according to the emulsification conditions in Table 1).

[0069] (3) Sub-packaging: Sterile quantitative sub-packaging, cover and seal, and store at 2 - 8°C.

[0070] Table 1 Vaccine components and vaccine preparation method table

[0071]

[0072] Measure the viscosity and particle size of the emulsified vaccine. The specific results are as follows in the table:

[0073] Table 2 Viscosity and particle size measurement of vaccines prepared with different formulations

[0074] Group Viscosity (cP) Particle size (μm) PEDV S protein + 201 adjuvant (25 μg / mL) 91.0 D50 7.483, D100 24.95 PEDV S protein + 201 adjuvant (40 μg / mL) 87.2 D50 6.533, D100 52.62 PEDV S protein + 201 adjuvant (50 μg / mL) 88.0 D50 6.817, D100 24.95 PEDV S protein + aluminum hydroxide adjuvant (25 μg / mL) 1.46 D50 9.546, D100 57.77 PEDV S protein + aluminum hydroxide adjuvant (40 μg / mL) 1.72 D50 9.791, D100 92.09 Commercial diarrhea inactivated vaccine 42.1 D50 0.209, D100 0.791 PBS / /

[0075] As can be seen from the table, the viscosity and particle size of the vaccine with adjuvant 201 are greater than those of the commercial inactivated and aluminum adjuvant vaccines. Therefore, adjuvant 201 is preferably used.

[0076] Vaccine Immunogenicity Experiment of Example 3

[0077] 1. Piglet Immunization Experiment

[0078] To evaluate the safety and immunogenicity of the diarrhea S protein, vaccines were formulated with different adjuvants, and a commercial vaccine control group was set up. 60 diarrhea antibody-negative piglets were immunized, and the grouping is shown in Table 3. The body temperature, diet, and mental state of the pigs were monitored daily to evaluate the safety of the vaccine. The serum ELISA antibodies and neutralizing antibodies of the pigs were detected at different times after immunization to evaluate the immunogenicity of the protein.

[0079] Table 3 Grouping of Piglet Immunization Experiment

[0080] Grouping Group Immunization dose ( / time) Number of animals (heads) 1 PEDV S protein + 201 adjuvant (1:1) 50 μg / head 5 2 PEDV S protein + 201 adjuvant (1:1) 80 μg / head 5 3 PEDV S protein + 201 adjuvant (1:1) 100 μg / head 5 4 PEDV S protein + aluminum hydroxide adjuvant (5:1) 50 μg / head 5 5 PEDV S protein + aluminum hydroxide adjuvant (5:1) 80 μg / head 5 6 Commercial diarrhea inactivated vaccine 2 mL / head 5 7 PBS 2 mL / head 5

[0081] Experimental Results Figure 3 As shown, it can be seen from the figure that the antibody level produced by the vaccine with adjuvant 201 after 7 days of immunization is significantly higher than that of the commercial inactivated vaccine, indicating that the vaccine of the present invention can produce antibodies faster. In addition, within 14 - 187 days after immunization, the antibody level produced by the vaccine with adjuvant 201 after 7 days of immunization is significantly higher than that of the commercial inactivated vaccine, indicating that the vaccine of the present invention has better immunogenicity. In addition, it can be seen from the figure that the vaccine with aluminum hydroxide adjuvant produces antibodies more slowly and the antibody level is lower.

[0082] 2. Sow Immunization Experiment

[0083] To evaluate the safety and immunogenicity of the diarrhea S protein, a vaccine was formulated with adjuvant 201, and a commercial vaccine control group was set up. 17 diarrhea antibody-negative sows were immunized, and the grouping is shown in Table 4. The body temperature, diet, and mental state of the pigs were monitored daily to evaluate the safety of the vaccine. The antibody level in the colostrum after parturition was measured after the second immunization. The piglets were challenged at 5 - 7 days of age after farrowing, and the diarrhea rate and mortality rate after challenge were counted. The specific experimental results are shown in Table 5 and Figure 4 as follows.

[0084] Table 4 Grouping of Sow Immunization Experiment

[0085]

[0086]

[0087] Table 5 Results of the Challenge Protection Experiment after Two Immunizations

[0088] Group Number of sows Total number of piglets Number of vomiting + diarrhea Number of survivors Number of deaths and culls Mortality rate Blank control 4 47 47 37 10 21.3 Competitor 1 4 49 40 40 9 18.4 Competitor 2 4 48 42 41 7 14.6 Subunit vaccine 5 60 26 59 1 1.7

[0089] As can be seen from Table 5 and Figure 4 : When using the subunit vaccine of the present invention, the number of surviving sows and the number of sows with side effects (vomiting + diarrhea) are significantly less than those of the currently commonly used PEDV vaccines. Moreover, the antibody level is also significantly higher than that of the existing PEDV vaccines. This indicates that the vaccine of the present invention has less immune side effects, a high immune antibody level, a high immune protection efficiency, and better biosafety.

[0090] The above is the preferred embodiment of the invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements are also regarded as the protection scope of the present invention.

Claims

1. A PEDV subunit vaccine, characterized in that: The invention comprises an antigen for a PEDV subunit vaccine and a 201 adjuvant; the amino acid sequence of the antigen for a PEDV subunit vaccine is shown in SEQ ID NO: 1; the antigen is encoded by an optimized gene sequence as shown in SEQ ID NO: 9, wherein the optimized gene sequence is a PEDV S protein gene sequence with a signal peptide deleted, and a Kozac sequence as shown in SEQ ID NO: 2 and an IgG sequence as shown in SEQ ID NO: 3 are sequentially introduced at the 3' end. k sequence; a TEV sequence as shown in SEQ ID NO: 4, a Linker1 sequence as shown in SEQ ID NO: 5, a T4 foldon sequence as shown in SEQ ID NO: 6, a Linker2 sequence as shown in SEQ ID NO: 7, and a 6His tag as shown in SEQ ID NO: 8 are sequentially introduced at the 5' end; The antigen for the PEDV subunit vaccine is diluted to a concentration of 0.05 to 0.3 mg / mL; The volume ratio of the diluted antigen to 201 adjuvant is (10-20): (10-20).

2. The PEDV subunit vaccine according to claim 1, characterized in that The method for preparing the antigen for the PEDV subunit vaccine comprises: (1) Synthesize and optimize gene sequences; (2) The optimized gene sequence synthesized was cloned into the eukaryotic expression vector pIRES2-EGFP to obtain the recombinant plasmid pIRES2-EGFP-S t ; (3) The recombinant plasmid pIRES2-EGFP-S t Transfect CHO-K1 cells and screen for cell lines that stably express the S protein; (4) Cultivating the cell line stably expressing the S protein, collecting the culture product, and purifying it to obtain the antigen for PEDV subunit vaccine.

3. The PEDV subunit vaccine according to claim 2, characterized in that Step (2) comprises: Adding a restriction enzyme cleavage site ECORI to the 3' end of the optimized gene sequence, and adding a stop codon and an enzyme cleavage site BamHI to the 5' end, to obtain a gene sequence as shown in SEQ ID NO: 9; The eukaryotic expression vector pIRES2-EGFP was double-digested with ECORⅠ and BamHI to obtain fragment I; Connecting the gene sequence and fragment I using T4 DNA ligase to obtain a connection product; The ligation product was transformed into Escherichia coli DH5α, and the plasmid was extracted after expansion to obtain the recombinant plasmid pIRES2-EGFP-S t .

4. The PEDV subunit vaccine according to claim 2, characterized in that Step (3) includes: The recombinant plasmid pIRES2-EGFP-S t Transfected into CHO-K1 cells using Nulen PlusTransTM Transfection Reagent; After 2 to 4 rounds of screening with G418 antibiotic, a cell line stably expressing the S protein was obtained.

5. The PEDV subunit vaccine according to claim 2, characterized in that Step (4) comprises: After culturing the cell lines stably expressing the S protein for 48 to 60 hours, the cell supernatant was collected; The cell supernatant is purified by ultrafiltration and chromatography to obtain the antigen for PEDV subunit vaccine.

6. A method for preparing a PEDV subunit vaccine, for preparing the PEDV subunit vaccine according to any one of claims 1 to 5, characterized in that: include: Diluting the antigen for PEDV subunit vaccine according to claim 1 to a preset concentration; The adjuvant and diluted antigen are mixed and emulsified.

Citation Information

Patent Citations

  • Construction and application of bispecific antibody HER2*CD3

    CN104829728A

  • Porcine epidemic diarrhea virus S protein, subunit vaccine thereof, preparation method of subunit vaccine, and applications of porcine epidemic diarrhea virus S protein and subunit vaccine

    CN108822191A

  • Porcine epidemic diarrhea virus S protein mutant, nucleic acid molecule, subunit vaccine and application

    CN119409779A