A molecular marker related to hydraulic traits of pork and its application
By detecting the C/T polymorphic sites of the FGGY gene, excellent hydraulic type pigs were screened, which solved the problem of difficulty in improving the hydraulic power of pork in the prior art, and achieved efficient breeding and meat quality improvement.
Patent Information
- Application Number
- CN202410694026.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2023-10-24
- Filing Date
- 2024-05-31
- Publication Date
- 2025-02-11
- Estimated Expiration
- 2044-05-31
AI Technical Summary
The prior art is difficult to effectively improve the hydraulic power of pork, affecting the sensory quality of meat products and consumers' desire to buy.
By detecting the C/T polymorphic sites at position 160 of the nucleotide sequence of the FGGY gene, CC and TC pigs were screened as excellent hydraulic individuals and used for breeding to improve the hydraulic power of pork.
Effective screening and breeding of the hydraulic traits of pork system has been achieved, breeding costs have been reduced, and the water retention ability and quality of pork has been improved.
Smart Images
Figure BDA0004869145670000071 
Figure HDA0004869145680000011
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biological detection, and in particular relates to a molecular marker related to hydraulic traits of pork and an application thereof. Background Art
[0002] Pork quality is an important economic trait of pigs. It is an important prerequisite for meeting consumers' demand for meat nutrition and meat processing. Therefore, improving pork quality is one of the important goals of pig breeding. Water holding capacity (WHC) is an important evaluation parameter of pork quality. It mainly reflects the ability of pork muscle tissue to maintain inherent moisture through a series of physiological and biochemical reactions after slaughter. Water holding capacity is mainly evaluated by measuring drip loss (DL), which mainly detects the rate of weight loss caused by the natural slow seepage of water in the muscle due to gravity. Therefore, it is generally believed that meat with lower water holding capacity often shows higher drip loss, which will directly affect the sensory quality of meat products and ultimately affect consumers' purchasing desire. Therefore, improving pork water holding capacity remains a major challenge facing the pork production and meat processing industries.
[0003] The main factors affecting muscle water retention include glycogenolysis, a decrease in protein net charge content caused by a decrease in pH, and muscle protein contraction. After slaughter, muscles change from an aerobic state to an anaerobic state, and muscle glycogen generates lactic acid under anaerobic respiration; at the same time, non-contractile myosin consumes adenosine triphosphate (ATP) to generate inorganic phosphorus, which further stimulates glycogenolysis to lactic acid, resulting in a large accumulation of lactic acid in the muscles after slaughter, which in turn leads to a decrease in muscle pH. The decrease in pH will cause protein denaturation, which will change the net charge carried by muscle protein, thereby affecting the binding force of water in the muscles and causing water loss in the muscles.
[0004] The FGGY gene encodes a series of carbohydrate kinases, such as fucokinase, glucuronate kinase, glycerol kinase, ribulose kinase, and xylulose kinase, which phosphorylate their corresponding sugar substrates. Existing GWAS literature has identified the correlation between FGGY gene polymorphism and human amyotrophic lateral sclerosis (ALS) and average daily gain (ADG) traits in Nellore cattle. In addition, studies have confirmed that FGGY can express at least four alternative splicing variants in myoblasts and play a regulatory role in muscle atrophy through MAPK and PI3K-Akt signaling pathways. At the same time, in the study of long non-coding RNA (lincRNA) related to pig muscle growth, FGGY was found to be a potential target gene involved in muscle growth. Therefore, as a key carbohydrate kinase, FGGY may be involved in the metabolic process of anaerobic glycolysis in post-slaughter muscle and can be used as a candidate gene for muscle hydraulics, but the specific relationship between this gene and muscle hydraulics traits is not clear. Summary of the invention
[0005] In order to solve the above technical problems, the present invention provides a molecular marker related to the hydraulic traits of pork and its application.
[0006] To achieve the above object, the present invention adopts the following technical solutions:
[0007] A molecular marker related to the hydraulic trait of pork, wherein the molecular marker is the 160th position of the nucleotide sequence shown in SEQ ID NO.1, the Y of the position is C or T, and has C / T polymorphism, when the genotype is CC and TC type, the drip loss of pork is significantly lower than that of TT type individuals. Furthermore, the drip loss of CC type is lower than that of TC type, and homozygous CC is selected during breeding to cultivate pigs with higher hydraulic capacity.
[0008] A primer pair for detecting the molecular markers related to the hydraulic trait of pork as described above is used in screening pigs with superior hydraulic trait. Further, the primer pair includes the nucleotide sequences shown in SEQ ID NO.2 and SEQ ID NO.3.
[0009] A kit for detecting molecular markers related to hydraulic traits of pork, comprising the primer pair for detecting molecular markers related to hydraulic traits of pork as described above.
[0010] Furthermore, the primer pair is a primer pair for PCR amplification; wherein the sequences of the primer pair for PCR amplification are shown in SEQ ID NO.2 and SEQ ID NO.3.
[0011] A method for selecting pigs with excellent water retention ability comprises the following steps:
[0012] S1. Extract genomic DNA from pig blood or ear tissue samples;
[0013] S2, performing PCR amplification on the extracted genomic DNA using the primers described above for detecting the molecular markers associated with the hydraulic traits of pork;
[0014] S3. Identify the polymorphic sites of the amplified products.
[0015] In the method described above, preferably, in step S2, the final concentrations of the PCR amplification system are 3-10 ng / μl of genomic DNA template, 1×PCR amplification buffer, 10 mM dNTPs, 1 ng / μl of upstream and downstream primers, 0.015 U / μl of Taq DNA polymerase, and Mg 2+ 2.5mmol / L.
[0016] In the method as described above, preferably, in step S2, the PCR amplification program is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 50 s, for a total of 35 cycles; and finally extension at 72°C for 2 min.
[0017] In step 3), the identification method uses sequencing to identify the polymorphic sites.
[0018] The identification method uses sequencing to obtain a sequence such as SEQ ID NO.1. When the 160th position of the nucleotide sequence is C, it means that the individual with the CC genotype at the polymorphic site has a lower drip loss, that is, better water holding capacity.
[0019] The present invention uses a sequencing method to detect the base at the 160th position of the nucleotide sequence shown in SEQ ID NO.1, i.e., the g.152858710C>T polymorphic site (SSC 6g.152858710C>T) on chromosome 6 of the pig reference genome Sscrofa11.1, to determine the genotype of individual pigs, thereby selecting the drip loss trait of pork, and obtaining pigs with less drip loss.
[0020] The molecular markers, kits and methods related to the hydraulic trait of pork are used in pig breeding. Further, the breeding is to select pigs with higher hydraulic strength in pork, and when the genotype at position 160 of the nucleotide sequence shown in SEQ ID NO.1 is CC type, the muscle hydraulic strength is significantly higher than that of the genotype TT type.
[0021] The beneficial effects of the present invention are:
[0022] By utilizing the primer pair or kit provided by the present invention for detecting molecular markers related to the hydraulic traits of pork to amplify and detect the FGGY gene, the genotype of the sample to be tested is determined, and a preliminary association analysis between the genotype and the drip loss of pigs, i.e., the hydraulic trait, is performed, thereby providing a new molecular marker for molecular marker-assisted selection of pigs and a new technical means for screening pigs with low drip loss.
[0023] The method for screening pigs with excellent water-holding capacity provided by the present invention can be used for early screening of pigs, effectively solving the problem that muscle drip loss in actual production cannot be measured in vivo for screening, thereby reducing breeding costs. The method has high accuracy, low detection cost, and can realize automated detection, and has high practical application value in pig breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 These are the sequencing results of the sequences near the g.152858710C>T polymorphic site on chromosome 6 of the pig reference genome Sscrofa11.1 for CC genotype individuals and TT genotype individuals. DETAILED DESCRIPTION
[0025] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the present invention all belong to the scope of the present invention.
[0026] Unless otherwise specified, the technical means used in the embodiments of the present invention are conventional means well known to those skilled in the art.
[0027] Example 1
[0028] 1. Determination of the polymorphic site of porcine SSC 6g.152858710C>T
[0029] (1) Eight Beijing black pigs were used as experimental materials, and the genomic DNA of their ear margin tissues was extracted using a DNA extraction kit.
[0030] (2) Primer design and synthesis
[0031] According to the sequence of the pig reference genome 11.1, the following primers were designed and synthesized for the FGGY gene:
[0032] U (upstream primer): 5′-TGGTCTGCTCAGTTCACTAAACTCA-3′ (SEQ ID No. 2);
[0033] D (downstream primer): 5'-CATGGGACTTCATCACCCCTCTGAG-3' (SEQ ID No. 3)
[0034] (3) PCR amplification
[0035] The genomic DNA of Beijing black pig obtained in step (1) was used as a template and U and D were used as primers to perform PCR amplification to obtain PCR amplification products.
[0036] PCR amplification system: 80 ng genomic DNA template, 2 μl 10× PCR amplification buffer, 10 mM dNTPs final concentration, 20 ng upstream and downstream primers, 0.3 U Taq DNA polymerase, Mg 2+
[0037] 2.5mmol / L, using ddH 2 0 to make up the system to 20 μl.
[0038] PCR amplification program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 50 s, for a total of 35 cycles; and final extension at 72°C for 2 min.
[0039] (4) Sequencing and sequence analysis
[0040] The PCR amplification products were sequenced to obtain product 1 as shown in SEQ ID No.4 and product 2 as shown in SEQ ID No.5. There was only one base difference between SEQ ID No.4 and SEQ ID No.5, which was C or T at the 160th position from the 5' end in both SEQ ID No.4 and SEQ ID No.5. The sequence comparison results of the eight samples were as follows: Figure 1 As shown by the middle arrow, the site is the 152858710th base from the 5′ end on chromosome 6 of the pig reference genome Sscrofa11.1 (the pig reference genome sequence in the GenBank database on February 7, 2017), so the site is named SSC 6g.152858710C>T, which is specifically the 160th site of the nucleotide sequence shown in SEQ ID NO.1, and Y at this site is C or T.
[0041] Wherein SEQ ID NO.1:
[0042] TGGTCTGCTCAGTTCACTAAACTCAGTAAAGACTGTTGATGCTTGACAAGAGGACACTGCCGCAGTGGCATCGAGGTGAATCTTAATGTTCAATTTATTACTTTTAGCTAGCCTGCTCAAGTAGCTAAAAATCAGAGGTCACTAGGAAGACCAAAAGCTYAAAGGCCACACATCATTATTTATTTGAGATAAGGATTAAAAACAAAAAGATGAACTGCAATATGACCTCAGGAGGCAGCTGCGTGGCAATGTCTGAGGGAGTGGCTCTGGGGAGAAATGAGGGAGAGAGTTTTTGGGTGGAGAGACAGCCCTTGAGATGTTTAGTGAGTGAGCAACTCAGAGGGGTGATGAAGTCCCATG
[0043] SEQ ID No.4:
[0044] TGGTCTGCTCAGTTCACTAAACTCAGTAAAGACTGTTGATGCTTGACAAGAGGACACTGCCGCAGTGGCATCGAGGTGAATCTTAATGTTCAATTTATTACTTTTAGCTAGCCTGCTCAAGTAGCTAAAAATCAGAGGTCACTAGGAAGACCAAAAGCTCAAAGGCCACACATCATTATTTATTTGAGATAAGGATTAAAAACAAAAAGATGAACTGCAATATGACCTCAGGAGGCAGCTGCGTGGCAATGTCTGAGGGAGTGGCTCTGGGGAGAAATGAGGGAGAGAGTTTTTGGGTGGAGAGACAGCCCTTGAGATGTTTAGTGAGTGAGCAACTCAGAGGGGTGATGAAGTCCCATG
[0045] SEQ ID No.5:
[0046] TGGTCTGCTCAGTTCACTAAACTCAGTAAAGACTGTTGATGCTTGACAAGAGGACACTGCCGCAGTGGCATCGAGGTGAATCTTAATGTTCAATTTATTACTTTTAGCTAGCCTGCTCAAGTAGCTAAAAATCAGAGGTCACTAGGAAGACCAAAAGCTTAAAGGCCACACATCATTATT TATTTGAGATAAGGATTAAAAACAAAAAGATGAACTGCAATATGACCTCAGGAGGCAGCTGCGTGGCAATGTCTGAGGGAGTGGCTCTGGGGAGAAATGAGGGAGAGAGTTTTTGGGTGGAGAGACAGCCCTTGAGATGTTTAGTGAGTGAGCAACTCAGAGGGGTGATGAAGTCCCATG
[0047] The individual whose base 152858710 from the 5' end on chromosome 6 of the pig reference genome Sscrofa11.1 (or the 160th base from the 5' end of the PCR amplification product obtained in step (4)) is C is a homozygous individual, and the genotype of the individual is named CC. The individual whose base 152858710 from the 5' end on chromosome 6 of the pig reference genome Sscrofa11.1 (or the 160th base from the 5' end of the PCR amplification product obtained in step (4)) is T is a homozygous individual, and the genotype of the individual is named TT. The individual whose base 152858710 from the 5' end on chromosome 6 of the pig reference genome Sscrofa11.1 (or the 160th base from the 5' end of the PCR amplification product obtained in step (iii)) is C and T is a heterozygous individual, and the genotype of the individual is named CT.
[0048] 2. Association analysis between the porcine SSC 6g.152858710C>T polymorphism and drip loss in pork
[0049] In order to determine whether the SSC 6g.152858710C>T polymorphism is associated with the drip loss trait of pork, 729 Beijing black pigs purchased from Beijing Heiliu Animal Husbandry Technology Co., Ltd. were used as experimental materials and the following experiments were conducted:
[0050] S1. Extract genomic DNA from the ear margin tissue of each pig, perform PCR amplification according to the method in step 1 (3) to obtain each PCR amplification product, and determine whether the genotype of each pig is CC, CT or TT according to the method in step 1 (4).
[0051] S2. Referring to the method of G Otto, R Roehe, H Looft, L Thoelking, E Kalm, Comparison of different methods for determination of drip loss and their relationships to meat quality and carcass characteristics in pigs. Meat Science, Volume 68, Issue 3, 2004, Pages 401-409, ISSN 0309-1740, (https: / / doi.org / 10.1016 / j.meatsci.2004.04.007), the drip loss of the longissimus dorsi muscle of Beijing black pigs at the 3rd to 4th last thoracic vertebrae at 24 and 48 h after slaughter was determined by the bagging method. The pH value, meat color value (L*, a* and b* values) and intramuscular fat content of the longissimus dorsi muscle of Beijing black pigs were also determined 2h and 24h after slaughter.
[0052] S3. Single factor least squares association analysis was conducted on pig genotype and pork drip loss. The model used was as follows:
[0053] Y=S+G+e
[0054] Where Y is the trait measurement value, S is the sex effect, G is the genotype effect, and e is the residual effect.
[0055] The results are shown in Table 1.
[0056] Table 1 Association analysis between pig SSC 6g.152858710C>T genotype and pork dripping traits
[0057]
[0058] Note: Different letters in the same column indicate significant differences (P<0.05).
[0059] Table 1 shows that in the drip loss trait of pork, the TT genotype is significantly greater than the CT genotype and CC genotype (P<0.05). There is no significant difference in drip loss between the CT genotype and the CC genotype, but the CC homozygous individuals have lower drip loss and can be selected for the breeding of high-water-powered pigs.
[0060] The results show that the polymorphism of base 152858710 from the 5' end on chromosome 6 of the pig reference genome Sscrofa11.1 used in the present invention is closely related to pork drip loss. In actual pig breeding, in order to obtain pigs with smaller drip loss, it is best to select pigs with CC genotype for breeding.
[0061] In addition, genomic DNA was extracted from the blood samples of the above 8 black pigs for verification, and PCR amplification was performed using the primer pair shown in SEQ ID NO.2 and SEQ ID NO.3. The amplification conditions and procedures were as described above. The PCR amplification products were sequenced, and the sequencing results obtained 2 genotypes. The drip loss of the longissimus dorsi muscle of the 8 black pigs was measured, as shown in Table 2. The relationship between the genotype results and the drip loss corresponds to the above TT genotype. The drip loss is significantly greater than that of the CC genotype, and the CC genotype has the smallest drip loss, which is consistent with the results of the above 729 Beijing black pigs.
[0062] Table 2
[0063] Serial number genotype Dripping loss 24h (%) Dripping loss 48h (%) 1 CC 0.31 1.10 2 CC 0.47 1.05 3 CC 0.36 1.01 4 CC 0.33 1.04 5 TT 0.45 1.97 6 TT 3.19 4.93 7 TT 2.25 4.36 8 TT 0.92 2.62
[0064] The results showed that when the genotype at position 160 of the nucleotide sequence shown in SEQ ID NO.1 was CC, its muscle system hydraulic strength was significantly higher than that of the genotype of TT. Therefore, selecting CC homozygous pigs to enter the core group can be used to breed pig breeds with higher muscle system hydraulic strength to improve the quality of pork and save breeding time.
Claims
1. A primer pair for detecting molecular markers related to hydraulic traits of pork in screening pigs with superior hydraulic traits, characterized in that: The molecular marker is the 160th position of the nucleotide sequence shown in SEQ ID NO.1, and the Y of the position is C or T, with C / T polymorphism. When the genotype is CC and TC, the drip loss of pork is significantly lower than that of TT type individuals.
2. The use according to claim 1, characterized in that: The primer pair includes the nucleotide sequences shown as SEQ ID NO.2 and SEQ ID NO.
3.
3. Use of a kit for detecting molecular markers related to hydraulic traits of pork in pig breeding, characterized in that: The kit comprises the primer pair for detecting the molecular marker related to the hydraulic trait of pork according to claim 1 or 2, wherein the molecular marker is the 160th position of the nucleotide sequence shown in SEQ ID NO.1, the Y of the position is C or T, and has C / T polymorphism, and the drip loss of pork with genotype CC and TC is significantly lower than that of TT type individuals; Breeding is to select pigs with higher water strength in pork line.
4. A method for selecting pigs with excellent water retention ability, characterized in that: It includes the following steps: S1. Extract genomic DNA from pig blood or ear tissue samples; S2. using the primers for detecting molecular markers related to hydraulic traits of pork as described in claim 2 to perform PCR amplification on the extracted genomic DNA; S3. Identify the polymorphic sites of the amplified products.
5. The method according to claim 4, characterized in that In step S2, the PCR amplification system has a final concentration of genomic DNA template of 3-10 ng / µl, 1× PCR amplification buffer, a final concentration of dNTPs of 10 mM, a final concentration of upstream and downstream primers of 1 ng / µl, Taq DNA polymerase of 0.015 U / µl, and Mg 2＋ 2.5mmol / L.
6. The method according to claim 4, characterized in that In step S2, the PCR amplification program is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 50 s, for a total of 35 cycles; and finally extension at 72°C for 2 min.
7. The method according to claim 4, characterized in that In step S3, the identification method uses a sequencing method to identify the polymorphic site, and when the nucleotide sequence at position 160 is C as shown in SEQ ID NO.1, it indicates that the drip loss of the individual with CC genotype at the polymorphic site is lower, that is, the water holding capacity is better.
8. Application of the method according to any one of claims 4 to 7 in pig breeding; characterized in that: Breeding is to select pigs with higher water strength in pork line.