A siRNA for targeted knockdown of chicken SRSF2 gene expression and its application

Abstract

The present invention discloses a siRNA for knocking down the expression of chicken SRSF2 gene and its application, belonging to the field of molecular biotechnology and bioengineering. The present invention provides a siRNA capable of targeting the SRSF2 gene, wherein the sense chain sequence is shown in SEQ ID NO.4, and the antisense chain sequence is shown in SEQ ID NO.5. After the siRNA is transferred into primary chicken myoblasts, the expression of the SRSF2 gene can be effectively inhibited, and the expression of genes related to the ubiquitin-proteasome system and the autophagy-lysosome pathway can be regulated, so that the level of protein degradation in the muscle exceeds that of protein synthesis, muscle atrophy is promoted, the cross-sectional area of ​​muscle fibers is reduced, and the tenderness of chicken meat is improved. The siRNA developed by the present invention can provide new pathways and methods for high-quality broiler breeding, and has broad scientific research value and commercial prospects.

Description

Technical Field

[0001] The invention relates to the fields of molecular biotechnology and bioengineering, and in particular to siRNA for targeted knockdown of chicken SRSF2 gene expression and application thereof. Background Art

[0002] Serine / arginine-rich splicing factor 2 (SRSF2) is a splicing factor that is a member of the Serine / arginine-rich (SR) protein family and is widely expressed in a variety of cell types. SRSF2 can participate in the regulation of a variety of life processes by mediating genome stability, gene transcription, mRNA stability, and translation.

[0003] As the growth rate of broilers continues to increase, the phenomenon of a significant decline in meat quality in broiler production continues to increase. How to improve the quality of chicken has become a major issue facing current broiler breeders. Myofiber, as the basic component of skeletal muscle, affects the tenderness of meat at the tissue level, and is a key indicator for evaluating muscle tenderness. Preliminary sequencing revealed that SRSF2 expression levels in the breast muscle tissue of recessive White Rock chickens with larger muscle fiber diameters were higher than those in the breast muscle tissue of Apricot Blossom chickens with smaller muscle fiber diameters.

[0004] Small interfering RNA (siRNA) is a new method to inhibit gene expression. It causes post-transcriptional silencing of specific gene sequences in the body through homologous double-stranded RNA (dsRNA). siRNA has a specific knockdown effect on specific genes, and is simple to synthesize, has high transfection efficiency, low cytotoxicity, and can be prepared on a large scale, making siRNA an important tool for studying gene function and drug targets. However, there are no reports on the use of siRNA to inhibit the expression of the chicken SRSF2 gene, regulate the cross-sectional area of ​​chicken muscle fibers, and change the quality of chicken meat. Summary of the invention

[0005] The purpose of the present invention is to provide a siRNA for knocking down the expression of the chicken SRSF2 gene and its application to solve the problems existing in the above-mentioned prior art. The siRNA provided by the present invention can significantly inhibit the expression of chicken SRSF2, promote muscle atrophy, and improve the quality of chicken.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a siRNA for targeted knockdown of chicken SRSF2 gene expression, wherein the sense strand sequence of the siRNA is shown as SEQ ID NO.4, and the antisense strand sequence is shown as SEQ ID NO.5.

[0008] Preferably, two overhanging bases dT are added to the 3' ends of the sense strand and the antisense strand.

[0009] The present invention also provides the use of the siRNA in preparing a kit for knocking down chicken SRSF2 gene expression.

[0010] The invention also provides a recombinant expression vector containing a nucleotide sequence for expressing the siRNA.

[0011] The invention also provides an engineering bacterium containing the recombinant expression vector.

[0012] The present invention also provides the use of the siRNA or the recombinant expression vector or the engineering bacteria in identifying the function of chicken SRSF2 gene.

[0013] The present invention also provides the use of the siRNA or the recombinant expression vector or the engineering bacteria in improving the quality of chicken.

[0014] Preferably, the improvement of chicken quality is achieved by knocking down the chicken SRSF2 gene through the siRNA, thereby reducing the expression of the SRSF2 gene, promoting muscle atrophy, reducing the cross-sectional area of ​​the muscle fibers of the chicken, and improving the tenderness of the chicken.

[0015] The present invention also provides a method for improving chicken quality, comprising the steps of transfecting chicken embryos with the siRNA or the recombinant expression vector or the engineering bacteria to reduce the expression of the SRSF2 gene.

[0016] Preferably, the chicken SRSF2 gene is knocked down by the siRNA to reduce the expression of the SRSF2 gene, so as to improve the quality of chicken;

[0017] The improvement of muscle quality is achieved by promoting muscle atrophy, reducing the cross-sectional area of ​​the muscle fibers of the chicken, and improving the tenderness of the chicken.

[0018] The present invention discloses the following technical effects:

[0019] Transferring the siRNA provided by the present invention into primary chicken myoblasts can effectively inhibit the expression of the chicken SRSF2 gene, further regulate the expression of genes related to the ubiquitin-proteasome system and the autophagy-lysosome pathway, make protein degradation in muscle exceed protein synthesis, promote muscle fiber atrophy, and improve the tenderness of chicken. The siRNA developed by the present invention can provide a new pathway and method for high-quality broiler breeding, and has broad scientific research value and commercial prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0021] Figure 1 The figure shows the result of knocking down the chicken SRSF2 gene expression by siRNA; among them, * indicates that the difference between the interference group and the NC control group is significant (P<0.05); ** indicates that the difference between the interference group and the NC control group is extremely significant (P<0.01);

[0022] Figure 2 This is a diagram showing the efficiency of knocking down chicken SRSF2 gene protein expression by siRNA detected by Western blot;

[0023] Figure 3 The expression changes of genes related to the ubiquitin-proteasome system and autophagy-lysosome pathway in chicken primary myoblasts after siRNA transfection; among them, SQSTM1 is selective autophagy adaptor protein 1, ATROGIN1 is atrophin type I gene, MURF1 is muscle RING finger factor 1, and ULK1 is UNC-51-like kinase 1; * indicates that the interference group is significantly different from the NC control group (P<0.05); ** indicates that the interference group is extremely significantly different from the NC control group (P<0.01). DETAILED DESCRIPTION

[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0025] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0026] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0027] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0028] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0029] Example 1 Design and synthesis of siRNA sequences targeting chicken SRSF2 gene

[0030] According to the NCBI online database, the chicken SRSF2 gene mRNA reference sequence (accession number: NM_001001305.4, as shown in SEQ ID NO.1) was obtained, and three pairs of siRNAs targeting the CDS region of the chicken SRSF2 gene were designed using the optimized siCatchTM siRNA design software. During the design, the search for suitable siRNAs began from the nucleotides 100bp downstream of the start codon of the target gene, avoiding the exon and exon junction region. And dTdT overhangs were added to the 3' ends of the sense and antisense strands of each pair of siRNAs, which were synthesized by Guangzhou Ruibo Biotechnology Co., Ltd. The three pairs of siRNA sequences designed are shown in Table 1.

[0031] SEQ ID NO.1:

[0032]

[0033] Table 1 Sequences of three pairs of siRNA targeting SRSF2 gene

[0034]

[0035] Example 2 Transfection of chicken primary myoblasts with siRNA targeting chicken SRSF2 gene

[0036] Compared with cell lines, primary cells are difficult to culture and have a low transfection rate of exogenous genes, but primary cells retain a variety of important biological characteristics and functions of cells in vivo and have an irreplaceable role in the field of biomedicine. In this example, chicken primary myoblasts isolated and extracted from leg muscles of 11-year-old chicken embryos were used as transfected cells, and SRSF2 siRNA was transfected into chicken primary myoblasts.

[0037] The isolated chicken primary myoblasts were cultured at 5×10 5 The cells were inoculated into a 12-well culture plate at a density of 1.5 cells / well. When the cell density grew to 60-70%, three pairs of siRNA targeting the chicken SRSF2 gene and negative control siRNA NC (Ribo Biotech, siN0000001-1-5) were transfected into chicken primary myoblasts with the help of transfection reagent Lipofectamine 3000 (Thermo Fisher, L3000001). Three replicate wells were set up in each group, and the transfection concentration was 500nmol / L.

[0038] After 48 hours of transfection, each well was washed twice with PBS, and the total RNA of the transfected chicken primary myoblasts was extracted using Trizol reagent (Thermo Fisher, 15596018CN), and then cDNA synthesis was performed according to the instructions of HiScriptIII RTSuperMixforqPCR of Nanjing Novozyme Biotechnology Co., Ltd. Using the synthesized cDNA as a template, the gene encoding chicken actin (β-actin) as an internal reference gene, and SRSF2 gene-specific primers (sequences shown in Table 2), fluorescence quantitative PCR experiments were performed to detect the efficiency of siRNA-specific knockdown of chicken SRSF2 gene expression.

[0039] Table 2 SRSF2 gene quantitative primers

[0040]

[0041]

[0042] The reaction system was as follows: 2×SYBR Green I 5 μL, sterile DEPC water 3.6 μL, upstream and downstream primers 0.2 μL each, cDNA template 1 μL; -ΔΔCTMethods The relative expression levels of the target genes were calculated and statistically analyzed using SPSS18.0 software. P<0.05 indicated a significant difference, and P<0.01 indicated an extremely significant difference.

[0043] The efficiency of 3 pairs of siRNA in inhibiting chicken SRSF2 gene expression is shown in Figure 1 . As can be seen from the figure, compared with the control group si-NC, si-SRSF2-002 has the best inhibition efficiency, and significantly knocked down the expression of the chicken SRSF2 gene in chicken primary myoblasts, with a knockdown efficiency of more than 50%. Therefore, si-SRSF2-002 was selected in subsequent experiments to study the function of the chicken SRSF2 gene. The sense chain of the si-SRSF2-002 is 5'-GCCAGGAGAUCCAAGUCAA-3' (SEQ ID NO.4), and the sequence of the antisense chain is 5'-UUGACUUGGAUCUCCUGGC-3' (SEQ ID NO.5), and dTdT overhangs are added to the 3' ends of the sense chain and the antisense chain.

[0044] Furthermore, the chicken primary myoblasts transfected with si-SRSF2-002 were cultured for 48 h, each well was washed twice with PBS, and the total cell protein was extracted using RIPA cell lysis buffer (Thermo Fisher, 89901). Tubulin was used as an internal reference, and the concentration of the extracted total protein was determined using the Bio-Tech BCA assay. Western blot experiments were performed using anti-SRSF2 (Boosun, bs-17255R, 1:500) and anti-Tubulin (Yacoin, A01030, 1:10000). The results of si-SRSF2-002 inhibiting the expression of chicken SRSF2 protein are shown in Figure 2 As shown in the figure, compared with the protein expression of si-NC in the control group, si-SRSF2-002 significantly inhibited the expression of SRSF2 protein.

[0045] Example 3 Effect of post-SRSF2 gene knockdown on the mRNA expression of genes related to the ubiquitin-proteasome system and autophagy-lysosome pathway

[0046] The fluorescent quantitative PCR detection method in Example 2 was used to detect the changes in the expression levels of genes related to the ubiquitin-proteasome system and the autophagy-lysosome pathway after the chicken SRSF2 gene was knocked down. The related genes included: selective autophagy adaptor protein 1 (SQSTM1), atrophin type I gene (ATROGIN1), muscle ring finger factor 1 (MURF1) and UNC-51-like kinase 1 (ULK1). Use relevant specific primers (sequences are shown in Table 3), set the fluorescent quantitative PCR experimental steps and reaction system with reference to Example 2, and the results are shown in Figure 3As can be seen from the figure, knocking down the SRSF2 gene in chicken primary myoblasts can regulate the expression levels of genes related to the ubiquitin-proteasome system and the autophagy-lysosome pathway (SQSTM1, ATROGIN1, MURF1 and ULK1).

[0047] Table 3 Quantitative primers for genes related to the ubiquitin-proteasome system and autophagy-lysosome pathway

[0048]

[0049] DL-MURF1-RGGGAGATGATGGTCTGGATG(SEQ ID NO.13)

[0050] DL-ULK1-F TCGTTGCCTTGTATGACTT(SEQ ID NO.14)

[0051] DL-ULK1-R TTTATGCGAATGTTGTTGG(SEQ ID NO.15)

[0052] DL-SQSTM1-F AGCGACGAGGAGCTGGATC(SEQ ID NO.16)

[0053] DL-SQSTM1-R CCTTGTGGATGCCTTTACCC(SEQ ID NO.17)

[0054] The above results indicate that the siRNA targeted at knocking down the expression of the chicken SRSF2 gene provided by the present invention can significantly reduce the expression of the SRSF2 gene in chicken primary myoblasts, further regulate the expression levels of genes related to the activated ubiquitin-proteasome system and the autophagy-lysosome pathway, cause protein degradation in the muscle to exceed protein synthesis, promote muscle atrophy, cause a reduction in the cross-sectional area of ​​muscle fibers, change the quality of chicken, improve the tenderness of the chicken, and make the taste more tender.

[0055] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. An application of siRNA targeting and knocking down chicken SRSF2 gene expression in improving chicken quality, characterized in that: The sense strand sequence of the siRNA is shown in SEQ ID NO.4, and the antisense strand sequence is shown in SEQ ID NO.5; The improvement of chicken quality is achieved by knocking down the chicken SRSF2 gene through the siRNA, thereby reducing the expression of the SRSF2 gene and promoting muscle atrophy; Two overhanging bases dT are also added to the 3' ends of the sense strand and the antisense strand.

2. A method for improving the quality of chicken, characterized in that: The method comprises the steps of transfecting chicken embryos with the siRNA described in claim 1 to reduce the expression of the SRSF2 gene; The improvement of chicken quality is achieved by knocking down the chicken SRSF2 gene through the siRNA, thereby reducing the expression of the SRSF2 gene and promoting muscle atrophy.

Images