A lanthanide metal organic framework DNA sensor, and a preparation method and application thereof
By fabricating a lanthanide metal-organic framework DNA sensor, and utilizing LaMOF materials and fluorescence analysis methods, the sensitivity and accuracy issues of detecting free nucleic acids in blood were resolved, achieving efficient and low-cost quantitative detection.
Patent Information
- Application Number
- CN202410743013.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-11
- Publication Date
- 2025-12-19
- Estimated Expiration
- 2044-06-11
AI Technical Summary
Existing technologies lack sufficient sensitivity and accuracy in detecting cell-free nucleic acids (cfDNA) in blood. Traditional PCR methods have low accuracy, real-time quantitative PCR is costly, digital droplet ddPCR instruments are expensive, electrochemical sensing methods are complex to operate and have low accuracy, and MOF nanomaterials are not widely used in biosensing.
Using lanthanide metal-organic frameworks (LaMOFs), a lanthanide metal-organic framework DNA sensor was prepared by designing probe nucleic acid chains complementary to the target free nucleic acid, labeling them with phosphate groups and FAM dyes, and combining them with fluorescence analysis methods to achieve highly sensitive and specific quantitative detection.
It achieves accurate quantitative analysis of free nucleic acids, with linear correlation within the detection range of 25-250 pM. The method is simple and efficient, with high specificity and sensitivity, low detection limit, environmentally friendly operation and low cost.
Smart Images

Figure CN118581196B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of nucleic acid detection, in particular to a lanthanide metal organic framework DNA sensor and a preparation method and application thereof. BACKGROUND
[0002] Cell-free nucleic acid (cfDNA) is DNA released into the blood during apoptosis and necrosis. Tumor cells also release cfDNA into the blood as a signal molecule. Numerous studies have shown that the cfDNA content in the body fluid of cancer patients is much higher than that of healthy people, and the cfDNA sequence of cancer patients also carries genetic information related to the tumor genome, so cfDNA can be used as an important biomarker for early diagnosis and disease tracking of cancer. However, due to the very low content of cfDNA in the blood plasma, and the fact that cfDNA is also discharged after healthy cell apoptosis, only a small part of cfDNA contains tumor-related sequences, so the detection of cfDNA in body fluid requires an analysis method with very high sensitivity.
[0003] At present, the detection methods of cfDNA mainly include traditional PCR quantitative method, real-time fluorescent quantitative qPCR technology, digital microdroplet ddPCR technology, and electrochemical sensing. However, the traditional PCR quantitative method has low accuracy and poor reproducibility, and can only be used as a semi-quantitative or rough quantitative method, which is not sufficient to meet the detection requirements of cfDNA. The real-time fluorescent quantitative qPCR technology has problems such as non-specific primer amplification, gene contamination, high cost of fluorescent probe, and difficulty in design. The digital microdroplet ddPCR technology also has the problem of high instrument cost. The electrochemical sensing method also needs to perform PCR amplification on the target analyte, resulting in low accuracy, complicated operation, and easy enzyme decomposition of the sensor.
[0004] Metal organic framework (MOF) is a new type of functional material composed of metal centers and ligand units, and has good controllability, adsorption performance and fluorescence quenching ability, and has been widely studied and applied. On the other hand, nanoscale materials have unique applications in biological sensing as fluorescence quenching agents for dye-labeled molecules. However, MOF nanoparticles as a new type of functional nanomaterial have been rarely applied to biological sensing analysis, and currently, no work has attempted to use MOF materials as fluorescence biosensor for quantitative analysis of cell-free nucleic acid cfDNA. SUMMARY
[0005] In order to solve the above technical problems, the application provides a lanthanide metal organic framework DNA sensor and a preparation method and application thereof, utilizes the high structure controllability of the MOF, provides a MOF material preparation method with excellent solution stability, large specific surface area, high surface reactivity and excellent fluorescence quenching capacity, and constructs a MOF fluorescence biosensor, combines the characteristics of high sensitivity of fluorescence analysis, and applies the sensor to accurate, sensitive and specific quantitative detection of cfDNA.
[0006] In order to achieve the above object, the application is implemented according to the following technical scheme:
[0007] One of the objects of the application is to provide a preparation method of a lanthanide metal organic framework DNA sensor, comprising the following steps:
[0008] S1, probe nucleic acid chain design and synthesis: a probe nucleic acid chain complementary to the sequence of the target free nucleic acid chain is designed, and a phosphate group and a FAM dye group are labeled at both ends of the probe nucleic acid chain;
[0009] S2, modifying the probe nucleic acid chain on the lanthanide metal organic framework to prepare the lanthanide metal organic framework DNA sensor.
[0010] Further, in the step S1,
[0011] The sequence of the target free nucleic acid is shown in SEQ ID NO. 1, and is specifically:
[0012] (5') ACCGGACAGAGCCCATTACAAT;
[0013] The sequence of the probe nucleic acid chain is shown in SEQ ID NO. 2, and is specifically:
[0014] (5') FAM-AAATTGTAATGGGCTCTGTCCGGT-P.
[0015] Further, in the step S2, the preparation method of the lanthanide metal organic framework is:
[0016] 1.64g of lanthanum nitrate and 1.13g of 2-amino terephthalic acid sodium are weighed and dissolved in 50ml of deionized water, mixed uniformly under magnetic stirring, and reacted at room temperature for 20min, after the reaction is completed, the solid product is collected by centrifugation, and the solid product is washed and purified with water and ethanol in sequence, and dried to obtain the lanthanide metal organic framework.
[0017] Further, the step S2 specifically comprises:
[0018] Mix 800 uL of LaMOF with a concentration of 20 ug / ml with 400 uL of probe nucleic acid chain with a concentration of 0.5 uM, incubate the reaction at 37℃ for 2h, then centrifugal separation and wash off the excess probe nucleic acid chain, to obtain the lanthanide metal organic framework DNA sensor.
[0019] Preferably, in the step S2, the centrifugal speed is 8000prm, and the time is 3min.
[0020] The second object of the present application is to provide a lanthanide metal organic framework DNA sensor prepared by the above method.
[0021] The third object of the present application is to provide an application of the lanthanide metal organic framework DNA sensor in free nucleic acid quantitative analysis, which specifically comprises the following steps:
[0022] S01, establishment of a standard curve of fluorescence intensity corresponding to target free nucleic acid concentration: 0.5mg of lanthanide metal organic framework DNA sensor is added to a series of target free nucleic acid standard solutions with different concentrations, and then incubated for 3h, and then the fluorescence spectrum of the solution after reaction is measured by a steady-state transient fluorescence spectrometer, and the peak value of the characteristic fluorescence peak is read, and the measured fluorescence characteristic peak value is used to draw a standard curve of fluorescence intensity corresponding to target free nucleic acid concentration; wherein the concentration of the target free nucleic acid standard solution is 25-250pM; the standard curve is drawn by taking the measured fluorescence intensity as the ordinate and the concentration of the sample corresponding to the target free nucleic acid standard solution as the abscissa.
[0023] S02, determination of target free nucleic acid in the sample solution to be measured: 0.5mg of lanthanide metal organic framework DNA sensor is added to the sample solution to be measured, and then incubated for 3h, and then the fluorescence spectrum of the solution after reaction is measured by a steady-state transient fluorescence spectrometer, and the peak value of the characteristic fluorescence peak is read, and the measured characteristic fluorescence peak value is substituted into the standard curve of fluorescence intensity corresponding to target free nucleic acid concentration in step S01, to obtain the concentration of target free nucleic acid in the sample solution to be measured.
[0024] Preferably, in the step S01, the fluorescence spectrum of the solution after reaction is measured by a steady-state transient fluorescence spectrometer under an excitation wavelength of 480nm, and the peak value of the characteristic fluorescence peak at 530nm is read and recorded.
[0025] Compared with the prior art, the present application has the following beneficial effects:
[0026] (1) The application utilizes the chemical coordination reactivity of the synthetic lanthanide metal organic framework (LaMOF) surface incompletely coordinated metal sites and oligonucleotide phosphate groups, couples the capture DNA chain complementary to the target DNA on the LaMOF surface, and constructs a fluorescence biosensor based on LaMOF, which has simple synthesis steps, avoids complex synthesis reactions, and is environmentally friendly, simple to operate, and low in time and reagent costs.
[0027] (2) The application uses the principle of base complementary pairing between DNAs to recognize target DNAs, and can be combined with the analyte to be detected with high affinity, high specificity and high selectivity; moreover, the DNA probe has high designability, and the probe sequence can be designed according to the characteristic sequence of the analyte to be detected, and has wide application range and universality for various nucleic acid analysis.
[0028] (3) The application uses luminescent metal organic framework and in-situ fluorescence quenching reaction to detect nucleic acids, converts the amount of target DNA into fluorescence signal, realizes quantitative analysis of free nucleic acid cfDNA, and has good linear correlation in the concentration range of 25-250 pM, high method precision and good reproducibility.
[0029] (4) The application links the fluorescence spectrum analysis method and free nucleic acid quantitative detection together, can accurately quantify the content of target free nucleic acid. Through the specific complementary pairing of nucleic acid sequences, the specificity and accuracy of the analysis are greatly enhanced; on the other hand, combined with the high sensitivity of the fluorescence analysis method, the content of the target free nucleic acid is converted into a fluorescence signal, realizing the quantitative analysis of the target free nucleic acid, which can accurately quantify the target free nucleic acid to the pM level, and has very high specificity and sensitivity, the detection limit is much lower than the existing target free nucleic acid analysis method, the method is simple and efficient, and the detection result is more accurate. BRIEF DESCRIPTION OF DRAWINGS
[0030] Figure 1 The fluorescence intensity corresponding to the target free nucleic acid concentration standard curve is drawn for the embodiments of the application. DETAILED DESCRIPTION
[0031] In order to make the purpose, technical scheme and advantages of the application more clear and explicit, the following combines embodiments to further explain the application. The specific embodiments described herein are only used to explain the application, and are not used to limit the application.
[0032] The raw materials, reagents and equipment used in the following examples are commercially available unless otherwise specified.
[0033] Among them: taking the following target free nucleic acid sequence as an example, the corresponding lanthanide metal organic framework DNA sensor is designed, and the target free nucleic acid sequence is:
[0034] (5’)ACCGGACAGAGCCCATTACAAT (see SEQ ID NO. 1).
[0035] Example 1, Preparation of Lanthanide Metal Organic Framework DNA Sensor
[0036] 1) Probe nucleic acid chain design and synthesis: design a probe nucleic acid chain complementary to the sequence of the above target free nucleic acid chain, and label a phosphate group and a FAM dye group at both ends of the probe nucleic acid chain (the probe nucleic acid chain is commissioned from a biological company); the sequence of the designed probe nucleic acid chain is:
[0037] (5’)FAM-AAATTGTAATGGGCTCTGTCCGGT-P (see SEQ ID NO. 2).
[0038] 2) Preparation of Lanthanide Metal Organic Framework: weigh 1.64 g of lanthanum nitrate and 1.13 g of 2-amino terephthalic acid sodium into 50 ml of deionized water, mix uniformly under magnetic stirring, react at room temperature for 20 min, after the reaction is completed, centrifuge at 8000 rpm for 3 min to collect the solid product, and then wash and purify the solid product with water and ethanol respectively, and dry to obtain the lanthanide metal organic framework LaMOF;
[0039] 3) Preparation of fluorescent biosensor: mix 800 uL of LaMOF with a concentration of 20 ug / ml and 400 uL of probe nucleic acid chain with a concentration of 0.5 uM, incubate at 37°C for 2 h, then centrifuge and wash away the excess probe nucleic acid chain, to obtain the lanthanide metal organic framework DNA sensor.
[0040] Example 2, Application of Lanthanide Metal Organic Framework DNA Sensor in Free Nucleic Acid Quantitative Analysis
[0041] (1) Establishment of standard curve of fluorescence intensity corresponding to target free nucleic acid concentration: 0.5 mg of lanthanide metal organic framework DNA sensor was added to 25 nM, 50 nM, 75 nM, 100 nM, 125 nM, 150 nM, 175 nM, 200 nM, 225 nM, and 250 nM of target free nucleic acid standard solution, respectively, and mixed uniformly, then incubated for 3 h, then the fluorescence spectrum of the reaction solution was measured at 480 nm excitation wavelength using a steady-state transient fluorescence spectrometer, and the characteristic fluorescence peak value at 530 nm was read and recorded, then the standard curve of fluorescence intensity corresponding to target free nucleic acid concentration was drawn with the concentration of the sample corresponding target free nucleic acid standard solution as the abscissa, as shown in Figure 1 The analysis method showed good linear correlation in the concentration range of 25-250 nM, and the linear equation was Y=28.710X+12825, and the linear correlation coefficient r was 0.9912.
[0042] (2) Target free nucleic acid determination in the sample solution to be measured: 0.5 mg of the lanthanide metal organic framework DNA sensor is added to the sample solution to be measured, and the mixture is uniformly mixed and then incubated for 3 h. Then, the fluorescence spectrum of the solution after the reaction is determined at an excitation wavelength of 480 nm by using a steady-state transient fluorescence spectrometer. The characteristic fluorescence peak value at 530 nm is read and recorded. The measured characteristic fluorescence peak value is substituted into the fluorescence intensity corresponding to the target free nucleic acid concentration standard curve in step S01, and the concentration of the target free nucleic acid in the sample solution to be measured is obtained.
[0043] Further, the present embodiment also performs reproducibility evaluation, and the specific operation is as follows:
[0044] In step S01 of Example 2, three different concentrations of target free nucleic acid solutions are added, and the concentrations are 50 nM, 150 nM and 225 nM respectively. Six parallel samples of each concentration of target free nucleic acid solution are prepared, and then steps S01-S02 of Example 2 are performed. The measured target free nucleic acid concentrations of all samples are shown in Table 1.
[0045] Table 1 Method reproducibility evaluation
[0046]
[0047] As can be seen from Table 1, the RSD is in the range of 1.3% to 5.9%, which indicates that the method has good accuracy and precision, and the method reproducibility is good.
[0048] The technical scheme of the present application is not limited to the above specific embodiments, and any technical modification made according to the technical scheme of the present application falls within the protection scope of the present application.
Claims
1. A method for preparing a lanthanide metal-organic framework DNA sensor, characterized in that, Includes the following steps: S1. Probe Nucleic Acid Chain Design and Synthesis: Design probe nucleic acid chains complementary to the target free nucleic acid chain sequence, and label both ends of the probe nucleic acid chain with phosphate groups and FAM dye groups, respectively; the sequence of the target free nucleic acid is shown in SEQ ID NO.1, specifically: 5' ACCGGACAGAGCCCATTACAAT; The sequence of the probe nucleic acid chain is shown in SEQ ID NO.2, specifically: 5'FAM-AAATTGTAATGGGCTCTGTCCGGT-P; S2. Modify the probe nucleic acid chain onto a lanthanide metal-organic framework to prepare a lanthanide metal-organic framework DNA sensor: Weigh 1.64 g of lanthanum nitrate and 1.13 g of sodium 2-aminoterephthalate and dissolve them in 50 ml of deionized water. Mix them evenly under magnetic stirring and react at room temperature for 20 min. After the reaction is complete, collect the solid product by centrifugation, wash and purify the solid product with water and ethanol respectively, and dry to obtain the lanthanide metal-organic framework; Mix 800 μL of 20 μg / ml LaMOF with 400 μL of 0.5 μM probe nucleic acid chain and incubate at 37 °C for 2 h. Then centrifuge and wash away excess probe nucleic acid chain to obtain the lanthanide metal-organic framework DNA sensor.
2. The method for preparing a lanthanide metal-organic framework DNA sensor according to claim 1, characterized in that, In step S2, the centrifugation speed is 8000 rpm and the time is 3 minutes.
3. A lanthanide metal-organic framework DNA sensor prepared by the method of claim 1 or 2.
4. The application of a lanthanide metal-organic framework DNA sensor as described in claim 3 in the quantitative analysis of free nucleic acids.
5. The application of the lanthanide metal-organic framework DNA sensor as described in claim 4 in the quantitative analysis of free nucleic acids, characterized in that, Includes the following steps: S01. Establishment of a standard curve for fluorescence intensity corresponding to target free nucleic acid concentration: 0.5 mg of lanthanide metal-organic framework DNA sensor was added to a series of target free nucleic acid standard solutions of different concentrations, mixed thoroughly, and incubated for 3 h. Then, the fluorescence spectrum of the solution after reaction was measured using a steady-state transient fluorescence spectrometer, and the peak values of characteristic fluorescence peaks were read. A standard curve was plotted against the added target free nucleic acid concentration using the measured peak values of the characteristic fluorescence peaks. The concentration of the target free nucleic acid standard solution was 25-250 pM. The specific process of plotting the standard curve was as follows: the measured fluorescence intensity was plotted on the ordinate, and the concentration of the target free nucleic acid standard solution corresponding to the sample was plotted on the abscissa to obtain the standard curve of fluorescence intensity corresponding to target free nucleic acid concentration. S02. Determination of target free nucleic acid in the test sample solution: Add 0.5 mg of lanthanide metal-organic framework DNA sensor to the test sample solution, mix well, and incubate for 3 h. Then, use a steady-state transient fluorescence spectrometer to measure the fluorescence spectrum of the solution after the reaction, read the peak value of the characteristic fluorescence peak, and substitute the measured peak value of the characteristic fluorescence peak into the standard curve of target free nucleic acid concentration corresponding to the fluorescence intensity in step S01 to obtain the concentration of target free nucleic acid in the test sample solution.
6. The application of the lanthanide metal-organic framework DNA sensor according to claim 5 in the quantitative analysis of free nucleic acids, characterized in that, In step S01, the fluorescence spectrum of the solution after reaction at an excitation wavelength of 480 nm is measured using a steady-state transient fluorescence spectrometer, and the peak value of the characteristic fluorescence peak at 530 nm is read and recorded.
Citation Information
Patent Citations
Multi-channel fluorescence PCR detection method and kit for human papillomavirus (HPV) types 16 and 18
CN103184294A
Fluorescent nanoprobe, preparation method thereof and application thereof in biosensor
CN106908424A