Preparation method of serum HER2 ECD detection substance for detecting gastric cancer
By designing trigger probe sequences and hairpin chains for nonlinear hybridization chain reactions, and combining fluorescent and quenching groups, high sensitivity and specificity of HER2 ECD protein in gastric cancer serum were achieved, solving the problem of insufficient sensitivity in existing technologies. It also has the advantages of simple operation and low cost.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- TIANJIN TUMOR HOSPITAL
- Filing Date
- 2024-06-27
- Publication Date
- 2026-05-08
AI Technical Summary
In existing technologies, hybridization chain reaction has low sensitivity in detecting HER2 expression in gastric cancer serum, making it difficult to achieve dynamic monitoring with high sensitivity and specificity.
The trigger probe sequence and hairpin chain for the nonlinear hybridization chain reaction were designed, modified with fluorescent and quenching groups, and combined with buffer and ionic solution to form a mixed solution for the detection of HER2 ECD protein.
It achieves highly sensitive and specific detection of HER2 ECD protein in gastric cancer serum, is simple to operate, low in cost, requires no expensive equipment, and the aptamer powder is easy to store.
Smart Images

Figure CN118604344B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of fluorescence detection methods based on nonlinear hybridization chain reactions, and particularly to a method for preparing a HER2 ECD assay for detecting gastric cancer serum. Background Technology
[0002] Gastric cancer is a malignant tumor originating from the gastric mucosal epithelium. The incidence of gastric cancer shows significant regional differences, with a much higher incidence in Northwest and Eastern coastal regions of my country compared to Southern regions. Gastric cancer can occur in any part of the stomach, with more than half occurring in the antrum. The greater curvature, lesser curvature, and anterior and posterior walls of the stomach can also be affected. The vast majority of gastric cancers are adenocarcinomas, which often present with no obvious symptoms in the early stages, or with nonspecific symptoms such as upper abdominal discomfort and belching. These symptoms are often similar to those of chronic gastric diseases such as gastritis and gastric ulcers, making them easily overlooked. Therefore, the early diagnosis rate of gastric cancer in my country remains low.
[0003] Based on a deeper understanding of the molecular mechanisms of tumor development, gastric cancer patients should determine their HER2 status as early as possible. Accurate HER2 testing can provide a comprehensive understanding of the disease's status and type, enabling effective individualized treatment and prolonging survival. Among existing technologies, hybridization chain reactions (HCRs) are of great significance in medical testing and analysis due to their advantages of being enzyme-free, isothermal, and having high amplification efficiency. However, traditional HCRs only provide a linear assembly process, resulting in poor analytical sensitivity. Therefore, developing a more sensitive detection technology for dynamically monitoring changes in HER2 expression has become an urgent need. Summary of the Invention
[0004] Nonlinear hybridization chain reactions (NLCRs) offer numerous advantages in developing biosensors based on various detection methods, including simplicity, high sensitivity, low cost, and good specificity. However, the design of the trigger probe sequence is a crucial technical aspect for the success of NLCRs. Designing a trigger probe sequence based on an aptamer involves more than simply obtaining the complementary base sequence of the aptamer; the number of bases in the trigger probe sequence must also be carefully designed to ensure that, in the absence of a detection target, the trigger probe and aptamer exist in a stable double-stranded structure in solution, without reacting with the hairpin sequence. When a detection target is present, the target protein binds to the aptamer with high specificity and affinity, effectively exposing the trigger probe. The exposed probe then further assembles with the hairpin NLH1-NLH4, ultimately forming a branched DNA cross-linked structure. In this process, the design and optimization of the trigger probe sequence, as well as the optimization of the number of non-complementary bases in the hairpin sequence, are critical, determining the smooth progress of the entire reaction and the filtering out of non-specific fluorescent signals. An improper design can lead to the appearance of non-specific detection signals. Therefore, designing a trigger probe sequence is a complex and crucial step.
[0005] To address the aforementioned technical problems, this invention provides a method for preparing an ECD assay for detecting HER2 in gastric cancer serum. The method of this invention yields a gastric cancer serum HER2 assay with higher sensitivity and specificity for detecting HER2 in gastric cancer serum.
[0006] This invention provides a method for preparing a serum HER2 ECD assay for detecting gastric cancer, comprising the following steps:
[0007] Step S1: Based on the sequence of the aptamer of HER2 ECD in gastric cancer serum, a trigger probe sequence and hairpin chain for nonlinear hybridization chain reaction were designed, synthesized and purified, and fluorescent groups and quenching groups were modified at both ends of the hairpin chain.
[0008] Step S2: Dissolve the trigger probe sequence (Trigger DNA) and the HER2 ECD aptamer in buffer solution, mix and heat, then cool to room temperature to obtain solution 1;
[0009] The hair clip chain includes hair clips NLH1, NLH2, NLH3, and NLH4.
[0010] Hairpins NLH1, NLH2, NLH3, and NLH4 were dissolved in buffer solution, heated, and cooled to room temperature to obtain solutions 2, 3, 4, and 5, respectively.
[0011] The HER2 ECD protein solution was mixed with solution 1 at room temperature, and then solutions 2, 3, 4, 5, magnesium chloride solution, and dipotassium hydrogen phosphate solution were added to form a mixed solution. The pH value of the mixed solution was adjusted during the formation of the mixed solution, and the mixture was incubated to form the detection substance.
[0012] Furthermore, the trigger probe sequence is shown in SEQ ID NO.1.
[0013] Furthermore, the sequence of the hair clip NLH1 is shown in SEQ ID NO.2, the sequence of the hair clip NLH2 is shown in SEQ ID NO.3, the sequence of the hair clip NLH3 is shown in SEQ ID NO.4, and the sequence of the hair clip NLH4 is shown in SEQ ID NO.5.
[0014] Furthermore, the buffer solution is a TE buffer solution.
[0015] Furthermore, in step S2, the trigger probe sequence and the HER2 ECD aptamer are dissolved in buffer solution, and before mixing and heating, the molar ratio of the trigger probe sequence to the aptamer is 1:1.
[0016] Furthermore, in step S2, the trigger probe sequence and the HER2 ECD aptamer are dissolved in buffer solution, and the molar concentration of the trigger probe sequence is 10 μM before mixing and heating.
[0017] Furthermore, prior to the mixing and heating, the buffer solution containing the trigger probe sequence is mixed with the buffer solution containing the HER2 ECD aptamer, with the ratio of the buffer solution containing the trigger probe sequence to the buffer solution containing the HER2 ECD aptamer being 1:1 by volume.
[0018] Furthermore, the molar concentration ratio of hairpin NLH1 in solution 2, hairpin NLH2 in solution 3, hairpin NLH3 in solution 4, and hairpin NLH4 in solution 5 is 1:2:2:4.
[0019] Furthermore, the molar concentration of hairpin NLH1 in solution 2 is 0.1 μM.
[0020] Furthermore, the mass concentration of the HER2 ECD protein solution is 20 ng / mL.
[0021] Furthermore, the specific method for preparing the HER2 ECD protein solution is as follows: dissolve the HER2 ECD protein in TE buffer solution.
[0022] Furthermore, by volume, the volume ratio of the HER2 ECD protein solution, solution 1, solution 2, solution 3, solution 4, and solution 5 is 1:1:1:1:1:1.
[0023] Furthermore, the molar concentration of the magnesium chloride solution is 45mM-55mM.
[0024] Furthermore, the molar ratio of the magnesium chloride solution to the dipotassium hydrogen phosphate solution is 2:1.
[0025] Furthermore, the volume ratio of HER2 ECD protein solution, solution 1, solution 2, solution 3, solution 4, and solution 5 to magnesium chloride solution and dipotassium hydrogen phosphate solution is 20:2:1.
[0026] Furthermore, the pH value of the mixed solution is 4.5-8.5.
[0027] Furthermore, the reagent used to adjust the pH value of the mixed solution is a sodium hydroxide solution.
[0028] Furthermore, the temperature for mixing and heating is 94℃-96℃, and the heating time is 1.5min-2.5min.
[0029] Furthermore, the heating temperature is 94℃-96℃, and the heating time is 2.5min-3.5min.
[0030] Furthermore, the room temperature is 25℃-30℃.
[0031] Furthermore, the incubation temperature is 36℃-40℃, and the incubation time is 0.8h-1.2h.
[0032] Furthermore, the fluorescent group is FAM.
[0033] Furthermore, the quenching group is BHQ1.
[0034] Furthermore, the synthesis and purification process in step S1 is a well-known method in the art, and the designed trigger probe sequence, hairpin strand, fluorescent group, and quencher group can be sent to a biotechnology company for synthesis and purification.
[0035] Furthermore, the sequence of the aptamer for the HER2 ECD in gastric cancer serum is AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTATATGTATTTGGTTTTTGGCTCTCACAGACACACTACACACGCACA.
[0036] Furthermore, the SEQ ID NO.1 is TGTGCGTGTGTAGTGTGTCTGTGAGAGCCAAAAACCAAATACATATACAAAATGACAAGTGCAGACTCTTAGGGATTTGGGCGGTTAGGAAGTTT.
[0037] Furthermore, SEQ ID NO.2 is a fluorescent group and a quenching group linked in the sequence TTTCTTCCTAACCGCTCTTCCCGAGGCGTACCCCCCCGAGCTACGAAG, specifically: TTT-fluorescent group-CTTCCTAACCGCTCTTCCCGAGGCGTACCCCCCCGAGCTACGAAG-quenching group.
[0038] Furthermore, SEQ ID NO.3 is a fluorescent group and a quenching group linked in the ATGCTACAAAACGGACTTCGTAGCTCGGGGTTTAAAATGAGCCAT sequence, specifically: fluorescent group -ATGCTACAAAACGGACTTCGTAGCTCGGGGTTTAAAATGAGCCAT-quenching group.
[0039] Furthermore, SEQ ID NO.4 consists of a fluorescent group and a quenching group linked in the sequence TTTGAAGGATTGGCGAGAATGGCTCATTTTAAAGGCCTCGGAAAATTC, specifically: TTT-fluorescent group-GAAGGATTGGCGAGAATGGCTCATTTTAAAGGCCTCGGAAAATTC-quenching group.
[0040] Furthermore, SEQ ID NO.5 consists of a fluorescent group and a quenching group linked in the sequence TCCGTTTTGGTTTCCGAATTTTCCGAGGCCGGGTACGCCTCGGGA, specifically: fluorescent group -TCCGTTTTGGTTTCCGAATTTTCCGAGGCCGGGTACGCCTCGGGA-quenching group.
[0041] The embodiments of the present invention have the following technical effects:
[0042] 1. The advantages of this invention are: First, the detection method using the aptamer obtained by this invention for detecting HER2 ECD protein in gastric cancer serum is simple and rapid, requiring no complex instruments or equipment, nor complex labeling such as proteases. The reaction occurs automatically at a slightly higher temperature, achieving a relatively ideal detection effect. Second, the detection cost of this invention is low, as it does not require expensive and difficult-to-preserve antibodies; only the purified and synthesized base sequence is needed. Third, the aptamer powder obtained by this invention is less expensive and easier to preserve than antibodies, while also possessing high specificity for binding to the target.
[0043] 2. In this invention, a trigger probe sequence was first successfully designed and then successfully applied to a fluorescence detection method, ultimately obtaining a detectable that can accurately detect HER2 ECD protein in gastric cancer serum. Attached Figure Description
[0044] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0045] Figure 1 These are the atomic mechanical microscopy test results provided in the embodiments and comparative examples of the present invention, wherein... Figure 1 In the figure, A represents the detection result of HER2 ECD protein at 0 ng / mL. Figure 1 In the figure, B represents the detection result of HER2 ECD protein at 0 ng / mL. Figure 1 In the figure, C represents the detection result of HER2 ECD protein at 50 ng / mL. Figure 1 In the figure, D represents the detection result of HER2 ECD protein at 50 ng / mL.
[0046] Figure 2 This is the XRD pattern of Example 1.
[0047] Figure 3 These are the test results for the examples and comparative examples, where... Figure 3 In this context, A represents the effect of the pH value of the reaction environment. Figure 3 In the diagram, B represents a comparison of the fluorescence signals of the final products of linear HCR and nonlinear NHCR. Figure 3 C in the figure represents the effect of incubation temperature. Detailed Implementation
[0048] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0049] In a first aspect, some embodiments of the present invention provide a method for preparing a serum HER2 ECD detector for gastric cancer, comprising the following steps:
[0050] Step S1: Based on the sequence of the aptamer of HER2 ECD in gastric cancer serum, a trigger probe sequence and hairpin chain for nonlinear hybridization chain reaction were designed, synthesized and purified, and fluorescent groups and quenching groups were modified at both ends of the hairpin chain.
[0051] Step S2: Dissolve the trigger probe sequence and the aptamer of HER2 ECD in buffer solution, mix and heat, then cool to room temperature to obtain solution 1;
[0052] The hair clip chain includes hair clips NLH1, NLH2, NLH3, and NLH4.
[0053] Hairpins NLH1, NLH2, NLH3, and NLH4 were dissolved in buffer solution, heated, and cooled to room temperature to obtain solutions 2, 3, 4, and 5, respectively.
[0054] The HER2 ECD protein solution was mixed with solution 1 at room temperature, and then solutions 2, 3, 4, 5, magnesium chloride solution, and dipotassium hydrogen phosphate solution were added to form a mixed solution. The pH value of the mixed solution was adjusted during the formation of the mixed solution, and the mixture was incubated to form the detection substance.
[0055] In some embodiments, the trigger probe sequence is as shown in SEQ ID NO.1.
[0056] In some embodiments, the sequence of the hairpin NLH1 is shown in SEQ ID NO.2, the sequence of the hairpin NLH2 is shown in SEQ ID NO.3, the sequence of the hairpin NLH3 is shown in SEQ ID NO.4, and the sequence of the hairpin NLH4 is shown in SEQ ID NO.5.
[0057] In some embodiments, the buffer solution is a TE buffer solution.
[0058] In some embodiments, in step S2, the trigger probe sequence and the aptamer of HER2 ECD are dissolved in a buffer solution, and before mixing and heating, the molar ratio of the trigger probe sequence to the aptamer is 1:1.
[0059] In some embodiments, in step S2, the trigger probe sequence and the HER2 ECD aptamer are dissolved in buffer solution, and the molar concentration of the trigger probe sequence is 10 μM before mixing and heating.
[0060] In some embodiments, before mixing and heating, a buffer solution containing the trigger probe sequence is mixed with a buffer solution containing the HER2 ECD aptamer, wherein the ratio of the buffer solution containing the trigger probe sequence to the buffer solution containing the HER2 ECD aptamer by volume is 1:1.
[0061] In some embodiments, the molar concentration ratio of hairpin NLH1 in solution 2, hairpin NLH2 in solution 3, hairpin NLH3 in solution 4, and hairpin NLH4 in solution 5 is 1:2:2:4.
[0062] In some embodiments, the molar concentration of hairpin NLH1 in solution 2 is 0.1 μM.
[0063] In some embodiments, the mass concentration of the HER2 ECD protein solution is 20 ng / mL.
[0064] In some embodiments, the specific method for preparing the HER2 ECD protein solution is as follows: dissolve the HER2 ECD protein in a TE buffer solution.
[0065] In some embodiments, the volume ratio of the HER2 ECD protein solution, solution 1, solution 2, solution 3, solution 4, and solution 5 is 1:1:1:1:1:1.
[0066] In some embodiments, the molar concentration of the magnesium chloride solution is 45 mM-55 mM.
[0067] In some embodiments, the molar ratio of the magnesium chloride solution to the dipotassium hydrogen phosphate solution is 2:1.
[0068] In some embodiments, the volume ratio of HER2 ECD protein solution, solution 1, solution 2, solution 3, solution 4, and solution 5 to magnesium chloride solution and dipotassium hydrogen phosphate solution is 20:2:1.
[0069] In some embodiments, the pH of the mixed solution is 4.5-8.5.
[0070] In some embodiments, the reagent used to adjust the pH of the mixed solution is a sodium hydroxide solution.
[0071] In some embodiments, the temperature for mixing and heating is 94°C-96°C, and the heating time is 1.5 min-2.5 min.
[0072] In some embodiments, the heating temperature is 94°C-96°C, and the heating time is 2.5 min-3.5 min.
[0073] In some embodiments, the room temperature is 25°C-30°C.
[0074] In some embodiments, the incubation temperature is 36°C-40°C, and the incubation time is 0.8h-1.2h.
[0075] In some embodiments, the fluorescent group is FAM.
[0076] In some embodiments, the quenching group is BHQ1.
[0077] In some embodiments, the synthesis and purification process in step S1 is a well-known method in the art, which can be achieved by sending the designed trigger probe sequence, hairpin chain, fluorescent group, and quencher group to a biotechnology company for synthesis and purification.
[0078] The following specific embodiments will be used as examples:
[0079] Example 1:
[0080] (1) Probe preparation:
[0081] Based on the aptamer sequence study of HER2 ECD, the trigger probe sequence for the NHCR system, including the hairpin chain, fluorescent group, and quencher group, was designed and optimized. The designed sequence was sent to Shanghai Sangon Biotech for synthesis and purification. The fluorescent group was FAM, and the quencher group was BHQ1.
[0082] (2) Synthesis of the NHCR system:
[0083] During the synthesis process, all base sequences were obtained by dissolving the DNA in TE buffer (commercially available from Shanghai Sangon Biotech Co., Ltd.). Trigger DNA solution (10 μM) and HER2 ECD aptamer solution (10 μM) were mixed at a volume ratio of 1:1 and heated to 95 °C for 3 min, then gradually cooled to room temperature (25 °C) to form partially complementary double-stranded DNA, yielding solution 1. The corresponding NLH1-NLH4 strands were then heated separately to 95 °C for 3 min, followed by slow cooling to room temperature. The molar concentrations of hairpin NLH1 in solution 2, hairpin NLH2 in solution 3, hairpin NLH3 in solution 4, and hairpin NLH4 in solution 5 were 0.1 μM, 0.2 μM, 0.2 μM, and 0.4 μM, respectively. The HER2 ECD protein solution (20 ng / mL) was then added to solutions 1, 2, 3, 4, and 5 in a volume ratio of 1:1:1:1:1:1, resulting in a final volume of 50 μL. Subsequently, 5 μL of 50 mM Mg2Cl solution (magnesium chloride solution) and 2.5 μL of 25 mM K2HPO4 solution (potassium hydrogen phosphate solution) were added. During mixing, the pH was adjusted to 6.1 using sodium hydroxide solution. The mixture was incubated at 38°C for 1 h, and the formation of the product was detected. This product is denoted as NHCR4.
[0084] Comparative Example 1: Preparation process of linear HCR:
[0085] (1) Probe preparation:
[0086] Based on the study of aptamer sequences of HER2 ECD, hairpin strands were designed using the trigger probe sequence, fluorescent group, and quencher group from Example 1. The designed sequence was sent to Shanghai Sangon Biotech for synthesis and purification.
[0087] (2) Synthesis of HCR system:
[0088] During the synthesis process, all base sequences were obtained by dissolving the DNA in TE buffer (commercially available from Shanghai Sangon Biotech Co., Ltd.). Trigger DNA solution (10 μM) and HER2 ECD aptamer solution (10 μM) were mixed and heated to 95 °C for 3 min, then gradually cooled to room temperature (25 °C) to form partially complementary double-stranded DNA, yielding solution 1. The corresponding LH1-LH2 strands were then heated separately to 95 °C for 3 min, followed by slow cooling to room temperature. The molar concentrations of hairpin LH1 in solution 2 and hairpin LH2 in solution 3 were 0.1 μM and 0.2 μM, respectively. The HER2ECD protein solution (20 ng / mL) was added to solutions 1, 2, and 3, and the total volume was 50 μL. Then, 5 μL of 50 mM Mg2Cl solution and 2.5 μL of 25 mM K2HPO4 solution were added. During the mixing process, the pH value was adjusted to 6.1 with sodium hydroxide solution. The mixture was incubated at 38 °C for 1 h, and the formation of the final product was detected.
[0089] The hairpin LH1 sequence is shown in SEQ ID NO.6, and the hairpin LH2 sequence is shown in SEQ ID NO.7. The fluorescent group is FAM, and the quenching group is BHQ1.
[0090] SEQ ID NO.6 consists of a fluorescent group and a quenching group linked in the sequence CTTCCTAACCGCCCACAAAGTTCAGCGGGG, specifically CTTCCT-quenching group-AACCGCCCACAAAGTTCAGCGGGG-fluorescent group.
[0091] SEQ ID NO.7 consists of a fluorescent group and a quenching group linked in the sequence TTTTGGGCGGTTAGGAAGCCCCGCTGAACTTTG, specifically TTT-fluorescent group-TGGGCGGTTAGGAAGCCCCGCTGAA-quenching group-CTTTG. Comparative Example 1 is denoted as HCR2.
[0092] Comparative Example 2: The preparation method of Comparative Example 1 was used, but Comparative Example 2 only used hairpin LH1. Comparative Example 2 is denoted as: HCR1.
[0093] Comparative Example 3: The preparation method of Example 1 was used, but Comparative Example 3 only used hairpin NLH1. Comparative Example 3 is denoted as NHCR1.
[0094] Comparative Example 4: The preparation method of Example 1 was used, but Comparative Example 4 only used hairpins NLH1 and NLH2. Comparative Example 4 is denoted as NHCR2.
[0095] Comparative Example 5: The preparation method of Example 1 was used, but Comparative Example 5 only used hairpins NLH1, NLH2, and NLH3. Comparative Example 5 is denoted as NHCR3.
[0096] The detection product obtained in Example 1 was used to detect HER2 ECD protein:
[0097] (1) Atomic mechanical microscopy (AFM) detection:
[0098] The final products formed in this invention were characterized by atomic mechanical microscopy after adding 0 ng / mL and 50 ng / mL HER2 ECD protein, respectively.
[0099] (2) X-ray diffraction spectroscopy (XRD):
[0100] The target substance HER2 ECD protein was added to the final reaction solution formed in Example 1, and X-ray diffraction spectroscopy was performed on the solution after the addition of the target substance HER2 ECD protein.
[0101] (3) Comparison of reaction rates between linear HCR and NHCR:
[0102] The intensity and rate of fluorescence signals of both linear and nonlinear self-assembly reactions were detected by triggering them with corresponding hairpin chains.
[0103] Results analysis:
[0104] Figure 1 The results of atomic mechanical microscopy can be used to observe whether there are unassembled scattered structures and assembled cross-shaped branching structures under the microscope, which can confirm the morphology of the NHCR end products. Figure 1 In Figure 1 A and Figure 1 B shows a scattered structure under the microscope, confirming that when the added HER2 ECD protein is 0 ng / mL, the HER2 ECD protein does not assemble with the hairpin structure and aptamer trigger probe. Figure 1 C and Figure 1 D shows that when 50 ng / mL of HER2 ECD protein is added, the HER2 ECD protein assembles with the hairpin structure and aptamer-triggered probe to form the expected DNA macromolecule. Figure 1 C and Figure 1 D shows a more obvious branched structure, proving that the method of the present invention can successfully detect the HER2 ECD protein in the serum of gastric cancer.
[0105] exist Figure 2In the study, X-ray diffraction spectra were performed on the HER2 ECD protein, the target substance, after its addition. The results showed the formation of a highly crystalline single peak, further confirming that the analyte has a stable structure.
[0106] exist Figure 3 In section B, the reaction rates and fluorescence intensities of the detectables obtained by linear HCR (HCR1, HCR2) and nonlinear NHCR (NHCR1, NHCR2, NHCR3, NHCR4) were compared. The results showed that the detectables obtained by the present invention had higher fluorescence intensities and better reaction rates. The results confirm that the method of the present invention obtains detectables with higher reaction rates and detection signals.
[0107] In this invention, the effects of pH value and incubation temperature on the fluorescence intensity of the analyte during mixing were further investigated, and the results are as follows: Figure 3 A and Figure 3 As shown in C. In Figure 3 In study A, it was found that the fluorescence intensity of the analyte increased with increasing pH value. However, the pH value in the reaction environment could not exceed 8.5. If the pH value in the reaction environment was too high, the interaction between ions in the hybridization buffer would be affected. Therefore, the pH value range of the mixed environment was further selected to be 4.5-8.5.
[0108] As the incubation temperature increases, the fluorescence intensity of the analyte increases. However, excessively high incubation temperatures can affect the stability of the target protein. Therefore, the incubation temperature is 36℃-40℃.
[0109] In summary, the nonlinear hybridization chain reaction method of the present invention can successfully detect the HER2 ECD protein in gastric cancer serum.
[0110] It should be noted that the terminology used in this invention is for describing specific embodiments only and is not intended to limit the scope of this application. As shown in this specification, unless the context clearly indicates otherwise, words such as "a," "an," "an," and / or "the" do not specifically refer to the singular and may include the plural. The terms "comprising," "including," or any other variations thereof are intended to cover a non-exclusive inclusion, such that a process, method, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, or apparatus. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, or apparatus that includes said element.
[0111] It should also be noted that the terms "center," "upper," "lower," "left," "right," "vertical," "horizontal," "inner," and "outer," etc., indicate the orientation or positional relationship based on the orientation or positional relationship shown in the accompanying drawings, and are only for the convenience of describing the present invention and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, or be constructed and operated in a specific orientation, and therefore should not be construed as a limitation of the present invention. Unless otherwise expressly specified and limited, the terms "installed," "connected," "linked," etc., should be interpreted broadly. For example, they can refer to a fixed connection, a detachable connection, or an integral connection; they can refer to a mechanical connection or an electrical connection; they can refer to a direct connection or an indirect connection through an intermediate medium; they can refer to the internal communication of two components. For those skilled in the art, the specific meaning of the above terms in the present invention can be understood according to the specific circumstances.
[0112] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the technical solutions of the embodiments of the present invention.
Claims
1. A method for preparing a serum HER2 ECD assay for detecting gastric cancer, characterized in that, Includes the following steps: Step S1: Based on the sequence of the aptamer of HER2 ECD in gastric cancer serum, a trigger probe sequence and hairpin chain for nonlinear hybridization chain reaction were designed, synthesized and purified, and fluorescent groups and quenching groups were modified at both ends of the hairpin chain. Step S2: Dissolve the trigger probe sequence and the aptamer of HER2 ECD in buffer solution, mix and heat, then cool to room temperature to obtain solution 1; The hair clip chain includes hair clips NLH1, NLH2, NLH3, and NLH4. Hairpins NLH1, NLH2, NLH3, and NLH4 were dissolved in buffer solution, heated, and cooled to room temperature to obtain solutions 2, 3, 4, and 5, respectively. The HER2 ECD protein solution was mixed with solution 1 at room temperature, and then solutions 2, 3, 4, 5, magnesium chloride solution, and dipotassium hydrogen phosphate solution were added to form a mixed solution. The pH value of the mixed solution was adjusted during the formation of the mixed solution, and the mixture was incubated to form the detection analyte. The trigger probe sequence is shown in SEQ ID NO.1; The sequence of the hair clip NLH1 is shown in SEQ ID NO.2, the sequence of the hair clip NLH2 is shown in SEQ ID NO.3, the sequence of the hair clip NLH3 is shown in SEQ ID NO.4, and the sequence of the hair clip NLH4 is shown in SEQ ID NO.
5.
2. The method according to claim 1, characterized in that, The buffer solution is a TE buffer solution.
3. The method according to claim 1, characterized in that, In step S2, the trigger probe sequence and the aptamer of HER2 ECD are dissolved in buffer solution. Before mixing and heating, the molar ratio of the trigger probe sequence to the aptamer is 1:
1. In step S2, the trigger probe sequence and the HER2 ECD aptamer are dissolved in buffer solution. Before mixing and heating, the molar concentration of the trigger probe sequence is 10 μM.
4. The method according to claim 1, characterized in that, Before mixing and heating, the buffer containing the trigger probe sequence is mixed with the buffer containing the HER2 ECD aptamer, with the ratio of the buffer containing the trigger probe sequence to the buffer containing the HER2 ECD aptamer by volume being 1:
1.
5. The method according to claim 1, characterized in that, The molar concentration ratio of hairpin NLH1 in solution 2, hairpin NLH2 in solution 3, hairpin NLH3 in solution 4, and hairpin NLH4 in solution 5 is 1:2:2:4; The molar concentration of hairpin NLH1 in solution 2 is 0.1 μM.
6. The method according to claim 1, characterized in that, The mass concentration of the HER2 ECD protein solution was 20 ng / mL.
7. The method according to claim 1, characterized in that, The volume ratio of the HER2 ECD protein solution, solution 1, solution 2, solution 3, solution 4, and solution 5 is 1:1:1:1:1:1; The volume ratio of HER2 ECD protein solution, solution 1, solution 2, solution 3, solution 4, and solution 5 to magnesium chloride solution and dipotassium hydrogen phosphate solution is 20:2:
1.
8. The method according to claim 1, characterized in that, The molar concentration of the magnesium chloride solution is 45 mM-55 mM; The molar ratio of the magnesium chloride solution to the dipotassium hydrogen phosphate solution is 2:
1.
9. The method according to claim 1, characterized in that, The pH value of the mixed solution is 4.5-8.5; The temperature for mixing and heating is 94℃-96℃, and the heating time is 1.5min-2.5min; The heating temperature is 94℃-96℃, and the heating time is 2.5min-3.5min; The incubation temperature is 36℃-40℃, and the incubation time is 0.8h-1.2h.
Citation Information
Patent Citations
HER2 (Human Epidermal Growth Factor Receptor 2) protein nucleotide aptamer, complex composition and applications thereof
CN103290017A
Fluorescence method for detecting serum vifatin
CN115948542A