A weak strain of Riemerella anatipestifer, clpS gene knockout method, use and vaccine

Abstract

The invention belongs to the biological field, and discloses a weak strain of Riemerella anatipestifer, which is a clpS gene-deficient strain. The strain achieves a lower lethality rate and a higher protective effect by knocking out the clpS gene. At the same time, the invention also provides a method for knocking out the clpS gene, the use of the weak strain, and a vaccine.

Description

Technical Field

[0001] The invention relates to the biological field, and in particular to a weak strain of Riemerella anatipestifer, a clpS gene knockout method, use and a vaccine. Background Art

[0002] Riemerella anatipestifer (RA) belongs to the family Flavobacteriaceae. It is a Gram-negative short rod-shaped bacterium with blunt ends under a microscope. Riemerella anatipestifer is the main pathogen that causes serositis and meningitis in ducklings. It has attracted people's attention due to its high morbidity and mortality. In particular, it causes a large number of deaths and developmental delays in ducklings, and is one of the most serious infectious diseases that endanger the duck farming industry.

[0003] Riemerella anatipestifer infection is widely distributed in duck farms around the world, mainly harming newborn ducklings. At least 21 serotypes have been reported so far, and cross-protection between different serotypes is weak, limiting the use of attenuated vaccines. Clinical prevention and control mainly relies on the long-term use of antibiotics, but the use of antibiotics has led to the emergence of drug-resistant strains.

[0004] Regarding the development of attenuated strains of Riemerella anatipestifer, the prior art discloses:

[0005] CN106701650B A gene-deficient attenuated strain of Riemerella anatipestifer and its construction method and application;

[0006] The document discloses that after knocking out the B739_1343 fragment, 10 In the case of CFU injection, the survival rate was 70%;

[0007] Therefore, the technical problem to be solved in this case is: how to develop a new attenuated strain of Riemerella anatipestifer. Summary of the invention

[0008] The purpose of the present invention is to provide a weak strain of Riemerella anatipestifer, which achieves a lower lethality rate and a higher protective effect by knocking out the clpS gene.

[0009] At the same time, the present invention also provides a method for knocking out the clpS gene, the use of the attenuated strain and a vaccine.

[0010] To achieve the above object, the present invention provides the following technical solutions:

[0011] A Riemerella anatipestifer attenuated strain, wherein the Riemerella anatipestifer attenuated strain is a clpS gene deleted strain.

[0012] At the same time, the present invention also discloses a method for knocking out the clpS gene of Riemerella anatipestifer, comprising the following steps:

[0013] Step 1: amplify the upstream homology arm and the downstream homology arm of the clpS gene of Riemerella anatipestifer, and add a resistance gene and a reverse screening gene between the upstream homology arm and the downstream homology arm to obtain a fusion gene fragment;

[0014] Step 2: Clone the fusion gene fragment into the shuttle plasmid to obtain a recombinant plasmid;

[0015] Step 3: The recombinant plasmid is transformed into Riemerella anatipestifer, and after screening, a weak strain of Riemerella anatipestifer with the clpS gene knocked out is obtained.

[0016] In the above-mentioned clpS gene knockout method, the nucleotide sequence of the fusion gene fragment is shown as SEQ ID NO.1.

[0017] In the above-mentioned clpS gene knockout method, the shuttle plasmid is pBluescript II.

[0018] In the above-mentioned clpS gene knockout method, the step 3 is specifically:

[0019] Step 31: transforming the recombinant plasmid into Riemerella anatipestifer for transformation;

[0020] Step 32: Screening the transformed bacteria with spectinomycin to obtain spectinomycin-resistant bacteria;

[0021] Step 32: After the bacteria obtained in step 32 are expanded and cultured, single colonies that cannot grow in the presence of spectinomycin are selected for PCR identification to obtain a weak strain of Riemerella anatipestifer with the clpS gene knocked out.

[0022] In the above-mentioned clpS gene knockout method, in step 31, the culture medium used is TSB culture medium containing 5 wt % fetal bovine serum, and KCl and CaCl2 are additionally added to the TSB culture medium.

[0023] In the above-mentioned clpS gene knockout method, 10 mM KCl and 20 mM CaCl2 were additionally added to the TSB medium.

[0024] In the above-mentioned clpS gene knockout method, 1-3 μg of recombinant plasmid and 1-5×10 9 a Riemerella anatipestifer; the transformation method is natural transformation.

[0025] At the same time, the invention also discloses the use of the attenuated strain of Riemerella anatipestifer as described above for preparing a vaccine.

[0026] Finally, the present invention discloses a vaccine containing the attenuated strain of Riemerella anatipestifer as described above.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The attenuated strain of Riemerella anatipestifer obtained by the present invention achieves a lower lethality rate and a higher protective effect by knocking out the clpS gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 is a structural diagram of the recombinant plasmid pBlue-clpS-spc-sacb;

[0030] Figure 2 It is a structural diagram of the recombinant plasmid pBlue-clpS. DETAILED DESCRIPTION

[0031] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0032] 1. Source of raw materials

[0033] Riemerella anatipestifer (RA): The clinical isolate of Riemerella anatipestifer serotype 1 (GD2021) was isolated from clinically ill ducks in our laboratory.

[0034] TSA culture medium: purchased from Beijing Solebow Technology Co., Ltd.

[0035] TSB medium: purchased from Beijing Solebow Technology Co., Ltd.

[0036] Shuttle plasmid pBluescript II: purchased from Shanghai Zeye Biotechnology Co., Ltd.

[0037] 2. Construction of clpS gene homologous recombination plasmid

[0038] 2.1 Preparation of recombinant plasmid pBlue-clpS-spc-sacb

[0039] The sequence of the clpS gene (B739_1609) of Riemerella anatipestifer was downloaded from the NCBI website. Primers ClpS-up-F, ClpS-up-R, ClpS-down-F, and ClpS-down-R for upstream and downstream gene fragments of homologous recombination were designed using Primer5 software. The SacB reverse screening gene sequence was amplified from the pRE112 plasmid using primers SacB-F and SacB-R, and the spectinomycin resistance gene Spc was amplified from the pIC333 plasmid using primers Spc-F and Spc-R. The primer sequences are shown in Table 1. The concatenated fragments (fusion genes) were cloned into the homologous recombination plasmid pBluescript II to obtain the recombinant plasmid pBlue-clpS-spc-sacb. The structure of the recombinant plasmid pBlue-clpS-spc-sacb is shown in Table 1. Figure 1 The nucleotide sequence of the fusion gene is shown in SEQ ID NO.1.

[0040] SEQ ID NO.1

[0041]

[0042] 2.2 Preparation of recombinant plasmid pBlue-clpS

[0043] The sequence of the Riemerella anatipestifer clpS gene (B739_1609) was downloaded from the NCBI website. Primer5 software was used to design primers ClpS-up-F1, ClpS-up-R1, ClpS-down-F1, and ClpS-down-R1 for the upstream and downstream gene fragments of homologous recombination. The concatenated fragments (fusion gene 2) were cloned into the homologous recombination plasmid pBluescript II to obtain the recombinant plasmid pBlue-clpS. The structure of the recombinant plasmid pBlue-clpS is shown in the figure Figure 2 As shown, the nucleotide sequence of fusion gene 2 is shown as SEQ ID NO.2.

[0044] SEQ ID NO.2

[0045] CTTATTGGGTTAAAGCTACACAACCACTCGAAGAAATTAACGATTTTTTACCAAAACCACTACCTGAAGAGGGTGAGTTTAATACTTTAGCAGGTTTTATACTTCATCGTTTGGAAGAAATTCCAGAGGAAAATCAAGAGTTTGATTTTGAAAATTACCA TTTTAAAATACTTAAAATGAATAATAAAAGTGTAGAAATGGTAGAGCTTACCTATGATGATAGCTTTTTTGGAGAATCGGGGGAAGGAACTAATGCTAACTAGTAGCTATTTCAAACTATGAAGAAATAATCTCATGCGTTGGTTGAAGTTTGTTTTAGT TTTAGGGGTGCTTTTGGCAGGTGTTTATGCGGTCTCCATGTTGTTTGTTGATGAGAGCAAATCCTTTAAAGTAGAAAGAGAACTTGATTATCCCATAGATAAAGTTTATCCACAATTTAGTAACTTTCAGAATCTTACCAGGTGGTATCAGTACTTTACC CAAAATCCTAAATTGAAATTTGAATACTTTTTACCTTATGAAGGGCAGGGAAGTTCTATGAACTTTGTAGATGCTAAAGAAGGGGTAGGAATGGTATTTATTAGATATGAAAACTTTGAAAAAACTCTGAGATACGAGTTTTTTGATGCGGATACTAATG

[0046] Table 1 Primer information

[0047]

[0048] 3. Construction of RA clpS gene deletion strain

[0049] The homologous recombination plasmid was transferred into RA by natural transformation as follows:

[0050] The revived RA was diluted to 1×10 7The cells were inoculated at an inoculation concentration of 1.5 CFU / mL in TSB medium (containing 10 mM KCl and 20 mM CaCl2) containing 5% FBS, and cultured at 37°C with shaking until the logarithmic growth phase. 1 mL of bacterial solution was centrifuged at 5000 rpm for 5 min, and the cells were resuspended in 100 μL of TSB medium, and 1 μg of recombinant plasmid pBlue-clpS-spc-sacb was added. The cells were placed in a 37°C incubator for 2 h, and then all of them were spread in TSA medium containing 5% FBS and 30 μg / mL spectinomycin, and cultured in a 37°C incubator for screening and culture for 3 days. Single colonies were picked for PCR identification.

[0051] In the process of homologous recombination by natural transformation, the TSB medium was optimized through the following process, and multiple experiments were conducted, and finally the transformation was carried out according to the above optimal formula; specifically, refer to Table 2 below, which records the formula of the TSB medium used in previous experiments;

[0052] Table 2 Formulation of TSB medium

[0053] First optimization Second optimization The third optimization The fourth optimization KCl - - 10mM 10mM <![CDATA[CaCl2]]> - 20mM - 20mM FBS 5％ 5％ 5％ 5％ Single colony 0～1 0～5 0～5 46～51 Transformation efficiency <![CDATA[(0~1)×10 9 ]]> <![CDATA[(0~5)×10 9 ]]> <![CDATA[(0~5)×10 9 ]]> <![CDATA[(46~51)×10 9 ]]> Success rate 0％ 0％ 0％ 100％(8 / 8)

[0054] The transformants obtained in the first round of screening were then subjected to a second round of screening using the reverse screening marker gene SacB. The method is as follows:

[0055] The transformants obtained in the first round of screening were cultured under shaking until the logarithmic growth phase. 1 mL of bacterial solution was centrifuged at 5000 rpm for 5 min, resuspended in 100 μL of TSB medium, and 1 μg of plasmid pBlue-clpS was added. The cells were placed in a 37°C incubator for 2 h, and then all were spread in TSA medium containing 5% sucrose and 5% FBS. The cells were placed in a 37°C incubator for screening and culture for 3 days. Single colonies that could not grow on spectinomycin-resistant plates were picked for PCR identification and sequencing verification.

[0056] The sequencing results showed that the genome of the constructed RA clpS gene deletion strain had a 288bp sequence deletion in the clpS gene functional region, resulting in the inactivation of the clpS gene. The mutation region was continuously passaged 20 times without recurrence, indicating that the RA clpS gene deletion strain was successfully constructed and can be stably inherited.

[0057] 4. Bacterial growth curve of RA clpS gene deletion strain

[0058] The wild-type RA and clpS gene-deficient strains were cultured at 1×10 6 The TSB medium was inoculated with a starting concentration of CFU / mL, and bacterial samples were collected every 1 hour for plate counting until 12 hours of culture, and the growth of the wild strain and the clpS gene-deficient strain in the TSB medium was counted;

[0059] The results showed that the deletion of clpS gene did not affect the bacterial growth rate of RA, and there was no significant difference in the number of bacteria at each time point.

[0060] 5. Bacterial virulence of RA clpS gene deletion strain

[0061] Sixty one-day-old ducklings were randomly divided into six groups. One group of ducklings was inoculated with the RA parent strain (10 7 CFU / bird), and the other 4 groups of ducklings were inoculated with the RA clpS gene deletion strain (10 7 CFU / pc, 10 8 CFU / pc, 10 9 CFU / pc, 10 10 CFU / bird), and the last group of ducklings were inoculated with PBS by leg muscle injection as a control. The ducklings were observed for 7 consecutive days, and the mortality rate was counted to evaluate the virulence of the bacteria. The results of the virulence test can be seen in Table 3;

[0062] Table 3 Statistical results of the number of viable strains

[0063]

[0064] Virulence tests showed that the parent strain had a 100% mortality rate for ducklings, while all ducklings in the clpS gene-deficient strain group survived, with a mortality rate of 0%.

[0065] RA parent strain LD 50 6.76×10 8 CFU, RA clpS gene deletion strain LD 50 >10 10 CFU.

[0066] 6. Immune protection of RA clpS gene deletion strain

[0067] The clpS gene-deficient strain was injected intramuscularly (10 8 CFU / each dose, 14 days after the first immunization, 10 7 Ducklings immunized with the parent strain at a dose of 100 CFU / each could resist the challenge of the parent strain with a survival rate of 100%, while all the ducklings in the PBS immunization control group died.

[0068] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.

Claims

1. A strain of Riemerella anatipestifer ( Riemerella anatipestifer ) A weak strain, characterized in that The attenuated strain of Riemerella anatipestifer is a clpS gene deleted strain.

2. A method for knocking out the clpS gene of Riemerella anatipestifer, characterized in that: The steps include: Step 1: amplify the upstream homology arm and the downstream homology arm of the clpS gene of Riemerella anatipestifer, and add a resistance gene and a reverse screening gene between the upstream homology arm and the downstream homology arm to obtain a fusion gene fragment; Step 2: Clone the fusion gene fragment into the shuttle plasmid to obtain a recombinant plasmid; Step 3: The recombinant plasmid is transformed into Riemerella anatipestifer, and after screening, a weak strain of Riemerella anatipestifer with the clpS gene knocked out is obtained.

3. The clpS gene knockout method according to claim 2, characterized in that: The nucleotide sequence of the fusion gene fragment is shown in SEQ ID NO.

1.

4. The clpS gene knockout method according to claim 2, characterized in that: The shuttle plasmid is pBluescript II.

5. Use of the attenuated strain of Riemerella anatipestifer as claimed in claim 1 in preparing a vaccine against Riemerella anatipestifer.

6. A vaccine against Riemerella anatipestifer, characterized in that: Contains the attenuated strain of Riemerella anatipestifer as claimed in claim 1.

Images