A marine collagenase Baligenase and its application in preparing cowhide collagen tripeptide

Abstract

The present invention relates to the field of polypeptides, and in particular to a marine collagenase Baligenase and its application in preparing cowhide collagen tripeptides. The present invention screens out a collagenase Baligenase from marine licheniformis Bacillus licheniformis A‑2 of marine origin, and its amino acid sequence is shown in SEQ ID NO: 1. The present invention also provides a Bacillus subtilis strain for producing Baligenase, and fermentation can obtain Baligenase with high enzyme activity. Compared with commercially available alkaline protease hydrolysis Alcalase, the marine collagenase Baligenase of the present invention is used for the production of cowhide collagen tripeptides, and the obtained enzymatic hydrolysis product has a molecular weight <500Da oligopeptide ratio increased by 16.2%, and the content of collagen tripeptide increased by 2.35 times.

Description

Technical Field

[0001] The invention relates to the field of polypeptides, and in particular to marine collagenase Baligenase and application thereof in preparing bovine skin collagen tripeptide. Background Art

[0002] Collagen is the most abundant fibrous structural protein in humans and animals, accounting for about 30% of the total protein. It is widely distributed in various tissues and organs such as skin, tendons, bones, ligaments and blood vessels, and plays a very important role in humans and animals. However, as people age, they lose a lot of collagen, and collagen supplementation has become a popular method for beauty and anti-aging.

[0003] Collagen peptides are low molecular weight peptide products produced after collagen is hydrolyzed by acid or enzymes. Compared with collagen, collagen peptides have good solubility, are easy to absorb, have the physiological function of quickly replenishing collagen and other biological activities. Therefore, collagen peptides are one of the most popular raw materials for anti-aging and beauty products. They have been widely used in medicine, cosmetics and health foods, and the market demand at home and abroad is growing rapidly. Collagen tripeptide (CTP) refers to collagen peptide products rich in tripeptides. It is a high-end product among collagen peptides that has emerged in recent years. Scientific experiments have confirmed that collagen tripeptide can be directly absorbed into the blood in the small intestine, and then quickly enter various tissues and organs to play a role. Reports show that collagen tripeptide has physiological functions such as stimulating the proliferation of mouse and human skin fibroblasts, promoting hyaluronic acid synthesis, and reducing the loss of water in mouse skin. Therefore, the market for collagen tripeptide in my country is currently growing rapidly.

[0004] The raw materials for the production of collagen tripeptides in my country are mainly various animal processing wastes rich in collagen, such as fish skin, scales and bones, as well as skin and bones of livestock and poultry such as cattle, sheep and chickens. my country is a major country in the breeding and processing of edible cattle. The cowhide collagen produced during the processing of edible cattle has a high content of collagen and is a good raw material for the preparation of collagen tripeptides. The amino acid sequence of collagen is composed of a repeating sequence of (GXY) tripeptides as units. Therefore, the development of low-cost and high-efficiency enzymes that can produce (GXY) tripeptides by cutting at specific points on the cowhide collagen sequence is the key to the preparation of collagen tripeptides and the prerequisite for industrialization. Summary of the invention

[0005] In order to solve the above technical problems, the inventors screened out a collagen protein Baligenase from the marine licheniformis Bacillus licheniformis A-2 from the ocean, achieved efficient secretory expression in the Bacillus subtilis host, and obtained Baligenase with high enzyme activity by fermentation; compared with commercially available proteases, Baligenase can be used for the preparation of bovine skin collagen tripeptides, which can significantly increase the oligopeptide ratio and collagen tripeptide content.

[0006] The first aspect of the present invention provides a marine collagenase Baligenase, whose amino acid sequence is shown as SEQ ID NO:1.

[0007] Furthermore, the coding sequence of the marine collagenase Baligenase is shown as SEQ ID NO:2.

[0008] The second aspect of the present invention provides a recombinant plasmid, wherein the recombinant plasmid contains an expression frame of the marine collagenase Baligenase, and the coding sequence of the marine collagenase Baligenase is shown in SEQ ID NO:2.

[0009] The third aspect of the present invention provides a strain for producing marine collagenase Baligenase, wherein the strain contains the recombinant plasmid.

[0010] Furthermore, the strain is Bacillus subtilis.

[0011] The fourth aspect of the present invention provides the use of the marine collagenase Baligenase in the preparation of collagen tripeptides by enzymatic hydrolysis of cowhide.

[0012] The fifth aspect of the present invention provides a method for preparing bovine skin collagen tripeptide, comprising: pre-treating the bovine skin, adding water to the pre-treated bovine skin, using marine collagenase Baligenase to enzymatically hydrolyze the bovine skin for a certain period of time, heating the enzyme to inactivate it, and then removing impurities, filtering and drying to obtain peptide powder rich in fish skin collagen tripeptide.

[0013] Furthermore, the pretreatment includes cleaning and degreasing.

[0014] Furthermore, the enzyme inactivation parameters are: heating to 85° C., maintaining for 30 minutes, and inactivating the enzyme.

[0015] Furthermore, the process parameters of the enzymatic hydrolysis of the marine collagenase Baligenase are: pH 8.0-9.0, enzymatic hydrolysis temperature 40-60° C.; the dosage of alkaline protease per gram of fish skin is 2000-6000 U / g, and the enzymatic hydrolysis time is 1-6 hours.

[0016] Furthermore, the impurity removal is to add activated carbon for decolorization and deodorization, and the drying is spray drying.

[0017] Compared with the prior art, the beneficial effects of the present invention include at least:

[0018] 1. The present invention screened out a marine collagenase Baligenase derived from the ocean, which can specifically and efficiently cleave the collagen sequence to produce GXY tripeptide, which is the first discovery.

[0019] 2. The present invention obtains a Bacillus subtilis strain capable of efficiently producing highly active marine collagenase Baligenase through the construction of plasmids and strains.

[0020] 3. Compared with the commercially available alkaline protease Alcalase, the marine collagenase Baligenase of the present invention is used for the production of bovine collagen tripeptide. In the obtained enzymatic hydrolysis product, the proportion of oligopeptides with a molecular weight of <500 Da is increased by 16.2%, and the content of collagen tripeptide is increased by 2.35 times. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The wet weight and enzyme activity curve of Bacillus subtilis ST308 in 30L reactor;

[0022] Figure 2 This is the liquid chromatogram of the molecular weight of peptides in the enzymatically hydrolyzed cowhide mixture;

[0023] Figure 3 This is a chromatogram showing the detection of tripeptide content in the enzymatically hydrolyzed cowhide mixture. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical scheme and beneficial effects of the present invention clearer, the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments. Examples of the embodiments are shown in the accompanying drawings. It should be understood that the specific embodiments described in the following embodiments of the present invention are only exemplary descriptions of the specific embodiments of the present invention, and are intended to be used to explain the present invention, but do not constitute a limitation of the present invention.

[0025] The endpoints of ranges and any values ​​disclosed herein are not limited to the exact range or value, and these ranges or values ​​should be understood to include approximations to these ranges.

[0026] The formula of the culture medium involved in the embodiments of the present invention is as follows, % refers to mass percentage:

[0027] LB liquid medium: 1% tryptone, 0.5% yeast powder, 0.5% NaCl;

[0028] LB plate: 1% tryptone, 0.5% yeast powder, 0.5% NaCl, 1.5% agar;

[0029] Skim milk powder plate: 1% tryptone, 0.5% yeast powder, 0.5% NaCl, 1% skim milk powder, 1.5% agar;

[0030] Seed culture medium: yeast powder 0.5%, tryptone 0.5%, NaCl 0.5%, glucose 1%;

[0031] Shake flask fermentation medium: yeast powder 0.2 g / L, cottonseed cake powder 20 g / L, glucose 5 g / L, dipotassium hydrogen phosphate 3 g / L, potassium dihydrogen phosphate 1.5 g / L, magnesium sulfate heptahydrate 0.5 g / L, ammonium sulfate 0.35 g / L, manganese sulfate 0.2 g / L, ferrous sulfate heptahydrate 0.1 g / L, calcium carbonate 0.1 g / L, pH 7.0;

[0032] 30L reactor culture medium: cottonseed cake powder 100g / L, yeast extract powder 5.8g / L, potassium dihydrogen phosphate 7.5g / L, disodium hydrogen phosphate 6.4g / L, magnesium sulfate heptahydrate 2.3g / L, citric acid monohydrate 0.33g / L, calcium chloride dihydrate 1g / L, ferrous sulfate heptahydrate 0.06g / L.

[0033] Example 1 Cloning of collagenase gene baligenase

[0034] The collagenase gene baligenase from marine licheniformis Bacillus licheniformis A-2 has an amino acid sequence as shown in SEQ ID NO: 1. The genome of strain Bacillus licheniformis A-2 was extracted according to the instructions of the bacterial genome extraction kit of Tiangen Biotechnology Co., Ltd. The baligenase gene fragment was amplified using primers bal-F and bal-Rv using the genome as a template.

[0035] PCR primers and reaction conditions are as follows:

[0036] bal-F: atggcttttattctattatttgcgttatc (SEQ ID NO: 3);

[0037] bal-Rv: ttattcgacgataaaagggtcttccg (SEQ ID NO: 4).

[0038] The PCR conditions were: 98°C for 2 min; 98°C for 10 s; 58°C for 20 s, 72°C for 90 s, 30 cycles; 72°C for 5 min. The PCR amplification product was recovered using a gel recovery kit, the fragment was cloned into the vector pMD-18T, the plasmid was extracted, and sent to Qingdao BGI Gene Research Center for sequencing analysis. The results showed that the nucleotide sequence of the collagenase gene baligenase is shown in SEQ ID NO: 2.

[0039] Example 2 Construction of collagenase gene baligenase expression plasmid pST308

[0040] The recombinant plasmid was constructed using the enzyme-free cloning method, namely the TaKaRa In-Fusion homologous recombination kit. The forward and reverse enzyme-free cloning primers were designed according to the sequence of baligenase and the sequence of the vector pST101: 308.bal-F and 308.bal-Rv.

[0041] 308.bal-F:cactgctggcaggaggcgcaactcaagcttttgccatggcttttattctattattttgc (SEQ ID NO: 5);

[0042] 308.bal-Rv:ggaaatccggtcgtctagcacagcacagttcctgttattcgacgataaaagggtcttc (SEQ ID NO: 6).

[0043] Using NEB phusion fidelity enzyme, pMD-18T-bal plasmid as template, primer "308.bal-F / Rv" was used to amplify the gene fragment baligenase used to construct the recombinant plasmid pST308, and gel recovery. The vector pST101 was cut with restriction endonucleases HindIII / BamHI, reacted at 37° for 2h, and the double-cut vector pST101 was recovered by gel. Using the TaKaRa In-Fusion kit, the molar ratio of vector and fragment in the 10μL reaction system was 1:3, the temperature was 50℃, and the reaction was carried out for 30min; the reaction liquid was transformed into 50μL Escherichia coli competent cells, coated with LB plates containing 100μg / ml ampicillin, and cultured at 37℃ for 12h. Among them, the plasmid whose sequencing results were consistent with the designed sequence was named pST308.

[0044] Example 3 Construction and shake flask verification of recombinant engineered bacteria Bacillus subtilis ST308

[0045] The above-mentioned recombinant expression plasmid pST308 was transformed into the host cell Bacillus subtilis WB600 by the natural competent state method. The specific transformation process is as follows: pick a freshly activated single colony of Bacillus subtilis WB600 and inoculate it into 5ml GMI solution, and culture it at 30℃ and 125r / min overnight; on the next day, take 1ml and transfer it to 9ml GMI, and culture it at 37℃ and 220r / min for 3.5h; then take 1ml of the culture solution in the previous step and transfer it to 9ml GMⅡ solution, culture it at 37℃ and 125r / min for 90min, and then collect the bacteria by centrifugation at 5000g for 10min; gently suspend the bacteria with 1ml GMⅡ solution, and the suspended bacteria are competent cells. Take 200uL of competent cells, add 10μL of recombinant plasmid pST308, culture it at 37℃ and 200r / min for 60min, then spread it on LB solid plate containing 20μg / mL kanamycin, and culture it at 37℃ overnight.

[0046] The next day, 30 transformants were selected for shake flask verification. The 30 transformants were inoculated into 5 mL of seed culture medium with a final kanamycin concentration of 20 μg / mL, cultured at 37°C, 220 r / min for 6 hours, transferred to 30 mL of shake flask culture medium, cultured at 37°C, 220 r / min for 48 hours, and the collagenase activity in the shake flask supernatant was determined using bovine type I insoluble collagen as a substrate. Among them, the highest activity measured was 22638.5 U / mL, and the corresponding strain was named Bacillus subtilis ST308, and the production titer of the strain was evaluated in a 30L reactor.

[0047] Example 4 30 L small tank fermentation of recombinant bacteria Bacillus subtilis ST308

[0048] Bacillus subtilis ST308 was streaked and activated on a plate with a final kanamycin concentration of 20 μg / mL, cultured at 37°C for 15 hours, 5-6 single colonies were picked and inoculated into 50mL of a first-level seed culture medium, cultured at 37°C, 220r / min for 5-6 hours, and then inoculated into 500mL of a second-level seed culture medium with a 2% inoculum, cultured at 37°C, 220r / min for 3 hours, and all were inoculated into a 30L tank. The 30L tank was pre-filled with 80% of the volume of the culture medium, and the culture medium formula used for fermentation was: 100g / L cottonseed cake powder, 5.8g / L yeast extract powder, 7.5g / L potassium dihydrogen phosphate, 6.4g / L disodium hydrogen phosphate, 2.3g / L magnesium sulfate heptahydrate, 0.33g / L citric acid monohydrate, 1g / L calcium chloride dihydrate, 0.06g / L ferrous sulfate heptahydrate, pH 7.0.

[0049] Fermentation conditions: temperature 37°C, stirring rate 500-550r / min, ventilation volume 1.8-2.0m 3 / h, dissolved oxygen was controlled at 20%-50%, and ammonia and 0.5mol / L phosphoric acid were automatically added during the fermentation process to maintain the pH value of the fermentation liquid at 7.0-7.5. Samples were taken every 2 hours, and the bacterial morphology was observed under a microscope, and the bacterial density OD600 and collagenase activity were measured. The results were as follows Figure 1 shown.

[0050] Collagenase activity unit: Using insoluble type I collagen from bovine Achilles tendon as substrate, the amount of enzyme required to degrade the substrate to produce 1 μmol of leucine per hour at 37°C and in the enzyme's optimal pH buffer is 1 activity unit, i.e. 1U (unit). The results showed that after 32 hours of fermentation, the collagenase activity in the fermentation broth of Bacillus subtilis ST308 was measured to be 97250.3U / mL using insoluble type I collagen from bovine Achilles tendon as substrate, achieving an unexpected production effect.

[0051] Example 5 Preparation of collagen tripeptide by enzymatic hydrolysis of cowhide using marine collagenase Baligenase

[0052] (1) Cleaning: Rinse the fresh cowhide with running water to remove excess water.

[0053] (2) Degreasing: Add 3% sodium hydroxide to the cleaned cowhide and soak for 5-10 hours, then wash the cowhide until the pH value is 7.5-8.0. Add distilled water with a mass of 150% of the cowhide, boil it, and remove it after the surface oil solidifies.

[0054] (3) Enzymatic hydrolysis: The cowhide solution obtained in step (2) was heated to 50°C and the pH was adjusted to 10.0-11.0 with calcium hydroxide. Commercially available alkaline protease Alcalase or collagenase Baligenase was added at an E / S ratio of 4000 U / g. During the enzymatic hydrolysis, the temperature was maintained at 50°C, the pH was 8.0-9.0, the stirring speed was 50 r / min, and the enzymatic hydrolysis was carried out for 3 hours.

[0055] (4) Inactivation of enzyme: The enzymatic hydrolyzate obtained in step (3) was heated to 85°C and maintained for 30 min to inactivate the enzyme.

[0056] (5) Decolorization and deodorization: After the temperature of the enzymatic hydrolyzate obtained in step (4) is lowered to 75°C-80°C, the pH is adjusted to 5.5 with phosphoric acid, and activated carbon is added in an amount of 2%, stirred for 40 minutes, and the pH is adjusted to 6.0-7.0.

[0057] (6) Filtration: Filter the enzymatic hydrolyzate obtained in step (5) to remove activated carbon and residue.

[0058] (7) Spray drying: spray drying the clarified enzymatic hydrolysate obtained in step (6) to obtain peptide powder rich in bovine collagen tripeptide.

[0059] The distribution of peptides in peptide powder was detected by liquid chromatography. Figure 2 As shown in Table 1. In the product of Alcalase hydrolysis for 3h, the proportion of peptides with a molecular weight of <1000Da was 83.45%, and the proportion of peptides with a molecular weight of <500Da was 57.37%. In the product of Baligenase hydrolysis, the proportion of peptides with a molecular weight of <1000Da increased to 90.32%, and the proportion of peptides with a molecular weight of <500Da was 66.67%, an increase of 8.2% and 16.2% respectively.

[0060] Table 1 Proportion of peptides with different molecular weights in the hydrolysate

[0061]

[0062] At the same time, the collagen tripeptide content was determined using GPH (Gly-Pro-Hyp) as the standard. The results are as follows Figure 3 As shown in Table 2. The content of collagen tripeptide increased from 16.29% to 38.31%, an increase of 2.35 times, which greatly increased the active substance composition, which has very good theoretical and economic benefits for the preparation and industrialization of cowhide collagen tripeptide.

[0063] Table 2 Content of collagen tripeptide in enzymatic hydrolysate

[0064]

[0065] The sequence of the present invention

[0066] Baligenase amino acid sequence (SEQ ID NO: 1)

[0067] MAFILLFALSTFLTGVQATSVPDKKSPELEKAEIYGDIDVTSDKQTTVIVELKEKSLAEAKADGEKQTKASLKTARSKAKSKALKTLKKAKVNREYDRVFSGFSMKLPASEIPKLLAVKEVKAVYPNATYKPDSVKGKDVTLAADAIYPQMDKSAPFIGADQAWKSGYTGKGIKVAVIDTGVDYTHPDLKNNFGPYKGYDFVDNDYDPQETPTGDPRGGATDHGTHVAGTIAANGQIKGVAPEATLLAYRVLGPGGSGTTENVIAGIEKAVADGAKVMNLSLGNSLNSPDYATSIALDWAMAEGVVAVTSNGNSGPENWTVGSPGTSRDAISVGASQLPYNEYSVTLPSYSSAKVMGYQEEKDLEALNGQEVELVEAGLGQADDFSGKDVKGKVAVIQRGVIPFVDKAENAKNAGAIGAVIYNNATGEIEANVMGMAVPTVKLSKEEGEKLVQQIKEGKHSVVFSFKLDKKLGETIASFSSRGPVMDTWMIKPDVSAPGVNIVSTIPTHDPKNPYGYGSKQGTSMASPHVAGTAAILKQAKPDWTPEQIKGVLMNTAEKLTDENGKPLPHNTQGAGSIRIMEALKASSIVTPGSHSYGTFLKDKGKQTKKQAFTIENLSSHRKAYQLEYSFKGTGITVSGTERVVVPANQTGKAAAKVTVNSAKTKAGTYEGTVYIREDGRKVAEIPLLLIVKEPDYPRVTSVTVEPGAKQGAYTIEAYLPGGAEELAFLVYDENLNLLGQAGVYKNQGKGYQSYQWNGKINDAASLKSGKYYMLAYASAKGKSSYVLTEDPFIVE

[0068] Baligenase nucleotide sequence (SEQ ID NO:2):

[0069]

[0070] bal-F (SEQ ID NO: 3):

[0071] atggcttttattctattatttgcgttatc

[0072] bal-Rv (SEQ ID NO: 4):

[0073] ttattcgacgataaaagggtcttccg

[0074] 308.bal-F (SEQ ID NO:5):

[0075] cactgctggcaggaggcgcaactcaagcttttgccatggcttttattctattatttgc

[0076] 308.bal-Rv (SEQ ID NO:6):

[0077] ggaaatccggtcgtctagcacagcacagttcctgttattcgacgataaaagggtcttc

[0078] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention and do not constitute a limitation on the content of the present invention. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.

Claims

1. A method for preparing cowhide collagen tripeptide, characterized in that: include: The cowhide is pretreated, water is added to the pretreated cowhide, the cowhide is enzymatically hydrolyzed with marine collagenase Baligenase for a certain period of time, the enzyme is inactivated by heating, impurities are removed, filtered and dried to obtain peptide powder rich in cowhide collagen tripeptide, wherein the amino acid sequence of the marine collagenase Baligenase is shown in SEQ ID NO: 1; The process parameters of the enzymatic hydrolysis of the marine collagenase Baligenase are as follows: pH 8.0-9.0, enzymatic hydrolysis temperature 40-60° C., the amount of the marine collagenase Baligenase used per gram of cowhide is 4000 U / g, and the enzymatic hydrolysis time is 3 hours.

2. A method for preparing cowhide collagen tripeptide according to claim 1, characterized in that: The pretreatment includes cleaning and degreasing.

3. A method for preparing cowhide collagen tripeptide according to claim 1, characterized in that: The enzyme inactivation parameters are: heating to 85° C. and maintaining for 30 min to inactivate the enzyme.

4. A method for preparing cowhide collagen tripeptide according to claim 1, characterized in that: The impurity removal is to add activated carbon for decolorization and deodorization, and the drying is spray drying.

Images