A Zmhppd1 gene for detecting gamma-tocotrienol content in sweet corn kernels and its application

Abstract

This invention discloses a Zmhppd1 gene for detecting gamma-tocotrienol content in sweet corn kernels and its application. The locus is the InDel site at position 86086906 on chromosome 5 of the sweet corn genome, with a polymorphism of - / TAGAACAAGG. This locus is positively correlated with the expression of the 4-hydroxyphenylpyruvate dioxygenase gene, thus affecting gamma-tocotrienol content. This invention utilizes a molecular marker developed based on the 4-hydroxyphenylpyruvate dioxygenase gene (Zmhppd1) locus, employing agarose gel electrophoresis technology. Genotyping can be rapidly performed, offering advantages such as low cost, ease of operation, and suitability for high-throughput detection. This locus will greatly promote biofortification breeding of sweet corn with high gamma-tocotrienol content. This invention, based on the 4-hydroxyphenylpyruvate dioxygenase gene locus, allows for rapid genotyping, offering advantages such as low cost, ease of operation, suitability for high-throughput detection, and promotion of biofortification breeding of sweet corn with high gamma-tocotrienol content.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a Zmhppd1 gene for detecting the gamma-tocotrienol content of sweet corn kernels and an application thereof. Background Art

[0002] Sweet corn is a fruit and vegetable crop and an important dietary source of micronutrients. The structures of all vitamin E compounds differ only in the position and number of methyl substituents on the 2,3-dihydrobenzofuran ring, but their biological activities vary greatly. Vitamin E includes eight fat-soluble isomers (including tocopherol and tocotrienol), of which gamma-tocotrienol has the highest content among the eight vitamin E components, accounting for about 38% of the total vitamin E content, which is three times the content of gamma-tocotrienol. Studies have shown that although tocopherol and tocotrienol are similar in structure, there are huge differences in their biological functions. Compared with tocopherol, tocotrienol has stronger antioxidant and lipid oxidation inhibition. At the same time, it has physiological functions such as lowering cholesterol and anti-tumor. For sweet corn seeds, these physiological functions of gamma-tocotrienol can not only ensure the normal development of sweet corn seeds, but also increase the nutrition and added value of sweet corn. It is of great significance to increase the content of gamma-tocotrienol in sweet corn kernel tissue through genetic breeding.

[0003] Methods based on genomics and population genetics provide important opportunities for analyzing the genetic basis of vitamin E synthesis. The rich genetic variation of sweet corn populations provides favorable conditions for the use of key genes. It creates conditions for the targeted manipulation of the levels and types of tocopherols and tocotrienols in crops. In previous studies, linkage and association analyses of tocopherol and tocotrienol content in corn kernels provided a lot of important information for the genetic regulation of vitamin E synthesis and metabolism. However, most of the major quantitative trait genetic loci affecting tocopherol composition usually point to VTE4, that is, VTE4 is the key locus for vitamin E synthesis in corn, and there are fewer studies on other loci. However, except for VTE4, other genes / locus for screening high tocopherol and high tocotrienol content are rarely reported. Therefore, a Zmhppd1 gene for measuring the gamma-tocotrienol content of sweet corn kernels and its application are needed. Summary of the invention

[0004] The purpose of the present invention is to provide a Zmhppd1 gene for detecting the gamma-tocotrienol content of sweet corn kernels and an application thereof.

[0005] The present invention is achieved through the following technical solutions:

[0006] The invention discloses an application of the Zmhppd1 gene locus on chromosome 5 of the sweet corn genome, wherein the sweet corn genome is genome B73, v4 version, and the ID is Zm00001d015356. The locus is an InDel locus at position 86086906 of chromosome 5 of the sweet corn genome, and the polymorphism is - / TAGAACAAGG. The locus is positively correlated with the expression of the Zmhppd1 gene and thus affects the content of gamma-tocotrienol.

[0007] Further, when the expression of Zmhppd1 gene in the sweet corn kernels containing the site is increased, the gamma-tocotrienol content of the sweet corn is identified to be increased; when the expression of Zmhppd1 gene in the sweet corn kernels is decreased, the gamma-tocotrienol content of the sweet corn is identified to be decreased.

[0008] In another aspect, a variant site detection primer set, the detection site primer set includes a forward primer as shown in SEQ ID NO: 1; a forward primer as shown in SEQ ID NO: 2;

[0009] In another aspect, a kit for detecting high gamma-tocotrienol content in sweet corn comprises the variant site detection primer set.

[0010] In another aspect, a method for screening sweet corn with high gamma-tocotrienol content comprises the following steps: in the early stage of molecular marker-assisted selection breeding (MAS), based on the primer combination, the genotype of the InDel site at position 86086906 on chromosome 5 of the sweet corn genome is identified, and the sweet corn with the genotype of the variable site is selected for breeding and planting.

[0011] Compared with the prior art, the present invention adopts the above technical solution, and the biggest feature is:

[0012] Compared with the prior art, the present invention has the following effects:

[0013] 1. The present invention uses association analysis technology to newly mine and identify the InDel loci and related Zmhppd1 genes that control the gamma-tocotrienol content in sweet corn kernels, supplementing and enriching the genetic loci for molecular identification of gamma-tocotrienol content in sweet corn kernels.

[0014] 2. The molecular marker based on agarose gel electrophoresis technology developed by the present invention based on the 4-hydroxyphenylpyruvate dioxygenase gene (Zmhppd1) site can quickly complete genotype detection, has low cost, simple operation, and is suitable for high-throughput detection. This site will greatly promote the biofortification breeding of sweet corn with high gamma-tocotrienol content. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 PCA analysis of 63 SNPs in the 4-hydroxyphenylpyruvate dioxygenase gene (Zmhppd1) region of the present invention

[0016] Among them, the sweet corn population was divided into two haplotype groups, HG1 and HG2;

[0017] Figure 2 This is a comparison diagram of the difference analysis of the gene Zmhppd1 of the present invention;

[0018] Figure 3 This is a sequence variation analysis diagram of the Zmhppd1 region of the gene of the present invention;

[0019] Figure 4 This is a diagram showing the difference analysis of sweet corn materials with different alleles of InDel (- / TAGAACAAGG) of the present invention;

[0020] Figure 5 The present invention uses the InDel (- / TAGAACAAGG) marker to complete the genotype analysis diagram of the sweet corn material;

[0021] Among them, lane 1 is the marker; lanes 2, 4 and 6 are the genotype materials with the InDel marker sequence TAGAACAAGG deletion; lanes 3, 5 and 7 are the genotype materials with the InDel marker sequence TAGAACAAGG insertion; DETAILED DESCRIPTION

[0022] The technical scheme of the present invention is further described below in conjunction with embodiments and comparative examples, but they should not be construed as limiting the present invention:

[0023] Example 1 Mining and analysis of gamma-tocotrienol related gene Zmhppd1

[0024] The sweet corn association analysis population was composed of 295 sweet corn inbred line materials selected from widely representative inbred line materials collected from the main sweet corn growing areas in the world (including China, the United States, Thailand, Japan, Argentina, etc.). Leaf tissues were collected at the seedling stage, and whole genome resequencing was performed on the llumina Hiseq 2500 platform after genomic DNA extraction, library construction and other steps. The average sequencing depth was 11X, and about 9.86 million high-quality SNP data sets were identified on the entire genome. Secondly, the kernel tissues of the sweet corn materials in the population were sampled 15 days after pollination, and a transcriptome sequencing library with an insert size of 300-500bp was constructed. Transcriptome sequencing was performed using 150bp double-end paired RNA sequencing technology, and transcriptome sequencing of the whole kernel tissue was performed on the llumina Hiseq 2500 sequencing platform, generating a total of 31.27 million read bases. After bioinformatics analysis, the expression data of each gene in each material in the sweet corn population were obtained. This completes the expression results of kernel tissue in the sweet corn population.

[0025] In 2019, 295 sweet corn lines were planted at the Field Experiment Station of Guangdong Academy of Agricultural Sciences (E113°224, N23°093) with a planting pattern of about 12 plants per row. The experiment adopted a randomized block design, with 3 replicates for each inbred line. All sweet corn lines in each plot were self-pollinated, and pollination data were recorded. 20 days after pollination, an appropriate amount of grains were harvested from 3 plants in each row. Immediately after harvesting, the grains were frozen in liquid nitrogen until transferred to a -80°C refrigerator for storage.

[0026] 20 days after pollination, the gamma-tocotrienol in fresh kernel tissue of sweet corn was precisely quantified, and the content of gamma-tocotrienol was determined by normal phase HPLC (NP-HPLC), the liquid phase infusion pump model was Waters515, the fluorescence detector model was Waters 2475, the chromatographic column model was Agilent ZORBAX RX-SIL, 250mm×4.6mm, the liquid phase contained 0.85% n-hexane, and the flow rate was 1 ml / min. Dual wavelength inspection was used, and the detection wavelengths were 290 and 330nm.

[0027] The genome-wide association analysis used ultra-high density molecular markers (SNPs, 9.86 million) for association analysis, and the mixed linear model was used for association analysis of gamma-tocotrienol content to identify the genetic loci controlling gamma-tocotrienol. The mixed linear model (MLM, controlling for population structure and kinship) was used to perform genome-wide single nucleotide polymorphism (SNPs) association analysis on the gamma-tocotrienol phenotypic traits. The number of effective SNPs in the whole genome was estimated using the GEC (Genetic Type Ierror calculator) software with default parameters. P-value = 1 / n was used as the significance threshold of the genome-wide association analysis (n, the number of effective SNPs in the whole genome).

[0028] Based on the analysis of the results of the whole genome association analysis of gamma-tocotrienol content, the present invention uses gene-based association analysis to identify that the 4-hydroxyphenylpyruvate dioxygenase gene Zmhppd1 (gene ID: Zm00001d015356, Chr5: 86084655..86086755; reference genome version: B73 V4) is significantly associated with gamma-tocotrienol content. Through haplotype and gene Zmhppd1 sequence analysis, an InDel site (S5_86086906) was identified to be significantly associated with gamma-tocotrienol content. It can be used for the development of molecular screening markers for high gamma-tocotrienol content. The distribution frequency of high gamma-tocotrienol content haplotypes in sweet corn populations is about 20%. The distribution frequency of favorable alleles is low, and it has high screening and application value. The InDel information for screening high gamma-tocotrienol content is as follows.

[0029] Table 1 Information on high gamma-tocotrienol loci associated with the 4-hydroxyphenylpyruvate dioxygenase gene (Zmhppd1)

[0030] serial number InDel chromosome Location SNP Favorable allele 1 S5_86086906 5 86,086,906 TAGAACAAGG / - -

[0031] Determination of gamma-tocotrienol content in sweet corn kernels

[0032] Vitamin E extraction: Sweet corn kernels were precooled with liquid nitrogen and then ball-milled for 60 seconds at 30 Hz using a mill (MM400; Retsch). 2 g of fresh sweet corn flour was accurately weighed in a frozen state. The sample was saponified with 2 mL of ethanol (95%). Antioxidants (1 mL of sodium chloride, 176 mg / mL; 4 mL of pyrogallol ethanol, 63.055 g / L; 1 mL of ascorbic acid, 176 mg / mL) and 2 mL of potassium hydroxide (600 g / L) were then added and mixed using a vortex mixer. The mixture was then extracted with n-hexane / ethyl acetate (9:1, v / v). The liquid phase of the organic layer was collected and concentrated to dryness using a concentrator under nitrogen. The residue was dissolved in 1% isopropanol in n-hexane for HPLC analysis.

[0033] Quantitative detection of vitamin E: The quantitative detection of vitamin E adopts normal phase high performance liquid chromatography (NP-HPLC) method. The NP-HPLC system includes a Waters 515 high performance liquid chromatography pump and a Waters 2475 multi-λ fluorescence detector. The chromatographic column is Agilent (ZORBAX RX-SIL, 250mm×4.6mm), and the flow rate is 1mL / min. The mobile phase is 0.85% n-hexane-2-propanol, and 20μL is injected. The excitation wavelengths of the detection are 290nm and 330nm. The standard curve constructed using 8 external standards was used to calculate the content of each vitamin E component. SNP map and expression level identification of sweet corn population

[0034] Leaf tissues were collected at the seedling stage, and after genomic DNA extraction and library construction, whole genome resequencing was performed on the llumina Hiseq2500 platform. The average sequencing depth was 11X, and about 9.86 million high-quality SNP maps were identified on the entire genome. Secondly, the grain tissues were sampled 15 days after pollination, and a transcriptome sequencing library with an insert size of 300-500bp was constructed. Transcriptome sequencing was performed on the llumina Hiseq 2500 sequencing platform using 150bp double-end paired RNA sequencing technology, and a total of 31.27 million read bases were generated. Thus, the expression results of genes in grain tissues of each individual in the sweet corn population were completed.

[0035] Gamma-tocotrienol genome-wide association analysis

[0036] TASSEL (3.0) was used for genome-wide association analysis, and mixed linear models were used to control population structure and kinship. In order to determine the genome-wide threshold of GWAS results, the present invention estimated the number of genome-wide effective SNPs using the GEC (Genetic Type Ierror calculator) software with default parameters. Then, the present invention selected P = 5.08 × 10-7 (P = 1 / n, n = number of effective markers) as the significance threshold for genome-wide association analysis. In order to determine the independence of significant SNPs, conditional GWAS was performed using the most significant SNP in the QTL region as a covariate.

[0037] According to the results of the association analysis of gamma-tocotrienol content, the present invention conducted a gene-based association analysis (magma_v1.10) on 131 genes related to VE synthesis and metabolic pathways, and found that a 4-hydroxyphenylpyruvate dioxygenase gene (Zmhppd1) was significantly correlated with gamma-tocotrienol content and related phenotypes (P<0.001; Table 2). Through haplotype analysis of 63 SNPs in the gene Zmhppd1 region, the present invention found that the 4-hydroxyphenylpyruvate dioxygenase gene (Zmhppd1) was mainly divided into two haplotype groups ( Figure 1 ), haplotype group 1 (HG1) had higher gamma-tocotrienol content and higher gene Zmhppd1 expression, Figure 2 a is the gamma-tocotrienol content among haplotype groups; Figure 2 b is the expression level of gene Zmhppd1. Meanwhile, the distribution frequency of this type of haplotype group in the population is low (about 20%), which indicates that the favorable allele of this gene is not fully utilized in the sweet corn breeding process. This gene has the potential to be used in the breeding process.

[0038] Table 2 Results of gene-based association analysis of gamma-tocotrienol content

[0039]

[0040] aCandidate genes are genes that are target genes in gene-based association analysis and reach a significant level.

[0041] The chromosome information of the b gene was determined by referring to the V4 sequence of the corn B73 reference genome.

[0042] c Gene-based association analysis was performed, and the starting position of the genes used.

[0043] d End positions of genes used for gene-based association analysis.

[0044] e Number of SNPs in the interval used for gene-based association analysis.

[0045] f The number of materials within the population used for gene-based association analysis.

[0046] Example 2 Sequence variation analysis and identification of functional sites of gene Zmhppd1

[0047] Using deep resequencing data of 295 materials of sweet corn population, the present invention analyzed the sequence variation in the Zmhppd1 region and its surroundings. Four SNP sites were identified in the coding region of the Zmhppd1 gene, which can cause mutations in the amino acids encoded by the gene, but these sites do not affect the expression level of the Zmhppd1 gene. In addition, a 10bp (TAGAACAAGG / -) insertion / deletion (InDel) mutation (TAGAACAAGG / -) at 152bp upstream of the gene was found. Figure 3 ). The InDel is a sequence variation type unique to haplotype group 1 (HG1), which can distinguish this haplotype group from other materials. The InDel is significantly correlated with the expression level of the gene Zmhppd1, and the insertion and deletion variation is significantly correlated with the difference in gamma-tocotrienol content, that is, the material containing the 10bp sequence TAGAACAAGG has a lower gene expression level and gamma-tocotrienol content, such as Figure 4 As shown, in Figure 4 aExpressed as gamma-tocotrienol content; Figure 4 b is expressed as the expression level of gene mhppd1; the material without this sequence has significantly higher expression level of gene Zmhppd1 and gamma-tocotrienol content. Based on this, this InDel site can be used to screen materials with high gamma-tocotrienol content.

[0048] Example 3 Development of InDel Molecular Markers Related to Gamma-Tocotrienol Content

[0049] Association analysis and transcriptome analysis verified the function of gene Zmhppd1 in the gamma-tocotrienol content of sweet corn kernel tissue. Aiming at the InDel site (TAGAACAAGG / -) 152bp upstream of gene Zmhppd1, the present invention developed a molecular marker based on PCR amplification and agarose gel electrophoresis detection for the screening of sweet corn materials with high gamma-tocotrienol content. This embodiment completed the design and verification of primers for the above-mentioned InDel site (TAGAACAAGG / -). The design of this InDel primer was completed by PRIMER-BLAST, a web primer design tool provided by NCBI.

[0050] For the above gamma-tocotrienol content-related InDel site (TAGAACAAGG / -), a molecular marker based on PCR and agarose gel electrophoresis was developed for screening of favorable allele genetic sites with high gamma-tocotrienol content. The design of primers for this InDel site was completed using the NCBI-BLAST program.

[0051] InDel marker genotype detection method: as shown in sequence NO.1 and NO.2, amplified by conventional PCR amplification system, when the DNA template sequence contains the insertion sequence TAGAACAAGG, the length of the amplified product is 154bp, when the amplified template DNA sequence does not contain the insertion sequence TAGAACAAGG, the length of the DNA sequence product amplified by the primer is 144bp, due to the different speeds of electrophoresis of DNA sequences of different lengths in agarose gel, that is, the shorter the DNA length, the faster the electrophoresis speed. The determination of the genotype of this InDel site in the sweet corn material is completed by the speed of movement of the amplified DNA product during electrophoresis. Thereby completing the determination using the allele type, and then performing genotype screening on the level of gamma-tocotrienol content.

[0052] Primer information is as follows:

[0053] InDel primer sequence F: CGGTTGCGGATGTGATTTGTC (SEQ ID NO: 1)

[0054] InDel primer sequence R: GCAATTCATAGCTAAACTTTGTGC (SEQ ID NO: 2)

[0055] The PCR amplification reaction system is shown in Table 3 (96-well ordinary PCR plate, 15 μl reaction system). The PCR amplification reaction program is shown in Table 4.

[0056] Table 3 PCR reaction system

[0057] Element volume DNA 2μL (20ng / μL) 2×Tag mix 7.5μL Primer(F+R) 2μL <![CDATA[ddH2O]]> 3.5μL Total 15μL

[0058] Table 4 PCR amplification reaction program

[0059]

[0060] After PCR amplification, 2.5% agarose gel electrophoresis was performed at a voltage of 160 V for 45 minutes, and the nucleic acid coloring dye used was GoldView. Figure 5As shown in the figure, the length of the PCR amplification product is different for different alleles at this InDel. The product containing the sequence TAGAACAAGG moves slower than the deletion type in electrophoresis. The sweet corn population verified that the genotyping results of this InDel marker were completely consistent with the high-throughput sequencing results. This shows that the molecular marker has high stability and universality. The application of this marker in the improvement of sweet corn gamma-tocotrienol will play an important role in promoting the high-quality breeding of sweet corn.

[0061] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which are all covered by the protection scope of the present invention.

Claims

1. Application of the Zmhppd1 gene locus on chromosome 5 of the sweet corn genome, wherein the version of the sweet corn genome is B73 V4, characterized in that: The site is the InDel site at position 86086906 of chromosome 5 of the sweet corn genome, and the polymorphism is - / TAGAACAAGG; the InDel site is positively correlated with the expression of the Zmhppd1 gene and thus affects the gamma-tocotrienol content. If the InDel site is "-", the expression of the Zmhppd1 gene in the sweet corn kernels containing the InDel site is increased, and it is identified as the gamma-tocotrienol content of the sweet corn is increased; if the InDel site is "TAGAACAAGG", the expression of the Zmhppd1 gene in the sweet corn kernels is reduced, and it is identified as the gamma-tocotrienol content of the sweet corn is reduced.

2. A primer set for detecting the InDel site as claimed in claim 1, characterized in that: The primer set includes a forward primer as shown in SEQ ID NO: 1 and a reverse primer as shown in SEQ ID NO:

2.

3. A kit for detecting high gamma-tocotrienol content in sweet corn, characterized in that: Comprising the primer set described in claim 2.

4. A method for screening sweet corn with high gamma-tocotrienol content, characterized in that: The following steps are involved: In the early stage of molecular marker-assisted selection breeding (MAS), based on the primer set described in claim 2, the genotype of the InDel site located at position 86086906 of chromosome 5 of the sweet corn genome is identified, and the polymorphism is - / TAGAACAAGG; if the InDel site is "-", the expression of the Zmhppd1 gene in the sweet corn kernels containing the InDel site is increased, and it is identified that the gamma-tocotrienol content of the sweet corn is increased, thereby promoting the biofortification breeding of sweet corn with high gamma-tocotrienol content; if the InDel site is "TAGAACAAGG", the expression of the Zmhppd1 gene in the sweet corn kernels is reduced, and it is identified that the gamma-tocotrienol content of the sweet corn is reduced.

Images