Specific marker, primer, detection method, kit and application of insertion variation in the intron region of ripk3 gene of rockfish

Abstract

The present invention belongs to the field of molecular biology technology, and further relates to a specific marker, primer, detection method, kit and application of insertion variation in the intron region of the ripk3 gene of striped rock sea bream. The specific marker of insertion variation in the intron region of the ripk3 gene of striped rock sea bream is a DNA fragment with non-insertion and insertion specific markers in the intron region of the ripk3 gene of striped rock sea bream, and the nucleotide sequence of the DNA fragment is shown in SEQ ID NO:1 and SEQ ID NO:2. The present invention obtains homologous segments of the ripk3 gene of Y and X chromosomes and marks them with large fragment DNA insertion sequences by screening the whole genome sequence of striped rock sea bream, and then establishes a method for rapid detection of intron insertion in the ripk3 gene of striped rock sea bream. This method has important application value in the identification of male and female sexes of striped rock sea bream, the preparation of male and female seedlings, and the study of functional heterogeneity of apoptosis of male and female cells.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and further relates to a specific marker, primer, detection method, kit and application of insertion variation in the intron region of the ripk3 gene of striped rock porgy. Background Art

[0002] Striped rock snapper Oplegnathus fasciatus ) belongs to the order Perciformes, family Oplegnathidae and genus Oplegnathus. Oplegnathus ), mainly distributed in the warm and tropical waters of the western Pacific Ocean, especially in rocky and coral reef environments. In 2004, China made a breakthrough in the reproductive regulation and artificial breeding technology of striped rock bream, making it an important species for marine cage and factory farming, marking a significant progress in the aquaculture technology of this fish. At present, the market price of striped rock bream has risen to 200 yuan per catty, reflecting its significant economic value and aquaculture potential. As a natural species native to my country, the resource development and sustainable utilization of striped rock bream have far-reaching significance, and its aquaculture prospects are broad. Striped rock bream has a typical X1X1X2X2 / X1X2Y sex determination system, in which male fish have one less chromosome than female fish, but have an anomalous Y chromosome, and the male sex type is X1X2Y. During the aquaculture process, the growth rate of male fish is usually faster than that of female fish. This characteristic provides a useful direction for genetic breeding research. Therefore, the development of the preparation technology of Kaohsiung seedlings and all-male seedlings will provide strong support for the quality improvement and efficiency enhancement of the striped sea bream breeding industry. In addition, the development of rapid genetic sex identification technology for striped sea bream seedlings will not only help to efficiently reserve high-quality male germplasm, but also improve the scientificity and pertinence of breeding decisions, thereby promoting the sustainable development and market competitiveness of the striped sea bream industry.

[0003] Receptor-Interacting Protein Kinase 3 (Ripk3) plays a crucial role in regulating programmed cell death pathways, especially necrosis. This form of cell death is characterized by cell swelling and rupture, leading to an inflammatory response. Unlike apoptosis, which is a more controlled non-inflammatory process, necrosis is a defense mechanism against viral infection and cellular stress. The Ripk3 protein is a serine / threonine kinase that interacts with various signaling molecules to propagate this form of cell death when apoptosis is inhibited or unable to proceed. In response to tumor necrosis factor (TNF) signaling, RIPK3 is activated by interacting with receptor-interacting protein kinase 1 (Ripk1). Upon activation, Ripk3 forms a complex with mixed lineage kinase domain-like pseudokinase (MLKL) called the necrosome. This complex then initiates downstream signaling cascades that lead to cell membrane disruption and ultimately cell lysis. Dysregulation of Ripk3 has been associated with a variety of pathologies, including neurodegenerative diseases, inflammatory diseases, and cancer. Understanding the exact mechanism by which Ripk3 promotes these processes will help to gain insight into potential therapeutic targets for intervention. So far, there have been no reports on the detection of intron insertions in the ripk3 gene on male chromosomes of rockfish and its application in the identification of female and male genetic sex. Summary of the invention

[0004] The purpose of the present invention is to overcome the shortcomings of the existing detection technology of DNA insertion variation in the intron region of the ripk3 gene of striped rock sea bream, and to provide a specific marker, primer, detection method, kit and application in the identification of male and female genetic sex for insertion variation in the intron region of the striped rock sea bream gene.

[0005] To achieve the above purpose, the present invention adopts the following technical solution:

[0006] A specific marker for insertion variation in the intron region of the ripk3 gene of striped rock sea bream. The specific marker for insertion variation in the intron region of the ripk3 gene of striped rock sea bream is a DNA fragment of non-insertion and insertion specific markers in the intron region of the ripk3 gene of striped rock sea bream. The nucleotide sequences of the DNA fragments are shown in SEQ ID NO:1 and SEQ ID NO:2.

[0007] The bases shown in the nucleotide sequence SEQ ID NO:1 of the non-insertion and insertion specific marker of the DNA fragment in the intron region of the striped rock sea bream ripk3 gene are homologous fragments shared by the X1 chromosomes of female and male striped rock sea bream in the intron region of the ripk3 gene without DNA insertion variation, which is a DNA characteristic marker shared by non-insertion and insertion individuals of the intron region of the ripk3 gene of the striped rock sea bream; and, the sequence fragment (347bp) inserted between the 66th and 67th positions of the base sequence shown in SEQ ID NO:1 is the homologous fragment of the insertion DNA variation, such as the base sequence shown in SEQ ID NO:2.

[0008] An application of a specific marker for insertion variation in the intron region of the ripk3 gene of the striped rock sea bream, and an application of the specific marker in identifying the genetic sex of male and female striped rock sea bream.

[0009] A method for identifying the genetic sex of male and female rock bream using the specific marker of insertion mutation in the intron region of the ripk3 gene of the rock bream:

[0010] 1) PCR amplification: Take the striped porgy to be tested and extract genomic DNA; use the obtained genomic DNA as a template and specific primers for the intron region of the striped porgy ripk3 gene to perform PCR amplification, and compare the obtained PCR amplification product with the specific marker;

[0011] 2) Result judgment: two DNA fragments of 125 bp and 472 bp are amplified from the genomic DNA of the tested striped rock bream, which means that the tested striped rock bream is judged to be an individual with a DNA fragment insertion mutation in the intron region of the ripk3 gene; 125 bp is the base shown in SEQ ID NO: 1, and 472 bp is the base shown in SEQ ID NO: 2;

[0012] 3) Only a single DNA fragment of 125 bp is amplified from the genomic DNA of the tested striped rock seabream, which means that the tested striped rock seabream is an individual with no DNA fragment insertion mutation in the intron region of the striped rock seabream ripk3 gene; 125 bp is the base shown in SEQ ID NO: 1.

[0013] The specific primers in step 1) are:

[0014] Ch ripk3 _F:1:5'-TTAAACCCTAGATTTAAACCTAG-3';

[0015] Ch ripk3 _R:2: 5'- AGTGTATTGATGATATGCTGTGT-3';

[0016] In the step 2), it is determined that the striped bream to be tested is an individual with a DNA fragment insertion mutation in the intron region of the ripk3 gene, and the striped bream individual to be tested is a male fish X1X2Y;

[0017] In the step 3), it is determined that the striped rock seabream to be tested is an individual with no DNA fragment insertion mutation in the intron region of the striped rock seabream ripk3 gene, and the striped rock seabream individual to be tested is a female X1X1X2X2.

[0018] A primer for detecting specific markers of insertion mutations in the intron region of the ripk3 gene of the striped rock porgy:

[0019] Ch ripk3 _F:1:5'-TTAAACCCTAGATTTAAACCTAG-3';

[0020] Ch ripk3 _R:2:5'-AGTGTATTGATGATATGCTGTGT-3'.

[0021] An application of primers for detecting insertion variation of intron region of ripk3 gene of striped rock bream, and application of the primers in detecting genetic sex of male and female striped rock bream.

[0022] A kit for identifying the genetic sex of male and female rock porgy, the kit containing the primers.

[0023] The advantages of the present invention are:

[0024] The present invention compares the ripk3 gene on the fusion chromosome Y of the male striped rock sea bream with the ripk3 gene intron located on the homologous chromosome X of the female fish to produce a large sequence insertion, thereby efficiently, quickly and accurately identifying whether the DNA insertion variation occurs in the intron of the ripk3 gene of the striped rock sea bream. This has important significance and application value for revealing the functional heterogeneity of female and male cell apoptosis and inflammatory response of striped rock sea bream, realizing the rapid identification of female and male genetic sex, and improving the genetic breeding process of striped rock sea bream and the large-scale production of high-quality seedlings.

[0025] The present invention screens and obtains homologous segments of ripk3 gene introns of X and Y chromosomes of striped rockfish and has large DNA insertion marker sequences from the whole genome sequence of striped rockfish, and further establishes a rapid detection method for DNA insertion variation of ripk3 gene introns of striped rockfish, which can be used to quickly, accurately and efficiently identify whether DNA insertion occurs in the ripk3 gene intron of the striped rockfish to be detected. The method uses a pair of primers to amplify two bands of 125bp and 472bp with a difference of 347bp in the ripk3 gene intron DNA insertion individuals, and only amplifies a single band of 472bp in the ripk3 gene intron DNA insertion individuals, and can be distinguished by agarose gel electrophoresis, shortening the time for accurate identification of ripk3 gene intron variation of striped rockfish, and improving detection efficiency. It has important significance and application value in the study of apoptosis of female and male cells based on ripk3 gene, identification of male and female sex, preparation of high male seedlings and family selection of striped rockfish. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 A nucleotide sequence comparison diagram of the ripk3 gene of the X chromosome and the ripk3 gene of the Y chromosome provided in the embodiment of the present invention; the modules connected by connecting lines in the figure represent highly homologous regions of the ripk3 gene on chromosomes X and Y, wherein the marked region is the target sequence ChrX1 of the present invention ripk3 and ChrY ripk3 The location.

[0027] Figure 2 ChrX1 provided in the embodiment of the present invention ripk3 and ChrY ripk3 Specific location information on chromosomes X and Y; 125bp represents ChrX1 ripk3 The length of the fragment, 472 bp represents ChrY ripk3 Length; ChrY ripk3 The middle lower region represents the inserted 347 bp nucleotide sequence, which is closely related to ChrX1 ripk3 The fragment has no homologous matching sequence.

[0028] Figure 3 The obtained X chromosome ChrX1 provided in the embodiment of the present invention ripk3 ChrY ripk3 Nucleotide sequence alignment, the positions of the primers at both ends are indicated by black thick underlines; *: represents ChrX1 ripk3 and ChrY ripk3 Sequence consistency, the blank area indicates the base sequences are inconsistent between the two; _ _ _ _: represents the inserted sequence; the black underline represents the area where the inserted sequence is located.

[0029] Figure 4 The X chromosome ChrX1 provided in the embodiment of the present invention ripk3 ChrY ripk3 Schematic diagram of nucleotide sequence homologous insertion difference DNA fragments; the black area represents the homologous region, the gray area represents the insertion region and site information, and the blank area represents the deletion region and site information.

[0030] Figure 5 The figure shows the results of 1.5% agarose gel electrophoresis of PCR products of male and female individuals of striped sea bream provided in an embodiment of the present invention, M: DL 2000 DNA Maker; ♂: physiological male fish; ♀: physiological female fish; the individual showing two bands (125bp and 472bp) in the figure is an individual with DNA insertion in the intron of the ripk3 gene, which is also a genetic male fish, and the physiological sex histological identification is male fish, and the individual showing a single band (125bp) is an individual with no DNA insertion in the intron of the ripk3 gene, which is also a genetic female, and the physiological sex histological identification is female. DETAILED DESCRIPTION

[0031] The specific implementation modes of the present invention are further described below in conjunction with examples. It should be noted that the specific implementation modes described here are only for illustrating and explaining the present invention, and are not limited to the present invention.

[0032] The present invention firstly completed the whole genome sequencing and assembly of female and male striped rock sea bream by using the third-generation PacBio whole genome sequencing technology, and obtained high-quality genomes at the chromosome level of female and male striped rock sea bream (SRP160016, SRP220007, Xiao et al., 2019, 2020). By comparative genomic bioinformatics analysis methods, it was found that compared with the intron region of the ripk3 gene on the X1 chromosome of female fish, a large DNA sequence insertion mutation occurred in the intron region of the homologous ripk3 gene on the Y chromosome of male striped rock sea bream ( Figure 1 The intron region of the ripk3 gene on the X1 chromosome of female fish (19,016,663 bp to 19,016,787 bp) and the homologous region of the Y chromosome of male fish (18,132,650 bp to 18,133,121 bp) with DNA sequence insertion were selected as the research target regions ( Figure 1 The DNA fragment on chromosome X1 is 125 bp long and is named ChrX1. ripk3 , whose sequence is X ripk3 IDNo:1; The DNA fragment on chromosome Y is 472 bp long and contains a sequence homologous to the intron region of the ripk3 gene on chromosome X1, named ChrY ripk3 , whose sequence is Y ripk3 ID No:1;ChrY ripk3ChrX1 ripk3 Homologous sequence alignment revealed that ripk3r The corresponding DNA fragment of 347 bp between sites 66 and 67 ( Figure 2 and Figure 3 ), a 347bp DNA sequence was inserted into the intron region of the ripk3 gene on the Y chromosome of the male fish at 18,132,650bp~18,133,121bp, which is a DNA marker for detecting whether a DNA fragment insertion mutation occurs in the intron region of the ripk3 gene of the striped rock bream; at the same time, because the marker is located on the Y chromosome of the male fish and has male-associated genetic characteristics, this fragment is also a DNA marker unique to the Y chromosome of the male striped rock bream, and ChrY ripk3 It is a DNA characteristic marker shared by male and female striped sea bream.

[0033] The invention is based on the characteristic marker of long DNA insertion sequence found at the position of 18,132,650bp-18,133,121bp in the intron region of the ripk3 gene of the Y chromosome of male striped rock bream to determine whether a DNA fragment insertion mutation occurs in the intron region of the ripk3 gene of striped rock bream, and invents a rapid detection method for DNA insertion mutation in the intron region of the ripk3 gene of striped rock bream, and applies the method to the rapid identification of the genetic sex of female and male striped rock bream; the specific detection method is to determine whether the striped rock bream to be detected has Y ripk3 The nucleotide fragment (472 bp) of ID No: 1 was quickly identified by PCR primers; the present invention was based on comparative analysis of the intron region sequence of the ripk3 gene on the Y chromosome of the striped rockfish and the homologous gene sequences on the X1 and X2 chromosomes, and the X1 and X2 chromosomes of the ripk3 gene were identified. ripk3 ID No:1 Nucleotide sequence homologous to Y chromosome ripk3 IDNo: 1 nucleotide sequence, using the feature that a large fragment is inserted in the Y chromosome of striped bream in the homologous region of the ripk3 gene intron region, two primers were designed. The method of detecting PCR products by 1.5% agarose gel electrophoresis was used to quickly determine whether a DNA fragment insertion mutation occurred in the intron region of the striped bream ripk3 gene; at the same time, the marker was located on the Y chromosome of male fish and had male-associated genetic characteristics, which was used for the accurate identification of the genetic sex of striped bream. The upstream and downstream primer sequences were:

[0034] Ch ripk3 _F:1 : 5'-TTAAACCCTAGATTTAAACCTAG -3' (X ripk3 ID No:2)(SEQ ID NO:3)

[0035] Ch ripk3 _R:2 : 5'- AGTGTATTGATGATATGCTGTGT -3' (X ripk3 ID No:3) (SEQ ID NO:4).

[0036] The steps of using the above primers to identify the insertion variation of the DNA fragment in the intron region of the ripk3 gene of the striped rock sea bream mainly include: extracting high-quality whole genome DNA of the striped rock sea bream, amplifying the specific marker DNA fragment of the DNA insertion variation in the intron region of the ripk3 gene of the Y chromosome, and detecting the PCR product DNA by agarose gel electrophoresis; wherein two DNA fragments of 472bp and 125bp were amplified in the Y chromosome and X1 chromosome of the male striped rock sea bream (X1X2Y), respectively, and the 472bp fragment was a specific marker fragment in the intron region of the ripk3 gene where the DNA insertion variation occurred; while only a single DNA fragment of 125bp was amplified in the female striped rock sea bream (X1X1X2X2).

[0037] The present invention is based on the whole genome sequencing of male and female striped rock seabream, the positioning of the intron region of the ripk3 gene of female and male individuals, and the comparison and analysis of DNA sequences. It can be seen that a long DNA fragment insertion mutation occurs in the intron region of the ripk3 gene on the Y chromosome of male striped rock seabream. Then, the long DNA fragment is used as a DNA marker specific to the base insertion mutation in the intron region of the ripk3 gene on the Y chromosome of the striped rock seabream, and the male and female striped rock seabream are quickly identified by using the DNA sequence insertion mutation in the intron region of the ripk3 gene of the striped rock seabream. The method can quickly, accurately and efficiently distinguish whether the tested striped rock seabream has a sequence insertion mutation in the intron region of the ripk3 gene. This method will amplify two bands of 472bp and 125bp in individuals with DNA insertion in the intron region of the ripk3 gene, of which the 472bp band is a specific target band, while only a single band (125bp) is amplified in individuals with no DNA insertion in the intron region of the ripk3 gene. The above target band can be quickly and accurately distinguished by agarose gel electrophoresis, so as to achieve rapid identification of whether DNA sequence insertion occurs in the intron region of the ripk3 gene of the striped bream. At the same time, since the specific target band (472bp) is located on the Y chromosome of male fish and has male-associated genetic characteristics, this fragment is also a DNA marker unique to the Y chromosome of male striped bream, which can be used for rapid identification of the genetic sex of female and male striped bream.

[0038] Example 1 Screening and verification of DNA markers specific to sequence variation in the intron region of the ripk3 gene of rock bream

[0039] Discovery of homologous segments in the intron region of the ripk3 gene on the Y and X chromosomes of striped bream and containing large fragments of inserted target DNA sequences: The DNA sequences of the male fish heterochromosome (neo-Y) and the female fish X1 chromosome DNA sequences used were from the research team of Li Jun in the Marine Fish Aquaculture and Breeding Technology Laboratory of the Institute of Oceanology, Chinese Academy of Sciences. The team commissioned Wuhan Fraser Gene Information Co., Ltd. to use the third-generation PacBio whole genome sequencing technology to complete the sequencing and assembly of the male and female whole genomes of striped bream. The assembly results have been published (SRP160016, SRP220007, Xiao et al., 2019, 2020). The genome sequences of male and female striped bream were analyzed using comparative genomic bioinformatics (see Figure 1 ), the intron region of the ripk3 gene on the Y chromosome of the male striped rock bream was homologous to the intron region of the ripk3 gene on the X1 chromosome of the female striped rock bream, and there was a large DNA insertion fragment, among which the target DNA fragment in the intron region of the ripk3 gene on the X1 chromosome was 125bp in length and was named ChrX1 ripk3 , whose sequence is SEQ ID NO:1:

[0040] TTAAACCCTAGATTTAAACCCTAGATTTACGGATTTGTAAACCGAGACTACAGATTTACACATGGCCCGTTTGCTTCAGGTAATATTAACACTTCAAATTTTACACAGCATATCATCAATACACT.

[0041] The target DNA fragment homologous to the intron region of the ripk3 gene on the male fish heteromorphic chromosome Y is 472 bp long, which contains a sequence homologous to X1 and is named ChrY ripk3 , whose sequence is SEQ ID NO:2:

[0042] TTAAACCCTAGATTTAAACCCTAGATTTACGGATTTGTAAACCAAGACTACAGATTTACACATGGCTCTTTTTTCTTCTCAGCTGACCCCAGGGGGGCTCCATAGAGGGGTGTACTACAGAGTGAGATTAATGGGTTAGCGAGGTATGTTGAGCCTAAAGCCAGAGTTTTCAATGTCAGAAAGGTGGCTCTCTTTAACCTGGCTCATCATGGTAATTTATGCTACACACCCAACC TGTTATGGAGGGAGTTATGTTCAGAGTTTCGGATTTAAAACGGCTATTATGGAGCCCCTAAAGTTATTAGCCTATTTTATCTCCCCTAACATACATATCTTGTGCGCACAAGATATTTATGTTATGGGCCTTTAGGGGCTCCATAGGCTATAGAAAGGACATCCTCTCATTTTTCCCCCGTTTGCTTCAGGTAATATTAACACTTTAAATTTTACAGCATATCATCAATACACT.

[0043] The whole genome scanning of male and female individuals and the location of the intron region of the ripk3 gene in female and male individuals and DNA sequence comparison analysis showed that the intron region of the ripk3 gene in chromosome X1, ChrX1 ripk3 Homologous ChrY ripk3 (Y chromosome) has a DNA sequence insertion, corresponding to ChrX1 ripk3 Positions 66 and 67 (insertion 347 bp) ( Figure 2 and Figure 3 ). The target region is the intronic region of the ripk3 gene on chromosome Y (ChrY ripk3 ) DNA sequence is homologous to the X1 chromosome DNA region (ChrX1 ripk3 ) inserted a 347bp DNA sequence, which is a DNA marker specific to the base insertion mutation in the intron region of the ripk3 gene of the striped rock bream. Its presence or absence can be used to identify whether a DNA sequence insertion mutation has occurred in the intron region of the ripk3 gene of the striped rock bream. At the same time, since this marker is located on the Y chromosome of male fish and has male-associated genetic characteristics, ChrY ripk3 This fragment is also a DNA marker unique to the Y chromosome of male striped sea bream, and ChrX1 ripk3 It is the common DNA characteristic marker of the genetic sex of male and female striped bream, such as Figure 1 and Figure 2 shown.

[0044] Sequence verification of DNA markers specific to sequence variation in the intron region of the ripk3 gene: Based on the nucleotide sequence of SEQ ID NO:2 in the intron region of the ripk3 gene on the Y chromosome and the nucleotide sequence characteristics of the homologous gene SEQ ID NO:1 on the X1 chromosome, two primers were designed ( Figure 3 ). Female and male striped porgy with known physiological sex were selected and high-quality DNA was extracted from them. ripk3 _F:1,Ch ripk3 _R:2 two primers for PCR amplification, the reaction conditions and procedures are as follows: PCR reaction system 20μL: 10×Buffer 5.8μL, dNTP 4.0μL, rTaq enzyme (5U / μL) 0.2μL, upstream and downstream primers (Ch ripk3 _F:1 and Ch ripk3 _R:2) 0.4µL each, DNA template 2.0µL, ddH2O 7.2µL. Touch down PCR amplification program: 94℃ 3mins, 55℃ (-1℃, 3 cycles) 1min, 72℃ 1min30s, 3 cycles; 94℃ 30s, 53℃ 1min, 72℃ 1min30s, 30 cycles; 72℃ 10min, stored at 15℃. 1.5% agarose gel electrophoresis of PCR products can distinguish the differences between the DNA fragments inserted and non-inserted into the intron region of the ripk3 gene. The difference fragment products of the inserted and non-inserted DNA sequences in the intron region of the ripk3 gene were cut and recovered and transformed into competent cells through the PMD18-T vector. The positive clones were picked and sent to Qingdao Paisonno Gene Biotechnology Co., Ltd. for sequencing. The sequencing results verified that the intron region of the homologous ripk3 gene on chromosomes X and Y of striped rockfish contained large fragments inserted into the target DNA sequence fragment, such as Figure 3 and Figure 4 shown.

[0045] Example 2 Establishment and application of DNA fragment insertion mutation identification technology in the intron region of the ripk3 gene of rock bream

[0046] Genetic identification was conducted on the striped sea bream (of which 12 were female and 12 were male) farmed by Haihe Aquatic Breeding Co., Ltd. in Wendeng District, Weihai City, Shandong Province.

[0047] High-quality DNA extraction: The fin ray DNA of rockfish was extracted using the Tiangen Marine Animal DNA Extraction Kit. The integrity of the genomic DNA was identified by 1.0% agarose gel electrophoresis. The OD value of the DNA supernatant was measured by a UV spectrophotometer. The DNA concentration was adjusted to 60 ng / µL and stored at -20°C for later use.

[0048] PCR reaction system and PCR amplification identification: using DNA fragment primers Ch specific for large fragment sequence variation in the intron region of the ripk3 gene of striped bream ripk3 _F:1 and Ch ripk3 _R:2 Detect whether the DNA fragment in the intron region of the ripk3 gene of the striped rock bream has inserted or not by PCR. The PCR reaction system is 20µL: 10×Buffer 5.8µL, dNTP 4.0µL, rTaq enzyme (5U / µL) 0.2µL, upstream and downstream primers (Ch ripk3 _F:1 and Ch ripk3 _R:2) 0.4µL each, DNA template 2.0µL, ddH2O 7.2µL. Touchdown PCR amplification program: 94℃ 3mins, 55℃ (-1℃, 3 cycles) 1min, 72℃ 1min30s, 3 cycles; 94℃30s, 53℃ 1min, 72℃ 1min30s, 30 cycles; 72℃ 10min, 15℃ storage. Add 10× Loading Buffer 2.0µL to each PCR sample to be tested, use 1.5% agarose gel electrophoresis at a constant voltage of 110V for 30 minutes, gel imaging can clearly distinguish between DNA insertion and non-insertion mutation individuals in the intron region of the ripk3 gene of striped rock bream (see Figure 5 ).

[0049] Depend on Figure 5 It can be seen that two target bands (472 bp and 125 bp) were amplified in the individuals of striped porgy with DNA insertion in the intron region of the ripk3 gene, of which the 472 bp band was the specific target band ChrY ripk3 However, in individuals without DNA fragment insertion into the intron region of the ripk3 gene, only a single band of ChrX1 could be amplified. ripk3 (125 bp). ripk3 The marker is located on the Y chromosome of male fish and has male-linked genetic characteristics. Therefore, ChrY ripk3 This fragment is also a DNA marker unique to the Y chromosome of male striped sea bream, and ChrX1 ripk3 It is a DNA characteristic marker shared by male and female genetic sexes of striped rock seabream, and the selected striped rock seabream can be distinguished. The method of the present invention can not only quickly, accurately and efficiently identify whether a DNA fragment insertion mutation occurs in the intron region of the ripk3 gene of the striped rock seabream to be tested, but also has important significance and application value in the study of the functional heterogeneity of female and male cell apoptosis and inflammatory response based on the intron region of the ripk3 gene of striped rock seabream, as well as in the identification of male and female sexes, the preparation of high male seedlings and family selection.

Claims

1. A specific marker for insertion mutation in the intron region of the ripk3 gene of rock bream, characterized in that: The specific markers for insertion variation in the intron region of the ripk3 gene of the striped rock sea bream are DNA fragments of non-insertion and insertion specific markers in the intron region of the ripk3 gene of the striped rock sea bream, and the nucleotide sequences of the DNA fragments are shown in SEQ ID NO:1 and SEQ ID NO:

2.

2. The specific marker for insertion variation in the intron region of the ripk3 gene of the striped sea bream according to claim 1, characterized in that: The nucleotide sequence of the non-insertion and insertion specific markers of the DNA fragment in the intron region of the ripk3 gene of the striped rock sea bream is shown in SEQ ID NO: 1, which is a homologous fragment in the intron region of the ripk3 gene shared by the X1 chromosomes of female and male striped rock sea bream without DNA insertion mutation. It is a DNA characteristic marker shared by non-insertion and insertion individuals in the intron region of the ripk3 gene of the striped rock sea bream.

3. An application of a specific marker for insertion mutation in the intron region of the ripk3 gene of the striped sea bream according to claim 1, characterized in that: The specific marker is used to identify the genetic sex of male and female striped porgy.

4. A method for identifying the genetic sex of male and female striped porgy using the specific marker of insertion variation in the intron region of the ripk3 gene of striped porgy according to claim 1, characterized in that: 1) PCR amplification: Take the striped porgy to be tested and extract genomic DNA; use the obtained genomic DNA as a template and specific primers for the intron region of the striped porgy ripk3 gene to perform PCR amplification, and compare the obtained PCR amplification product with the specific marker described in claim 1; 2) Result judgment: two DNA fragments of 125 bp and 472 bp were amplified from the genomic DNA of the tested striped rock bream, indicating that the tested striped rock bream was an individual with a DNA fragment insertion mutation in the intron region of the ripk3 gene; 125 bp was the DNA fragment shown in SEQ ID NO: 1, and 472 bp was the DNA fragment shown in SEQ ID NO: 2; 3) Only a single DNA fragment of 125 bp is amplified from the genomic DNA of the tested striped rock bream, which means that the tested striped rock bream is an individual without DNA fragment insertion mutation in the intron region of the striped rock bream ripk3 gene; 125 bp is the DNA fragment shown in SEQ ID NO: 1; The specific primers in step 1) are: Ch ripk3 _F:1 : 5’- TTAAACCCTAGATTTAAACCCTAG-3’; Ch ripk3 _R:2: 5'-AGTGTATTGATGATATGCTGTGT-3'.

5. The method for identifying the genetic sex of male and female rock porgy according to claim 4, characterized in that: In step 2), it is determined that the striped rock bream to be tested is an individual with a DNA fragment insertion mutation in the intron region of the ripk3 gene, and the striped rock bream to be tested is a male fish X1X2Y; In step 3), it is determined that the striped rock seabream to be tested is an individual with no DNA fragment insertion mutation in the intron region of the striped rock seabream ripk3 gene, and the striped rock seabream individual to be tested is a female X1X1X2X2.

6. A primer for detecting the specific marker of the insertion mutation in the intron region of the ripk3 gene of the striped sea bream according to claim 1, characterized in that: Ch ripk3 _F:1 : 5’- TTAAACCCTAGATTTAAACCCTAG-3’; Ch ripk3 _R:2: 5'-AGTGTATTGATGATATGCTGTGT-3'.

7. Use of a specific labeled primer for detecting insertion variation in the intron region of the ripk3 gene of rock bream according to claim 6, characterized in that: The primers are used in detecting the genetic sex of male and female rock bream.

8. A kit for identifying the genetic sex of male and female rock bream, characterized in that: The kit contains the primers described in claim 6.

Images