circRNA markers, kits and applications thereof for diagnosing and evaluating myocardial aging

Abstract

The present invention discloses a circRNA marker, a kit and an application thereof for diagnosing and evaluating myocardial aging. The application of the circRNA marker includes one or more of the following applications: A1) application in the preparation of a product for diagnosing myocardial aging; A2) application in the preparation of a product for screening myocardial aging; A3) application in the preparation of a product for treating myocardial aging; A4) application in the preparation of a product for evaluating myocardial aging; A5) application in the preparation of a product for distinguishing myocardial aging from other heart diseases; the circRNA marker is hsa_circ_0120829, and the nucleotide sequence is shown in SEQ ID No.1.

Description

Technical Field

[0001] The present invention relates to a marker for diagnosing myocardial aging, specifically a circRNA marker, and also relates to a kit for detecting the circRNA marker and application thereof, belonging to the field of medical molecular diagnosis. Background Art

[0002] Cardiovascular diseases (CVDs) are among the diseases with the highest morbidity and mortality worldwide. With the advancement of medicine, despite remarkable achievements in disease prevention, diagnostic markers and treatment, the threat of cardiovascular diseases remains severe. Especially in the context of an aging population, myocardial aging and the cardiovascular diseases it causes have become a hot topic of research. Myocardial aging not only affects cardiac function, but is also closely related to the occurrence and development of a variety of cardiovascular diseases. Therefore, in-depth exploration of the molecular mechanisms of myocardial aging and the search for effective diagnostic markers and therapeutic targets are crucial to improving the ability to diagnose and treat related diseases.

[0003] Circular RNA (circRNAs) is a special type of non-coding RNA first discovered by Sanger in 1976. In recent years, studies have shown that circRNAs play an important role in cardiovascular diseases. They interact with miRNA and mRNA to affect gene expression, thereby participating in the pathological process of various cardiovascular diseases such as atherosclerosis, coronary artery disease, and myocardial infarction. CircRNAs have stability and conservatism, as well as specific spatiotemporal expression patterns, making them potential biomarkers and therapeutic targets for cardiovascular diseases. Compared with traditional linear RNA, the circular structure of circRNAs makes them more stable and less susceptible to degradation. With the advancement of detection technology, the detection of circRNAs has become more feasible, which provides the possibility for their application in the diagnosis and treatment of myocardial aging and related cardiovascular diseases. Therefore, studying the mechanism of action of circRNAs in myocardial aging and developing diagnostic tools based on circRNAs are of great significance for improving the diagnosis and treatment of myocardial aging-related diseases. Summary of the invention

[0004] The primary technical problem to be solved by the present invention is to provide an application of a new circRNA marker. The circRNA marker can not only be used to prepare substances for diagnosis, screening, disease assessment and differentiation of myocardial aging and other heart diseases, but also become a new target for the treatment of myocardial aging-related diseases.

[0005] Another technical problem to be solved by the present invention is to provide a kit for detecting the circRNA marker. The kit can be used for diagnosing, screening, evaluating and distinguishing myocardial aging from other heart diseases.

[0006] The third technical problem to be solved by the present invention is to provide a primer for detecting the circRNA marker. The primer can be used for diagnosis, screening, prognosis evaluation and differentiation of myocardial aging and other heart diseases.

[0007] In order to achieve the above technical objectives, the present invention adopts the following technical solutions:

[0008] According to a first aspect of an embodiment of the present invention, there is provided an application of a substance for detecting a circRNA marker, including one or more of the following applications:

[0009] A1) Application in the preparation of products for diagnosing myocardial aging;

[0010] A2) Application in the preparation of products for screening myocardial aging;

[0011] A3) Application in the preparation of products for treating myocardial aging;

[0012] A4) Application in the preparation of myocardial aging disease assessment products;

[0013] A5) Application in the preparation of products for distinguishing myocardial aging from other heart diseases;

[0014] The circRNA marker is hsa_circ_0120829, and the nucleotide sequence is shown in SEQ ID No.1.

[0015] The "product" can be a product for diagnosing myocardial aging by detecting the expression level of hsa_circ_0120829 through RT-PCR, real-time quantitative PCR, in situ hybridization, chip or high-throughput sequencing platform.

[0016] In the above applications, hsa_circ_0120829 was significantly upregulated in the plasma samples of patients with myocardial aging; the expression level of hsa_circ_0120829 in healthy people was significantly lower than that in patients with myocardial aging.

[0017] Preferably, the substance is a reagent for detecting the expression level of hsa_circ_0120829, or a reagent for specifically identifying hsa_circ_0120829, or a reagent for detecting the content of hsa_circ_0120829.

[0018] Preferably, the substance is a substance for detecting hsa_circ_0120829, specifically the following a), b) or c):

[0019] a) Primers for detecting or specifically recognizing hsa_circ_0120829;

[0020] b) a reagent set containing the reagent described in a);

[0021] c) A kit containing a) or b).

[0022] Preferably, the primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0023] According to a second aspect of an embodiment of the present invention, a kit for detecting a circRNA marker is provided, the kit comprising one or more of the following applications:

[0024] A1) Application in the preparation of products for diagnosing myocardial aging;

[0025] A2) Application in the preparation of products for screening myocardial aging;

[0026] A3) Application in the preparation of products for treating myocardial aging;

[0027] A4) Application in the preparation of myocardial aging disease assessment products;

[0028] A5) Application in the preparation of products for distinguishing myocardial aging from other heart diseases;

[0029] The circRNA marker is hsa_circ_0120829, and the nucleotide sequence is shown in SEQ ID No. 1; the kit includes a reagent for detecting or specifically identifying hsa_circ_0120829, or a reagent for detecting the expression amount of hsa_circ_0120829.

[0030] The kit provided by the present invention can be used to detect the expression of the hsa_circ_0120829 characteristic gene sequence shown in SEQ ID NO.1 in the peripheral blood of the subject, and then the probability of myocardial aging or the severity of the disease in the subject can be judged based on the information of up-regulation or down-regulation of these gene expressions, thereby realizing the diagnosis and / or screening of myocardial aging.

[0031] All kits provided by the present invention may include appropriate packaging and instructions for use in the methods disclosed in the present invention. Preferably, the detection kit provided by the present invention is a nucleic acid detection kit, including reagents required for RNA extraction and real-time fluorescence quantitative PCR (qRT-PCR). The kit may further include appropriate buffer and polymerase, and may also include control primers and / or probes.

[0032] Preferably, the reagent for detecting or specifically identifying hsa_circ_0120829 is a specific primer, and the specific primer is the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0033] According to a third aspect of an embodiment of the present invention, a primer for detecting a circRNA marker is provided, wherein the primer comprises one or more of the following applications:

[0034] A1) Application in the preparation of products for diagnosing myocardial aging;

[0035] A2) Application in the preparation of products for screening myocardial aging;

[0036] A3) Application in the preparation of products for treating myocardial aging;

[0037] A4) Application in the preparation of myocardial aging disease assessment products;

[0038] A5) Application in the preparation of products for distinguishing myocardial aging from other heart diseases;

[0039] The primers are primers for detecting the expression level of hsa_circ_0120829 or specifically identifying hsa_circ_0120829.

[0040] Preferably, the primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

[0041] Compared with the prior art, the present invention has the following technical effects:

[0042] (1) The present invention discloses a specific circular RNA, namely hsa_circ_0120829, which has important value in the diagnosis of myocardial aging. In clinical validation trials, it was found that the level of hsa_circ_0120829 in the plasma of patients with myocardial aging was significantly higher than that in the healthy control group. This finding suggests that hsa_circ_0120829 can be used as a potential biomarker for the diagnosis and screening of myocardial aging, and also helps to distinguish myocardial aging from other heart diseases.

[0043] (2) Further diagnostic efficacy evaluation through ROC curve analysis showed that hsa_circ_0120829 showed high sensitivity and specificity in diagnosing myocardial aging. This means that hsa_circ_0120829 can not only accurately identify patients with myocardial aging, but also reduce the possibility of misdiagnosis, thus confirming its effectiveness and reliability in clinical diagnosis.

[0044] (3) In addition, the study also found a positive correlation between the expression levels of hsa_circ_0120829 and β-galactosidase, a marker of myocardial cell aging. This correlation further confirmed the close connection between hsa_circ_0120829 and the myocardial cell aging process, and emphasized its potential application value in the diagnosis of myocardial aging. Therefore, hsa_circ_0120829 not only has important clinical significance in the diagnosis of myocardial aging, but its correlation with cell aging markers also provides strong support for its diagnostic efficacy as a biomarker of myocardial aging.

[0045] (4) In clinical experiments, a positive correlation was observed between BNP (B-type natriuretic peptide) in human plasma and the expression level of hsa_circ_0120829. BNP is a peptide hormone synthesized by the heart when the ventricular wall is dilated or stretched. It can reflect the compensatory function of the heart and is an important biomarker for evaluating cardiac function and diagnosing heart failure. Since heart failure is closely related to myocardial aging, the level of BNP is also often used to reflect the condition of myocardial aging. Experimental data showed that the level of hsa_circ_0120829 in plasma was positively correlated with the level of BNP, which means that the level of hsa_circ_0120829 can be used as an indicator to assess the severity of myocardial aging. Therefore, hsa_circ_0120829 may not only become a diagnostic biomarker for myocardial aging, but also help to assess the severity of the disease and provide guidance for clinical treatment.

[0046] (5) In an in vitro cytological validation experiment, the expression of hsa_circ_0120829 (a circular RNA) was significantly increased compared with normal control cells by treating AC16 cardiomyocytes with D-galactose (D-gal), indicating that the expression of hsa_circ_0120829 increases during cardiomyocyte aging. This finding provides a cellular and molecular basis for hsa_circ_0120829 as a potential diagnostic biomarker for myocardial aging. In addition, by knocking down (i.e., reducing the expression level) small RNAs related to hsa_circ_0120829, it was observed that the cellular aging phenomenon was alleviated, which further supports that hsa_circ_0120829 can not only be used as a biomarker for myocardial aging, but also may become a new target for the treatment of myocardial aging. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 The volcano plot of circRNA expression differences between aging cardiomyocytes AC16 and normal controls obtained by sequencing;

[0048] Figure 2To determine the hsa_circ_0120829 content in the plasma of aging patients and normal controls by qRT-PCR;

[0049] Figure 3 ROC curve for hsa_circ_0120829 in diagnosing patients with myocardial aging;

[0050] Figure 4 is the relationship between the positive ratio of β-galactosidase, a senescence marker, and the expression level of hsa_circ_0120829 in cardiomyocytes induced by D-gal;

[0051] Figure 5 The relationship between the patient's plasma BNP level and the expression of hsa_circ_0120829;

[0052] Fig. 6A The relative expression level of hsa_circ_0120829 after AC16 was transfected with hsa_circ_0120829 small interfering RNA (siRNA);

[0053] Figure 6B This is the relative expression level of mRNA after hsa_circ_0120829 knockdown;

[0054] Fig. 7A The expression of P21 mRNA induced by D-gal in cardiomyocytes after siRNA knockdown of hsa_circ_0120829 in AC16;

[0055] Figure 7B The expression of D-gal-induced cardiomyocyte IL-1β mRNA after siRNA knockdown of hsa_circ_0120829 in AC16;

[0056] Figure 8 The expression levels of hsa_circ_0120829 and BNP after hsa_circ_0120829 knockdown and control group AC16 were treated with D-gal;

[0057] Fig. 9 Western blot was used to determine the expression of senescence marker protein β-galactosidase after knockdown of hsa_circ_0120829 and normal cells were induced to senescence with the senescence-inducing reagent D-gal. DETAILED DESCRIPTION

[0058] The present invention is further described below in conjunction with specific examples. These examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples that do not specify specific conditions are usually performed under conventional conditions or according to the conditions recommended by the manufacturer. Unless otherwise defined, all professional and scientific terms used in the text have the same meanings as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described contents can be applied to the method provided by the present invention. The preferred implementation methods and materials described in the text are for demonstration purposes only.

[0059] The research and development process and ideas of the present invention: First, 3 naturally aged AC16 cardiomyocytes and 3 normal control cells were selected to extract total RNA and then sent to Guangzhou Epigenetics for circRNA sequencing, and circRNAs with significant differences in expression (Fold chang ≥ 2.0, P value < 0.05) were screened. Then, qRT-PCR was used to determine the content of the top 10 circRNAs in the patient's plasma, and the first one with significant increase was taken for subsequent experiments. Then, the inventors used in vitro experimental cell levels to verify the relationship between the expression of hsa_circ_0120829 and myocardial aging again, and the specific data are as follows.

[0060] Example 1 Screening and correlation study of circRNA markers of myocardial aging

[0061] 1. Sample and Methods:

[0062] 1.1 Clinical samples:

[0063] Venous blood was collected from 50 patients aged 60 to 90 years who were hospitalized in the General Hospital of the Chinese People's Liberation Army from 2020 to 2023 and excluded heart disease. Venous blood was also collected from 50 healthy subjects aged ≤ 30 years. They were divided into two groups: a control group and an aging group for subsequent determination of circRNA levels in plasma.

[0064] Inclusion criteria:

[0065] (1) Inpatients aged 60 years or younger and younger than 90 years;

[0066] (2) Healthy people aged ≤30 years old;

[0067] (3) Complete blood sample information is available.

[0068] Exclusion criteria: malignant tumors, severe liver and kidney dysfunction, severe autoimmune diseases, severe blood system diseases or other cardiovascular diseases such as coronary heart disease, valvular heart disease and cardiomyopathy.

[0069] 1.2 Methods:

[0070] 1.2.1 Plasma extraction: Human peripheral blood was collected using EDTA anticoagulant blood collection tubes, centrifuged at 2500 g for 15 min, and the upper plasma was collected into a 2 ml sterile tube and stored in a -80 °C refrigerator.

[0071] 1.2.2 RNA extraction and real-time fluorescence quantitative PCR (qRT-PCR):

[0072] Total RNA was extracted from AC16 using RNA simple Total RNA Kit (DP419, TIANGEN, Beijing, China).

[0073] (1) RNA extraction

[0074] To extract tissue RNA from plasma samples, the instructions for use of TRIZOL Reagent (Invitrogen) were followed. The specific steps were as follows: 1 ml of TRIZOL Reagent was added to the plasma, followed by 200 μl of chloroform, and the mixture was shaken for 20 seconds and allowed to stand at room temperature for 10 minutes. Next, the mixture was centrifuged at 13,000 rpm for 15 minutes at 4°C. The supernatant was carefully aspirated, 800 μl of isopropanol was added, the mixture was gently inverted to mix, and then allowed to stand at -20°C for 1 hour. The mixture was centrifuged again at 13,000 rpm for 15 minutes at 4°C, and the supernatant was discarded. After that, 1 ml of 75% ethanol was added to gently wash the precipitate, and the mixture was centrifuged at 13,000 rpm for 5 minutes at 4°C, the supernatant was removed, and the precipitate was blown dry. Finally, an appropriate amount of enzyme-free water was added and the mixture was dissolved at 65°C for 10 minutes to detect the OD value and concentration of RNA. The extracted RNA samples should be stored at -80°C for future use.

[0075] (2) RNA reverse transcription to synthesize cDNA

[0076] 500 ng of RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara RR037A).

[0077] (3) Reverse transcription of circRNA:

[0078] Operate on ice, 20u1 per reaction system, as shown in Table 1:

[0079] Table 1

[0080]

[0081] (4) Reverse transcription of mRNA:

[0082] Operate on ice, 20 μL per reaction system, as shown in Table 2:

[0083] Table 2

[0084]

[0085] The reaction procedure was: 37°C for 45 min, 85°C for 5 min, and maintain at 4°C.

[0086] (5) qRT-PCR

[0087] circRNAs primer sequences were designed according to the circRNAs primer design principles.

[0088] The cDNA obtained by reverse transcription reaction was diluted 1:10 and subjected to the following qRT-PCR reaction.

[0089] Operate on ice, 20u1 per reaction system, as shown in Table 3:

[0090] Table 3

[0091]

[0092] When conducting a real-time quantitative PCR (Real-time PCR) experiment, the reaction solution needs to be fully mixed and reacted in a PCR instrument according to the following procedures: First, the first stage is carried out, and the temperature is set to 95°C and maintained for 2 minutes; then, the second stage is entered, and 35 cycles are performed, each cycle includes 94°C for 5 seconds and 60°C for 1 minute; finally, the third stage is carried out, including 95°C for 15 seconds, 60°C for 1 minute, and 95°C for 5 seconds. In this process, the GAPDH gene is used as an internal reference to quantitatively compare the relative levels of each target mRNA, and the expression levels of these mRNAs are expressed by calculating the relative ratio.

[0093] 1.2.3 circRNA sequencing analysis:

[0094] Total RNA was extracted from 3 naturally aged AC16 cardiomyocytes and 3 normal control cells and sent to Guangzhou Epigenetics for circRNA sequencing. CircRNAs with significant expression differences (Fold chang ≥ 2.0, P value < 0.05) were screened, and then qRT-PCR was used to determine the content of the top 10 circRNAs in the patient's plasma. The first one with significantly increased expression was selected for subsequent experiments.

[0095] Figure 1 The volcano plot of circRNA expression differences between aging cardiomyocytes AC16 and normal controls obtained by sequencing. Table 4 lists the top 10 upregulated circRNAs.

[0096] Table 4 Top 10 upregulated circRNAs obtained from sequencing data

[0097]

[0098] 1.2.4 ROC curve drawing:

[0099] The Receiver Operating Characteristic (ROC) curve is a tool for evaluating the performance of diagnostic tests, which is displayed by plotting the relationship between the true positive rate (sensitivity) and the false positive rate (1-specificity). In the ROC curve diagram, the ordinate represents sensitivity, that is, the probability that the test correctly identifies the presence of the disease; the abscissa represents 1-specificity, that is, the probability that the test incorrectly marks a healthy individual as a disease. By setting different cutoff values, that is, the critical point that determines the positive test result, the sensitivity and specificity at each cutoff value can be calculated. Then, these points are connected on the coordinate graph, and the curve formed is the ROC curve. The closer the ROC curve is to the upper left corner, the better the diagnostic efficacy of the diagnostic marker. In the present invention, GraphPad Version 9.1.0 is used to draw the ROC curve to evaluate the diagnostic ability of a specific biomarker for a disease.

[0100] 1.2.5 Statistical analysis:

[0101] Student's t-test and analysis of variance were used for normal variables, and the Mann Whitney U test and Kruskal Wallis test were used for non-normal variables. Statistical analysis was performed using R software (v 3.4.2) and GraphPad Prism software (v 8.00). Biological replicates are shown as single data points superimposed on the bar graphs. P < 0.05 was considered significant.

[0102] 3. Verify the results:

[0103] like Figure 2 As shown, we measured the content of hsa_circ_0120829 in the plasma of aging patients by quantitative real-time polymerase chain reaction (qRT-PCR) technology. The experimental results showed that the expression level of hsa_circ_0120829 in the plasma of aging patients was significantly increased compared with that in the healthy control group. This finding further confirmed that hsa_circ_0120829, as a marker identified from aging cardiomyocytes AC16, has the possibility of becoming a potential biomarker of myocardial aging.

[0104] like Figure 3As shown in the figure, we drew the receiver operating characteristic (ROC) curve of hsa_circ_0120829 in diagnosing myocardial aging. The curve shows that hsa_circ_0120829 exhibits excellent sensitivity and specificity in diagnosing patients with myocardial aging, indicating that it has high diagnostic efficacy and can serve as a reliable biomarker for myocardial aging.

[0105] Example 2: Further verification of the relationship between hsa_circ_0120829 and myocardial aging using β-galactosidase staining experiment The relationship between

[0106] 1. Experimental purpose:

[0107] After a limited number of divisions, normal cells stop dividing and irreversible growth arrest occurs. At this time, the cells enter a state of senescence, and the β-galactosidase associated with senescence is activated. β-galactosidase is a hydrolase in the cell lysosome, but the activity of this enzyme is upregulated in senescent cells. Based on this phenomenon and principle, with galactoside as a substrate, senescent cell-specific β-galactosidase catalyzes the substrate to produce a blue product, which is manifested as a blue deposit in the cell cytoplasm. Under an optical microscope, cells or tissues expressing β-galactosidase that have turned blue can be easily observed. The β-galactosidase staining experiment is the gold standard for determining whether cells are senescent in cell molecular experiments.

[0108] 2. Experimental methods:

[0109] To stain AC16 human cardiomyocytes for β-galactosidase, the Beyotime galactosidase staining kit (C0602) was first used. For cells cultured in 6-well plates, the cell culture medium was first aspirated and then washed once with phosphate buffered saline (PBS). Next, 1 ml of β-galactosidase staining fixative was added and fixed at room temperature for 15 minutes. After fixation, the fixative was aspirated and the cells were washed again three times with PBS for 3 minutes each. After washing, the PBS was aspirated and 1 ml of the pre-prepared staining working solution was added to each well. The staining working solution was prepared by mixing 10 μl of β-galactosidase staining solution a, 10 μl of β-galactosidase staining solution b, 930 μl of β-galactosidase staining solution c, and 50 μl of X-Gal solution. The 6-well plate was sealed with plastic wrap to prevent evaporation of the liquid and incubated overnight at 37°C. Note that the incubation process cannot be carried out in a carbon dioxide incubator. Finally, the staining results were observed using a normal optical microscope.

[0110] 3. Statistical analysis methods:

[0111] Cells stained blue under an optical microscope were considered positive cells, and the number of positive cells per 100 cells was randomly selected to count the number of positive cells, which was determined as the positive cell ratio (%). The correlation analysis between the positive cell ratio of each sample and hsa_circ_0120829 was performed.

[0112] 4. Experimental results:

[0113] like Figure 4 As shown, a significant positive correlation was observed between the expression levels of β-galactosidase, a marker of cardiomyocyte aging, and hsa_circ_0120829. This finding indicates that the level of hsa_circ_0120829 increases with the progression of cardiomyocyte aging, thus confirming the close connection between hsa_circ_0120829 and cardiomyocyte aging. This positive correlation not only confirms the reliability of hsa_circ_0120829 as a potential biomarker of cardiomyocyte aging, but also indicates its potential application value in the diagnosis of cardiomyocyte aging, providing a strong molecular basis for the clinical diagnosis of cardiomyocyte aging.

[0114] Example 3 Experiment on the relationship between BNP and hsa_circ_0120829 expression

[0115] BNP (B-type natriuretic peptide) and N-terminal B-type natriuretic peptide precursor (patients above the median level) are biomarkers of cardiac function, and are also the preferred biomarkers for the diagnosis and differential diagnosis of heart failure, the severity of the disease and the assessment of prognosis. In healthy adults, the normal value of BNP should be <100ng / L. With the increase of age, myocardial aging and the decline of cardiac function, BNP will gradually increase, and it is generally considered abnormal when it is greater than 100ng / L. The diagnostic criteria are based on the expert consensus of the American College of Cardiology (ACC) in 2004: if BNP is <100ng / L, the possibility of heart failure is extremely small, and its negative predictive value is 90%. If BNP is >500ng / L, the possibility of heart failure is extremely high, and its positive predictive value is 90%. The normal value of BNP should be <100ng / L, and BNP within the normal range can exclude acute heart failure.

[0116] BNP in the heart is mainly distributed in the left and right atria, with the BNP content in the right atrium being more than three times that of the left atrium. The BNP content in the ventricles is relatively low because the precursors of BNP are not stored in the ventricles. Only when the ventricular wall is subjected to higher tension will it rapidly stimulate high expression of the BNP gene, resulting in large amounts of synthesis and secretion into the blood. In short, an increase in the level of BNP in plasma usually means that there is an obstruction in the contraction or relaxation function of the heart, and blood cannot be effectively pumped out of the venous system, causing the ventricles to be stretched. This increase in BNP levels changes dynamically and is closely related to the functional state of the heart.

[0117] Myocardial aging is a natural process that occurs with aging, and the heart muscle gradually loses its function and efficiency. This decline may lead to a decrease in the heart's ability to pump blood and obstructed blood circulation, which in turn increases the release of BNP. Therefore, the level of BNP in the blood is an important biomarker for assessing myocardial aging and the risk of heart failure.

[0118] The experimental results show that Figure 5 As shown, there is a positive correlation between BNP in patient plasma and the expression of hsa_circ_0120829. BNP is a hallmark protein of heart failure, and the positive correlation between the expression of hsa_circ_0120829 and BNP levels indicates that the level of hsa_circ_0120829 in plasma can reflect the severity of myocardial aging and heart failure. These findings further support the possibility of hsa_circ_0120829 as a potential biomarker for the assessment of myocardial aging.

[0119] Example 4 In vitro experimental cell level verification of the relationship between the expression level of hsa_circ_0120829 and myocardial aging relation

[0120] 1. Experimental Materials and Methods

[0121] 1. Cell culture:

[0122] Human cardiomyocyte cell line (AC16) was purchased from Wuhan Punosai, and the cells were cultured in RPMI-1640 medium + 10% fetal bovine serum in an incubator at 37°C with 5% carbon dioxide.

[0123] siRNA knockdown method: siRNA was ordered from Thermo Fisher and added according to the instructions when the cell confluence reached 70%. The knockdown effect was determined by qRT-PCR after 24 hours of induction.

[0124] 2. Cell senescence treatment:

[0125] To induce senescence in AC16 cardiomyocytes, these cells were exposed to 10 mM D-galactose. D-galactose is an effective inducer of senescence models, with stronger glycation than glucose and the ability to induce oxidative stress. Under this treatment, D-galactose can induce cytotoxicity and senescence characteristics in AC16 cells, including the promotion of BNP (B-type natriuretic peptide) secretion, a biomarker released during cardiomyocyte stress. After 24 hours of treatment, the expression levels of intracellular circRNAs and the concentration of BNP in the culture supernatant can be measured by comparing the cardiomyocytes of the treated and untreated control groups to evaluate the effect of D-galactose-induced cell senescence.

[0126] 3. The qRT-PCR method was the same as in Example 1.

[0127] 4. Determination of human plasma BNP:

[0128] When using the BNP enzyme-linked immunosorbent assay (ELISA) kit (ZC-34224) produced by Zhuocai Biotechnology to measure BNP levels, the operating steps are as follows: First, add 100 microliters of the standard or test sample to each well and let the kit equilibrate at room temperature for 30 minutes. Then, remove the required strips from the aluminum foil bag and seal the remaining strips in a ziplock bag and return them to 4°C for storage. For the standard wells, add 50 microliters of different concentrations of standards; for the sample wells, add 50 microliters of the test sample; and do not add anything to the blank wells. In all wells except the blank wells, add 100 microliters of horseradish peroxidase (HRP)-labeled detection antibody, seal the reaction wells with a sealing film, and then incubate in a water bath or incubator at 37°C for 60 minutes. After incubation, discard the liquid in the wells and pat dry with absorbent paper. Next, add 350 μl of washing solution to each well, let stand for 1 minute, shake off the washing solution, and pat dry with absorbent paper. Repeat this washing step for a total of 5 times, or use a plate washer for washing. After washing, add 50 μl of substrate A and B to each well, and then incubate at 37°C in the dark for 15 minutes. After incubation, add 50 μl of stop solution to each well, and measure the absorbance (OD) value of each well using a photometer at a wavelength of 450 nm within 15 minutes.

[0129] 5. Western blot experiment:

[0130] When performing a Western blot experiment, first remove the cell culture medium and wash once with phosphate buffered saline (PBS). Then, add 150 to 250 microliters of lysis buffer according to the amount of cells in each well of the 6-well plate. Use a pipette to blow the cells to ensure that the lysis buffer is fully in contact with the cells. Next, centrifuge the cell lysate at a centrifugal force of 10,000 to 14,000g for 3 to 5 minutes to collect the supernatant. Take out the precast polyacrylamide gel and mix the protein sample with 10 microliters of protein loading buffer. Load 20 to 40 micrograms of protein sample in each sample well of the gel and then electrophoresed at a voltage of 100V for 40 minutes. Before transfer, place the transfer tank in an ice bath, assemble the transfer sandwich, ensure that the membrane is close to the anode and the gel is close to the cathode, and add the transfer buffer. Turn on the power supply and perform electrotransfer at a voltage of 100V for 1 hour. After the transfer is completed, turn off the power supply and remove the membrane. Place the membrane in 25 ml of blocking buffer and incubate at room temperature for 1 hour. Wash the membrane three times with TBST buffer for 15 minutes each time. After that, incubate the primary and secondary antibodies in sequence. Prepare the luminescent working solution according to the instructions of the ECL ultrasensitive kit. Immerse the membrane completely in the luminescent working solution and incubate at room temperature for 3 minutes. Finally, press X-ray film in a darkroom, expose for different times, and then develop and rinse the film to observe the results.

[0131] 6. Experimental results:

[0132] Fig. 6A It was shown that after AC16 cardiomyocytes were transfected with hsa_circ_0120829 small interfering RNA (siRNA), the expression level of hsa_circ_0120829 was significantly reduced. Figure 6B The results showed that although hsa_circ_0120829 was knocked down, the total amount of mRNA in the cells did not change. These results confirmed the success of siRNA transfection and provided a reliable basis for subsequent experiments.

[0133] Fig. 7A and Figure 7B The effect of hsa_circ_0120829 siRNA transfection on the expression of senescence markers in AC16 cells was further explored. Fig. 7A It was shown that the mRNA expression level of P21 protein (a marker of cellular senescence) in AC16 cells was reduced after hsa_circ_0120829 was knocked down. Figure 7BThe results showed that the mRNA expression of IL-1β (a secretory factor associated with cell senescence) in AC16 cells was also reduced by knockdown of hsa_circ_0120829. These findings indicate that knockdown of hsa_circ_0120829 can slow down the process of cell senescence, suggesting that hsa_circ_0120829 may become a potential target for the treatment of myocardial aging.

[0134] Figure 8 The effects of knockdown of hsa_circ_0120829 on the expression of hsa_circ_0120829 and BNP (B-type natriuretic peptide, a biomarker of cardiac stress) in AC16 cells under D-galactose (D-gal)-induced senescence conditions were shown. The results showed that D-gal treatment significantly increased the level of BNP and induced an increase in the expression of hsa_circ_0120829. However, after knockdown of hsa_circ_0120829, the expression level of BNP decreased. These results support hsa_circ_0120829 as a biomarker of myocardial aging and further suggest that it may be a potential target for the treatment of myocardial aging.

[0135] at last, Fig. 9 Western blot was used to detect the expression of β-galactosidase (β-gal), a marker of senescence, in AC16 cells with hsa_circ_0120829 knocked down after D-gal induced senescence. The results showed that the level of β-gal was reduced in cells with hsa_circ_0120829 knocked down, which further confirmed the role of hsa_circ_0120829 in cardiomyocyte senescence and supported its potential as a therapeutic target for cardiomyocyte senescence.

[0136] The above experimental results show that hsa_circ_0120829 is significantly correlated with myocardial aging, making it a new biological marker for myocardial aging. In cardiomyocytes treated with D-galactose (D-gal), an aging inducer, the expression level of hsa_circ_0120829 was upregulated, which supports its role in myocardial aging. In addition, through ROC curve analysis, we found that hsa_circ_0120829 has excellent diagnostic potential and can effectively distinguish patients with myocardial aging. These findings suggest that hsa_circ_0120829 may be directly involved in the D-gal-induced myocardial cell aging process. Therefore, hsa_circ_0120829 is not only expected to become a diagnostic biomarker for myocardial aging, but also a potential target for the treatment of myocardial aging in the future.

[0137] Example 5 The sequences, primers and kit compositions involved in the present invention

[0138] The nucleotide sequence of the myocardial aging marker hsa_circ_0120829 provided by the present invention is shown in SEQ ID No. 1, circBank ID: hsa_cicrAAK1_010, cirBase ID: hsa_circ_0120829;

[0139] SEQ ID No.1: GTTGAAAACATCCTCTTGCATGACCGAGGCCACTATGTCCTGTGTGACTTTGGAAGCGCCACCAACAAATTCCAGAATCCACAAACTGAGGGAGTCAATGCAGTAGAAGATGAGATTAAGAAATACACAACGCTGTCCTATCGAGCACCAGAAATGGTCAACCTGTACAGTGGCAAAATCATCACTACGAAGGCAGACATTTGGGCTCTTGGATGTTT GTTGTATAAATTATGCTACTTCACTTTGCCATTTGGGGAAAGTCAGGTGGCAATTTGTGATGGAAACTTCACAATTCCTGATAATTCTCGATATTCTCAAGACATGCACTGCCTAATTAGGTATATGTTGGAACCAGACCCTGACAAAAGGCCGGATATTACCAGGTGTCCTACTTCTCATTTAAGCTACTCAAGAAAGAGTGCCCAATTCCAAATGTACAG

[0140] The primer pair for specifically identifying hsa_circ_0120829 provided by the present invention comprises an upstream primer as shown in SEQ ID No. 2 and a downstream primer as shown in SEQ ID No. 3:

[0141] SEQ ID No.2: GCCCGGCTAGCTCAGTCGGTAG

[0142] SEQ ID No.3: AGCATGGGACTCTTAATCCCAC

[0143] The kit provided by the present invention comprises:

[0144] 5x primer buffer, reaction enzyme combination I, Random 6 mers, Oligo dT primer, RNase-free pure water, SYBR probe II (Tli RNaseH Plus) (2x), PCR Primer (F+R) (10μM), ROX Reference dye (50x).

Claims

1. An application of a substance for detecting circRNA markers, characterized in that: Includes one or more of the following applications: A1) Application in the preparation of products for diagnosing myocardial aging; A2) Application in the preparation of products for screening myocardial aging; A3) Application in the preparation of products for treating myocardial aging; A4) Application in the preparation of myocardial aging disease assessment products; A5) Application in the preparation of products for identification and differentiation of myocardial aging and other diseases; The circRNA marker is hsa_circ_0120829, and its nucleotide sequence is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that: The product is a product for detecting the expression level of hsa_circ_0120829 through RT-PCR, real-time quantitative PCR, in situ hybridization, chip or high-throughput sequencing platform.

3. The use according to claim 1, characterized in that: The substance is a reagent for detecting the expression level of hsa_circ_0120829, or a reagent for specifically identifying hsa_circ_0120829, or a reagent for detecting the content of hsa_circ_0120829.

4. The use according to claim 1, characterized in that: The substance is a substance used to detect the expression amount, content or specific identification of hsa_circ_0120829, including the following a), b) or c): Primers for detecting or specifically identifying hsa_circ_0120829; A reagent set containing a); A kit containing a) or b).

5. The use according to claim 4, characterized in that: The primers are the upstream primer shown in SEQ ID No.2 and the downstream primer shown in SEQ ID No.3.

Images