Application of high-protein corn as soybean meal substitute in feed

Abstract

The present invention provides an application of high-protein corn as a soybean meal substitute in feed, and belongs to the field of feed technology. The present invention combines corn tissue culture technology with CRISPR / Cas9 gene editing technology to perform site-directed mutagenesis on the corn glutamine synthetase gene, and screens plants with amino acid site mutations. The crude protein content in the mutant corn kernels is as high as 30.44%, which is 106.23% higher than that of the non-mutated strains. The chicken feed prepared with the mutant corn kernels instead of soybean meal was fed to the experimental chickens, and the feed-to-meat ratio was close to that of the feed with soybean meal as the main nitrogen source, which was 21.94% lower than that of the feed prepared with the non-mutated corn. The use of high-protein corn as a soybean meal substitute to prepare feed can achieve the reduction of soybean meal in feed, effectively reduce feed costs, and improve breeding benefits.

Description

Technical Field

[0001] The invention belongs to the technical field of feed, and in particular relates to application of high-protein corn as a soybean meal substitute in feed. Background Art

[0002] Cereal products such as soybean meal, corn, and wheat bran are the main raw materials for animal feed. Soybean meal is a byproduct obtained after soybean oil is extracted from soybeans. The crude protein content in soybean meal is as high as 30~50%, which is the main raw material for making animal feed. As a protein feed, soybean meal is the staple food of livestock and poultry and is not easy to be replaced. In addition, soybean meal has become an important futures trading variety, which makes its price fluctuations have a wide range of influence and a large impact. The rising price of soybean meal has become the main factor in the rise in feed prices. In China, the main soybean producing area is in Heilongjiang, and the planting area is constantly decreasing. Soybean meal is highly dependent on imports, and its price fluctuation factors are unpredictable. Therefore, the replacement and reduction technology of soybean meal in feed has become an urgent problem to be solved in the feed manufacturing industry.

[0003] Corn is not only an important food and cash crop, but also an important raw material for the feed industry.

[0004] Corn plays a key role in my country's food security. Corn kernels are rich in starch, lipids and protein, as well as vitamins, trace elements and other nutritional factors. The protein content of existing corn varieties is about 10% to 15%, and its crude protein content is low. It is mainly used as a carbon source in feed and cannot completely replace soybean meal as the main nitrogen source in feed. Therefore, it is necessary to cultivate high-protein corn varieties for feed preparation to achieve the purpose of reducing the amount of soybean meal in feed. Summary of the invention

[0005] The invention aims to provide an application of high-protein corn as a soybean meal substitute in feed, belonging to the technical field of feed.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] Firstly, the present invention provides an application of high-protein corn as a soybean meal substitute in feed, wherein the high-protein corn is corn with a site-directed mutation of glutamine synthetase.

[0008] Furthermore, the amino acid sequence of the glutamine synthetase is SEQ ID NO.1.

[0009] Furthermore, the high-protein corn can be used as a soybean meal substitute for feed preparation.

[0010] Furthermore, the preparation method of the feed is as follows: 75% high-protein corn, 10% wheat bran, 10% fish meal, 1.5% bone meal, 3% yeast powder, and 0.5% salt. The proportioned feed raw materials are stirred and mixed by a mixer, dried, crushed by a grinder, and granulated.

[0011] Secondly, the present invention provides a corn glutamine synthetase mutant.

[0012] Thirdly, the present invention provides a gRNA for constructing a site-directed mutation of glutamine synthetase in corn, and the nucleotide sequence of the gRNA is SEQ ID NO.2.

[0013] Fourthly, the present invention provides a donor for constructing a site-directed mutation of glutamine synthetase in corn, wherein the nucleotide sequence of the donor is SEQ ID NO.3.

[0014] The beneficial effect of the present invention is that, by combining corn tissue culture technology with CRISPR / Cas9 gene editing technology, using soil Agrobacterium-mediated corn transformation, the 284th Tyr of the amino acid sequence of corn glutamine synthetase is mutated to Ala, and plants with amino acid site mutations are screened. The crude protein content in the mutant corn kernels is as high as 30.44%, which is 106.23% higher than that of the non-mutated strains. The chicken feed prepared with the mutant corn kernels instead of soybean meal is fed to the experimental chickens, and the feed-to-meat ratio is close to that of the feed with soybean meal as the main nitrogen source, which is 21.94% lower than that of the feed prepared with non-mutated corn. The use of high-protein corn as a soybean meal substitute to prepare feed can achieve the reduction of soybean meal in feed, reduce my country's dependence on imported soybean meal, effectively reduce feed costs, and improve breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 :The correspondence between the three sequences of glutamine synthetase gene HM371362.1, donor, and gRNA.

[0016] Figure 2 :pCAMBIA2300-Cas9donor vector plasmid map.

[0017] Figure 3 :Detection of protein content in corn kernels of mutant strains. DETAILED DESCRIPTION

[0018] Example 1: Protein structure modification and mutant design based on computer-aided design

[0019] The GenBank accession number of the amino acid sequence of maize glutamine synthetase is: ADO17336.1. The protein amino acid sequence was analyzed and homology modeling was performed using DiscoveryStudio software. The enzyme active site was analyzed and the aromatic amino acid tyrosine Tyr at position 284 was mutated to alanine Ala by site-directed mutagenesis to reduce steric hindrance and widen the enzyme pocket space. The amino acid sequence of the glutamine synthetase mutant is SEQ ID NO.1.

[0020] Example 2: Construction of corn plants with site-directed mutation of glutamine synthetase gene

[0021] 1.1 Construction of site-directed mutagenesis vector for glutamine synthetase gene

[0022] According to the maize glutamine synthetase gene GenBank: HM371362.1, gRNA was designed to guide Cas9 to cut the DNA sequence near Tyr 284 encoded by the maize glutamine synthetase gene to break the double-stranded DNA. The gRNA nucleotide sequence SEQ ID NO.2: GCGGCACAGGGAGCACATCGCGG conforms to the design principle of the gRNA sequence GN20NGG.

[0023] In order to introduce a site-directed mutation to mutate Tyr at position 284 to Ala, the donor sequence SEQ ID NO.3 was designed, with the corresponding gRNA sequence in the middle, the site-directed mutation site 6 bp after the cleavage site, and 80 bp of homology arm sequences upstream and downstream. To prevent the inserted site-directed mutation sequence from being cut twice by the gRNA-Cas9 system, a degenerate codon replacement was introduced into the donor corresponding gRNA sequence site. The corresponding relationship between the three sequences of glutamine synthetase gene HM371362.1, donor, and gRNA is shown in the figure. Figure 1 .

[0024] A binary vector pCAMBIA2300-Cas9donor for site-directed mutagenesis of the maize glutamine synthetase gene was constructed, and each expression frame was integrated into the maize genome through soil Agrobacterium transformation, thereby inserting the site-directed mutation sequence through gene splicing and homologous recombination. In this vector, the enhanced cauliflower mosaic virus promoter (CaMV 35S promoter) was used to initiate the expression of the Cas9 gene and the hygromycin phosphotransferase gene (HygR); the U6 promoter was used to initiate the transcription of gRNA, which requires the first G base and the last NGG base in the GN20NGG sequence to initiate the transcription of sgRNA. The Agrobacterium NOS promoter was used to initiate the transcription of donor. The plasmid map of the pCAMBIA2300-Cas9donor vector is shown in the figure. Figure 2 .

[0025] 1.2 Preparation of Agrobacterium tumefaciens strains

[0026] Transform the pCAMBIA2300-Cas9donor plasmid into Agrobacterium competent cells EHA105 by electroporation:

[0027] 1.2.1 Take out the competent Agrobacterium cells and place them on ice for 3-5 min;

[0028] 1.2.2 Add 2.0 μL plasmid DNA to 100.0 μL competent cells and place on ice for 30 min. Take out the mixture of cells and plasmids and transfer it to a pre-cooled -20℃ electroporation cup and electroporate at 2500V;

[0029] 1.2.3 Take out the electroporation cup, add 500.0 μL of pre-cooled YM liquid culture medium (without antibiotics), mix well by blowing with the pipette tip, and transfer the bacterial liquid into a 1.5 mL centrifuge tube; shake and culture at 28°C and 200 rpm for 5 h;

[0030] 1.2.4 Take 100.0 μL of bacterial solution and apply it on YM plate (containing 50.0 mg / L Kn and 50.0 mg / L Rif)

[0031] On top, invert and culture at 28℃ for 1.5~2 days;

[0032] 1.2.5 Pick a single colony of Agrobacterium tumefaciens and place it in 3.0 mL of dual-antibody YM liquid medium (50.0 mg / L Kn and 50.0 mg / L Rif), and culture it overnight in a shaker at 28°C and 200 rpm;

[0033] 1.2.6 Take 1.0 mL of overnight culture solution and inoculate it into 50.0 mL YM liquid medium (containing 50.0 mg / L Kn and 50.0 mg / L Rif), and culture it in a shaker at 28℃ and 200 rpm until the OD600 reaches 0.5.

[0034] 1.3 Agrobacterium-mediated transformation of maize

[0035] 1.3.1 Disinfection and sterilization: Add an appropriate amount of corn seeds to a 50.0 mL sterile centrifuge tube, shake for 30 seconds in 75% ethanol, filter, wash 2-3 times with sterile water, and pour out the sterile water. Add 1‰ mercuric chloride (HgCl2) solution to the centrifuge tube, shake gently for 5-10 minutes, and then rinse with sterile water for 5-6 times. Finally, place the sterilized seeds on sterile filter paper for inoculation.

[0036] 1.3.2 Seed germination: The sterilized seeds are inoculated into the pre-prepared MS medium. The seeds germinate in the medium and culture under light at 25°C for about 7 days.

[0037] 1.3.3 Inducing callus: Take the sterile seedlings in the culture bottle, cut off the leaves, cut them into small segments / long strips of about 5.0 mm, inoculate them into callus induction medium, and culture them under light for 3 days.

[0038] 1.3.4 Infection and co-culture: Place corn callus in a 100 mL sterile Erlenmeyer flask, add an appropriate amount of resuspended bacterial solution, and culture at 75 rpm for 10 min at room temperature. Pour off the liquid, dry the corn material, and then inoculate it into the co-culture medium and culture it in the dark at 27°C for 3 days.

[0039] 1.3.5 Screening: After co-cultivation, the callus tissue was transferred to the screening medium and cultured for 45 days, during which the screening medium was changed three times.

[0040] 1.3.6 Recovery: Select sterile callus tissue and inoculate it into recovery medium. Culture it for 30 days, during which time the recovery medium is replaced 2-3 times.

[0041] 1.3.7 Differentiation: After the recovery culture is completed, the callus tissue is transferred to the differentiation medium and cultured at 25℃ under light.

[0042] 1.3.8 Rooting: When the seedlings differentiated from the callus grow to 2-3 cm in height, they are separated from the entire tissue block and inoculated into the rooting medium.

[0043] 1.4 Screening of mutants and identification of genotypes

[0044] The regenerated plants were numbered and leaves were taken to extract the whole genome DNA. The primer pair donorF: CCGATCCCGGGCGACTGGAACG; donorR: AGGGACAAGACACGTACGTAC was used to amplify the DNA sequence where the target site was located. The reaction system was as follows:

[0045] DNA template 100.0-200.0 ng

[0046] 10× Ex Taq buffer 5.0 µL

[0047] 10 mM dNTP 3.0 µL

[0048] ExTaq enzyme 0.4 µL

[0049] donorF1.0 µL

[0050] donorR 1.0 µL

[0051] ddH2O to 50.0 µL

[0052] PCR reaction procedure:

[0053] 95℃ 5 min

[0054] 95℃ 30.0 s

[0055] 56℃ 30.0 s 30 cycles

[0056] 72℃ 30.0 s

[0057] 72℃ 5 min

[0058] The PCR products of each plant were recovered, connected to the pMD 19-T vector, and then commissioned to a sequencing company for Sanger sequencing to identify the plant genotype.

[0059] 1.5 Results

[0060] The pCAMBIA2300-Cas9donor plasmid was co-incubated with Agrobacterium competent cells EHA105, and the plasmid vector was successfully transferred into the competent cells. Agrobacterium containing the target vector was revived and stably expressed in antibiotic-free YM culture medium. After 4 hours of culture, the bacterial solution was evenly applied on the surface of the Kn+ / Rif+ double antibiotic YM plate. The successfully constructed vector contains Kn resistance genes and Rif resistance genes, and can divide normally in the double-antibiotic culture medium. The non-transfected strain lacks antibiotic resistance genes and cannot grow normally in the culture medium. It has been verified that the constructed vector contains the Hpt resistance gene. The results of monoclonal plasmid genome PCR show that the target strain vector contains gRNA and donor genes. The prepared Agrobacterium meets the experimental design requirements and can be used for corn genome infection.

[0061] Five single clones were selected in the Kn+ / Rif+ double-antibody YM medium, and the Agrobacterium plasmid was extracted after subculture. The PCR results showed that the target plasmid contained gRNA and donor genes, and each element was successfully integrated into the target vector and the constructed vector was successfully transferred into the Agrobacterium cells.

[0062] By transforming 1,000 corn callus tissues, a total of 57 regenerated seedlings were obtained. Through gene sequencing, 3 corn seedlings were obtained in which site-directed mutations were successfully introduced and Tyr at position 284 was mutated to Ala.

[0063] Example 3: Detection of protein content in mutant plants

[0064] 1.1 The three maize plants with site-directed mutations in the glutamine synthetase gene were propagated in large quantities through tissue culture, and the maize grains were harvested. Maize plants without mutations cultivated under the same conditions were used as controls.

[0065] 1.2 Take the crushed corn kernel powder and add it to a mortar. Add liquid nitrogen to further grind it into powder. Transfer the ground tissue to an EP tube and add 500 ul of extraction reagent for every 200 mg of plant tissue. Mix well and place on ice for 20 minutes. Invert several times to mix well so that the protein can be dissolved.

[0066] 1.3 Centrifuge at 12000 rpm for 15 minutes, discard the precipitate and collect the protein supernatant.

[0067] 1.4 Take the protein supernatant and test the protein content using the BCA method. Repeat the test 3 times for each sample.

[0068] 1.4.1 Dilute the BSA standard with PBS. See Table 1.

[0069] Table 1 Preparation of standard products

[0070]

[0071] 1.4.2 Preparation of BCA working solution

[0072] 1.4.2.1 Use the following formula to determine the total volume of working fluid required

[0073] (Number of standards + number of samples to be tested) × (number of experimental repetitions) × (volume of working solution for each sample) = total volume of working solution required

[0074] Take 12 samples to be tested as an example:

[0075] (9 standards + 12 samples to be tested) × (2 experimental replicates) × (2.0 ml) = 84 ml working solution

[0076] 1.4.2.2 Mix 90 ml of BCA Reagent A with 1.8 ml of BCA Reagent B (ratio of Reagent A to Reagent B = 50:1) to prepare the working solution.

[0077] 1.4.2.3 Detection

[0078] 1.4.2.3.1 Take 0.1 ml of each dilution concentration of the standard and the sample to be tested and add them into the marked test tubes.

[0079] 1.4.2.3.2 Add 2.0 ml of working solution to each test tube and mix thoroughly.

[0080] 1.4.2.3.3 Seal the test tube and incubate at 37°C for 30 minutes.

[0081] 1.4.2.3.4 Cool all test tubes to room temperature.

[0082] 1.4.2.3.5 Set the spectrophotometer detection wavelength to 562nm and use a cuvette filled with deionized water to zero the instrument. Then, measure the absorbance values ​​of all samples in turn within 10 minutes.

[0083] 1.4.2.3.6 Subtract the average absorbance of the blank standard at 562 nm from the absorbance of each standard and sample at 562 nm.

[0084] 1.4.2.3.7 Plot the blank-corrected absorbance of the standard at 562 nm against its concentration (µg / ml), with concentration as the horizontal axis and absorbance as the vertical axis, draw a standard curve (R2 value should be no less than 0.9900), and obtain a quadratic equation. Substitute the absorbance value of each sample to be tested into the equation to calculate the total protein content.

[0085] 1.5 Results

[0086] from Figure 3 It can be seen that the crude protein content of the grains of the non-mutated corn strain is 14.76%, the crude protein content of the grains of the corn No. 1 mutant strain is 30.37%, the crude protein content of the grains of the corn No. 2 mutant strain is 30.16%, and the crude protein content of the grains of the corn No. 3 mutant strain is 30.44%. The crude protein content of the grains of the No. 3 mutant strain is 106.23% higher than that of the non-mutated strain.

[0087] Example 4: Experiment on the effect of high-protein corn feed on the growth performance of white-feathered broilers

[0088] 1.1 Feed preparation

[0089] Feed 1: 60% corn, 10% wheat bran, 15% soybean meal, 10% fish meal, 1.5% bone meal, 3% yeast powder, 0.5% salt. The formulated feed raw materials are mixed in a mixer, dried, crushed in a grinder, and granulated.

[0090] Feed 2: 75% non-mutated corn, 10% wheat bran, 10% fish meal, 1.5% bone meal, 3% yeast powder, and 0.5% salt. The formulated feed ingredients are mixed in a mixer, dried, crushed in a grinder, and granulated.

[0091] Feed three: high-protein corn (mutant strain No. 3) 75%, wheat bran 10%, fish meal 10%, bone meal 1.5%, yeast powder 3%, salt 0.5%. The proportioned feed raw materials are mixed in a mixer, dried, crushed in a grinder, and granulated.

[0092] 1.2 Animal testing

[0093] (1) 300 one-day-old healthy white-feathered broiler chickens were randomly divided into three groups, 100 chickens in each group, and raised in isolation;

[0094] (2) The chickens were fed once at 8:00 and 16:00 every day, and were allowed to eat and drink freely. The experimental period was 40 days. During the feeding period, the immunization and feeding management were carried out according to the conventional immunization procedures for white-feathered broilers. At the end of the experiment, the feed-to-meat ratio of the experimental chickens was calculated.

[0095] Table 2 Experimental study on the effect of high-protein corn feed on the growth performance of white-feathered broilers

[0096] Grouping Main nitrogen source Feed to meat ratio Feed 1 Soybean meal 1.84:1 Feed 2 Non-mutated corn 2.37:1 Feed three High protein corn 1.85:1

[0097] As can be seen from Table 2, the feed prepared by replacing soybean meal with non-mutated corn has a higher feed-to-meat ratio of 2.37:1 for white-feathered broilers. The feed prepared by replacing soybean meal with high-protein corn has a feed-to-meat ratio of 1.85:1 for white-feathered broilers, which is close to the feed with soybean meal as the main nitrogen source. The feed-to-meat ratio of the glutamine synthetase mutant corn constructed by the present invention is 21.94% lower than that of the non-mutated corn. The high-protein corn can be used as a soybean meal substitute to prepare feed.

Claims

1. A use of high-protein corn as a soybean meal substitute in feed, characterized in that: The high-protein corn is corn with site-directed mutation of glutamine synthetase, and the amino acid sequence of the glutamine synthetase after site-directed mutation is SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The high-protein corn can be used as a soybean meal substitute for feed preparation.

3. The use according to claim 1, characterized in that: The preparation method of the feed is as follows: 75% high-protein corn, 10% wheat bran, 10% fish meal, 1.5% bone meal, 3% yeast powder, and 0.5% salt; the proportioned feed raw materials are stirred and mixed by a mixer, dried, crushed by a grinder, and granulated.

4. A corn glutamine synthetase mutant, characterized in that: The amino acid sequence of the corn glutamine synthetase mutant is SEQ ID NO.

1.

5. A gRNA for constructing a corn site-directed mutation of glutamine synthetase as described in claim 1, characterized in that: The nucleotide sequence of the gRNA is SEQ ID NO.

2.

6. A donor for constructing a corn with a site-directed mutation of glutamine synthetase as claimed in claim 1, characterized in that: The nucleotide sequence of the donor is SEQ ID NO.3.

Images