A biopolysaccharide that synergistically promotes the expression of ceramide synthase and / or hyaluronic acid synthase and its application

Abstract

The present invention provides a biopolysaccharide that synergistically promotes the expression of ceramide synthase and / or hyaluronic acid synthase and its application, belonging to the technical field of traditional Chinese medicine. The biopolysaccharide is prepared from polygonatum and yam as raw materials through alternating enzymatic hydrolysis, extraction, impurity removal, molecular interception, compounding and other processes to promote the expression of ceramide synthase. The polysaccharide also promotes the expression of hyaluronic acid synthase and can be used in external preparations for the treatment and prevention of dryness, itching and skin barrier defects caused by weakened expression of ceramide synthase and hyaluronic acid synthase.

Description

Technical Field

[0001] The invention belongs to the technical field of traditional Chinese medicine polysaccharides, and specifically relates to a biological polysaccharide that synergistically promotes the expression of ceramide synthase and / or hyaluronic acid synthase and an application thereof. Background Art

[0002] Ceramide is the main component of intercellular lipids in the skin barrier - the stratum corneum, accounting for about 50% of intercellular lipids. Ceramide and proteins on the surface of skin keratinocytes are linked by ester bonds to play the role of bonding cells. The lack of ceramide will lead to a decrease in the adhesion between keratinocytes, resulting in dry skin, desquamation, and scaly skin, which will further cause symptoms such as skin itching. Ceramide in the skin is endogenously regulated through complex metabolic pathways, and its content in the skin is mainly controlled by its synthase and decomposition enzyme, among which the key influencing factor is endogenous synthesis. The key to its endogenous speed lies in ceramide synthase, which has six subtypes, each of which has the ability to synthesize ceramides with different acyl chain lengths. Among them, ceramide synthase 2 (CerS2) is the most widely expressed gene in the CerS family and is the key rate-limiting enzyme affecting ceramide synthesis.

[0003] Hyaluronic acid is an important component of the natural moisturizing factor (NMF) contained in human skin. It is an acidic mucopolysaccharide. Hyaluronic acid has excellent water retention and is the best moisturizing substance found in nature. The maturation and aging process of human skin also changes with the content and metabolism of hyaluronic acid. The lack of hyaluronic acid in the skin will make the skin dry, rough, loose, wrinkled, etc. On the contrary, the fullness of hyaluronic acid will make the skin tender, smooth, elastic, etc. The content of hyaluronic acid in the skin is affected by its synthase and decomposition enzyme, especially by its synthase. Hyaluronan synthase (Hyaluronan synthase HAS) is a key rate-limiting enzyme in the synthesis process of hyaluronic acid. HAS can catalyze the synthesis of a considerable level of hyaluronic acid and supplement the hyaluronic acid in different stages and parts of the human body.

[0004] Chinese invention patent application CN110833516A discloses a polypeptide composition with moisturizing and hydrating effects, which contains a polypeptide that can increase the content of aquaporin 3, a polypeptide that can promote the production of hyaluronic acid or / and collagen, the polypeptide composition can be added with a natural moisturizing factor, and the polypeptide composition can further be added with trehalose or / and a polysaccharide moisturizer. The polypeptide composition of the present invention acts on different targets through the compounding of different active ingredients, exerts a synergistic effect in all directions, and can achieve excellent moisturizing and hydrating effects. However, the invention patent contains a large amount of chemical component polypeptides, which not only increases the cost of the product, but also requires high storage conditions for the product. French invention patent application FR2984154A1 discloses the use of active ingredients extracted from panicum miliaceum fibers as cosmetic active raw materials for improving and / or repairing skin barrier function. However, its effect needs to be further improved.

[0005] Therefore, there is an urgent need to provide a pure Chinese medicine preparation with low cost and good effect for promoting the expression of ceramide synthase and / or hyaluronic acid synthase. Summary of the invention

[0006] The present invention aims at the problems existing in the prior art and provides a biopolysaccharide that synergistically promotes the expression of ceramide synthase and / or hyaluronic acid synthase and its application. The biopolysaccharide suitable for promoting the expression of ceramide synthase is prepared by alternate enzymatic hydrolysis, extraction, impurity removal, molecular interception, compounding and other processes of Chinese medicinal materials yam and polygonatum, and the polysaccharide also has the function of promoting the expression of hyaluronic acid synthase, and can be used in external preparations for treating and preventing dryness, itching and skin barrier defects caused by weakened expression of ceramide synthase and hyaluronic acid synthase.

[0007] The first aspect of the present invention is to provide a biopolysaccharide that synergistically promotes the expression of ceramide synthase and / or hyaluronic acid synthase, wherein the biopolysaccharide is prepared by the following steps:

[0008] (1) Adding water to the medicinal materials of polygonatum odoratum and yam, enzymolysis with cellulase and mannanase, extraction and filtration to obtain filtrate I and medicinal residues;

[0009] (2) adding water to the medicinal residue in step (1), and enzymolyzing with cellulase and mannanase in sequence, extracting and filtering to obtain filtrate II;

[0010] (3) combining filtrate I and filtrate II, cutting off the portion with a molecular weight less than 3000 Daltons, and concentrating the portion through a 300 Dalton membrane concentration device to obtain a biopolysaccharide concentrate;

[0011] (4) Drying the biopolysaccharide concentrate to obtain the product.

[0012] Preferably, in step (1), the mass ratio of Polygonatum odoratum to Dioscorea opposita is 1:9-9:1, preferably 3:7.

[0013] Preferably, the mass of water added in step (1) is 8-15 times the mass of the medicinal material.

[0014] Preferably, in step (1), the mass of cellulase added is 0.5-2% of the mass of the medicinal material, the enzymolysis temperature is 50-70° C., and the enzymolysis time is 30-60 minutes.

[0015] Preferably, in step (1), the mass of mannanase added is 0.5-2% of the mass of the medicinal material, the enzymolysis temperature is 50-70° C., and the enzymolysis time is 10-15 minutes.

[0016] Preferably, in step (1), the extraction temperature is above 95° C. and the extraction time is 30-60 minutes.

[0017] Preferably, the mass of water added in step (2) is 5-10 times the mass of the medicinal material.

[0018] Preferably, in step (2), the mass of cellulase added is 0.5-2% of the mass of the medicinal material, the enzymolysis temperature is 50-70° C., and the enzymolysis time is 30-60 minutes.

[0019] Preferably, in step (2), the mass of mannanase added is 0.5-2% of the mass of the medicinal material, the enzymolysis temperature is 50-70° C., and the enzymolysis time is 10-15 minutes.

[0020] Preferably, in step (2), the extraction temperature is above 95° C. and the extraction time is 30-60 minutes.

[0021] Preferably, in step (3), the concentration is to reach 80% of the weight of the input medicinal material.

[0022] Preferably, the drying in step (4) is reduced pressure drying or freeze drying.

[0023] Preferably, in the step (4), the biopolysaccharide concentrate is not subjected to low-temperature drying, but is directly prepared into a solution with an equal weight to the medicinal material, by adding one or two of butylene glycol, propylene glycol, glycerol, and dipropylene glycol to a mass content of 5%, adding a preservative, and supplementing with deionized water to an equal weight to the medicinal material.

[0024] More preferably, the preservative is at least one of 1,2-hexanediol and p-hydroxyacetophenone. The added mass of the 1,2-hexanediol is 0.5-3%, preferably 0.5%; the added mass of the p-hydroxyacetophenone is 0.1-1%, preferably 0.5%.

[0025] The second aspect of the present invention relates to the use of the above-mentioned biopolysaccharide in the preparation of a drug for treating and / or preventing ceramide and / or hyaluronic acid deficiency.

[0026] Preferably, the drug is an external preparation.

[0027] Polygonatum odoratum, the dried rhizome of Polygonatum odoratum (Mill.) Druce, has the effects of nourishing yin and moistening dryness, promoting body fluid and quenching thirst. Modern research shows that Polygonatum odoratum has good antioxidant, hypoglycemic, anti-tumor, immune regulation and antibacterial effects.

[0028] Chinese yam, also known as Huai yam, Huai yam, and earth potato, is a Chinese medicinal material. It is the tuber of the Dioscorea plant, which has the effects of strengthening the spleen and lungs, benefiting the stomach and kidneys, strengthening the kidneys and improving essence, improving hearing and eyesight, helping the five internal organs, strengthening muscles and bones, improving will and calming the mind, and prolonging life. Modern research shows that Chinese yam has good immune regulation, blood sugar lowering, anti-aging, lipid-lowering, anti-inflammatory and antibacterial effects.

[0029] Compared with the prior art, the present invention has the following beneficial effects: by subjecting yam and polygonatum to alternating enzymatic hydrolysis, extraction, impurity removal, molecular interception and compounding processes using cellulase and mannanase, a biopolysaccharide with a molecular weight of 300-3000 suitable for promoting the expression of ceramide synthase is prepared. The polysaccharide also has the function of promoting the expression of hyaluronic acid synthase, and can be used in external preparations for treating and preventing dryness, itching and skin barrier defects caused by weakened expression of ceramide synthase and hyaluronic acid synthase. DETAILED DESCRIPTION

[0030] The following non-limiting examples can enable those skilled in the art to more fully understand the present invention, but do not limit the present invention in any way. The following content is merely an exemplary description of the scope of the present invention, and those skilled in the art can make various changes and modifications to the present invention based on the disclosed content, which should also fall within the scope of the present invention.

[0031] Example 1

[0032] The preparation steps of biopolysaccharide are as follows:

[0033] (1) Add 3 parts of Polygonatum odoratum and 7 parts of Dioscorea opposita to 8 times the amount of water in the amount of medicinal materials, add 0.5% cellulase in the amount of medicinal materials, and perform enzymolysis at 50°C for 60 minutes, add 0.5% mannanase in the amount of medicinal materials, and perform enzymolysis at 50°C for 15 minutes, heat to above 95°C, extract for 30 minutes, filter with gauze, and obtain filtrate I and medicinal residue;

[0034] (2) adding 10 times the amount of water as the medicinal material to the medicinal residue of step (1), adding 0.5% of cellulase as the medicinal material, enzymolysis at 50° C. for 60 minutes, adding 0.5% of mannanase as the medicinal material, enzymolysis at 50° C. for 15 minutes, heating to above 95° C. for extraction for 30 minutes, filtering with gauze to obtain filtrate II;

[0035] (3) Filtrate I and filtrate II are combined, filtered until clear, and passed through a molecular interception device to intercept a portion with a molecular weight less than 3,000 Daltons. The portion is concentrated to 80% of the weight of the input medicinal materials through a 300 Dalton membrane concentration device, and freeze-dried to obtain biopolysaccharide with a yield of 32.6%.

[0036] Example 2

[0037] The preparation steps of biopolysaccharide are as follows:

[0038] (1) Add 1 part of Polygonatum odoratum and 9 parts of Dioscorea opposita to 12 times the amount of water in the medicinal materials, add 1% of cellulase in the amount of the medicinal materials, and perform enzymatic hydrolysis at 70°C for 30 minutes, add 1% of mannanase in the amount of the medicinal materials, and perform enzymatic hydrolysis at 70°C for 10 minutes, heat to above 95°C, extract for 60 minutes, filter with gauze, and obtain filtrate I and medicinal residue;

[0039] (2) adding 8 times the amount of water as the medicinal material to the medicinal residue of step (1), adding 1% of cellulase as the medicinal material, enzymolysis at 70° C. for 30 minutes, adding 1% of mannanase as the medicinal material, enzymolysis at 70° C. for 10 minutes, heating to above 95° C. for extraction for 30 minutes, filtering with gauze to obtain filtrate II;

[0040] (3) Filtrate I and filtrate II are combined, filtered until clear, and passed through a molecular interception device to intercept a portion with a molecular weight less than 3,000 Daltons. The portion is concentrated to 80% of the weight of the input medicinal material through a 300 Dalton membrane concentration device, and freeze-dried to obtain biopolysaccharide with a yield of 29.3%.

[0041] Example 3

[0042] The preparation steps of biopolysaccharide are as follows:

[0043] (1) Add 9 parts of Polygonatum odoratum and 1 part of Dioscorea opposita to 15 times the amount of water in the amount of medicinal materials, add 2% cellulase in the amount of medicinal materials, enzymatically hydrolyze at 60°C for 45 minutes, add 2% mannanase in the amount of medicinal materials, enzymatically hydrolyze at 60°C for 10 minutes, heat to above 95°C, extract for 45 minutes, filter with gauze, and obtain filtrate I and medicinal residue;

[0044] (2) adding 5 times the amount of water as the medicinal material to the medicinal residue of step (1), adding 2% of cellulase as the medicinal material, enzymolysis at 60° C. for 45 minutes, adding 2% of mannanase as the medicinal material, enzymolysis at 60° C. for 10 minutes, heating to above 95° C. for extraction for 45 minutes, filtering with gauze to obtain filtrate II;

[0045] (3) Filtrate I and filtrate II are combined, filtered until clear, and passed through a molecular interception device to intercept a portion with a molecular weight less than 3,000 Daltons. The portion is concentrated to 80% of the weight of the input medicinal material through a 300 Dalton membrane concentration device, and freeze-dried to obtain biopolysaccharide with a yield of 33.9%.

[0046] Example 4

[0047] The preparation steps of biopolysaccharide are as follows:

[0048] (1) Add 3 parts of Polygonatum odoratum and 7 parts of Dioscorea opposita to 8 times the amount of water in the medicinal materials, add 0.5% cellulase in the amount of the medicinal materials, and perform enzymatic hydrolysis at 50°C for 60 minutes, add 0.5% mannanase in the amount of the medicinal materials, and perform enzymatic hydrolysis at 50°C for 15 minutes, heat to above 95°C, extract for 30 minutes, filter with gauze, and obtain filtrate I and medicinal residue;

[0049] (2) adding 10 times the amount of water as the medicinal material to the medicinal residue of step (1), adding 0.5% of cellulase as the medicinal material, enzymolysis at 50° C. for 60 minutes, adding 0.5% of mannanase as the medicinal material, enzymolysis at 50° C. for 15 minutes, heating to above 95° C. for extraction for 30 minutes, filtering with gauze to obtain filtrate II;

[0050] (3) Filtrate I and filtrate II are combined, filtered until clear, and passed through a molecular interception device to intercept a portion with a molecular weight of less than 3,000 Daltons. The portion is concentrated to 80% of the weight of the input medicinal material through a 300 Dalton membrane concentration device, butanediol is added to a content of 5%, 1,2-hexanediol to 0.5%, and p-hydroxyacetophenone to 0.5%, and water is added to the amount of the medicinal material to obtain a biopolysaccharide solution.

[0051] Comparative Example 1

[0052] The preparation steps of biopolysaccharide are as follows:

[0053] (1) Add 8 times the amount of water to the medicinal material Polygonatum odoratum, add 0.5% of cellulase to the medicinal material, perform enzymolysis at 50°C for 60 minutes, add 0.5% of mannanase to the medicinal material, perform enzymolysis at 50°C for 15 minutes, heat to above 95°C for extraction for 30 minutes, filter with gauze, and obtain filtrate I and medicinal residue;

[0054] (2) adding 10 times the amount of water as the medicinal material to the medicinal residue of step (1), adding 0.5% of cellulase as the medicinal material, enzymolysis at 50° C. for 60 minutes, adding 0.5% of mannanase as the medicinal material, enzymolysis for 15 minutes, heating to above 95° C. for extraction for 30 minutes, filtering with gauze to obtain filtrate II;

[0055] (3) Filtrate I and filtrate II are combined, filtered until clear, and passed through a molecular interception device to intercept a portion with a molecular weight less than 3,000 Daltons. The portion is concentrated to 80% of the weight of the input medicinal materials through a 300 Dalton membrane concentration device, and freeze-dried to obtain Polygonatum odoratum biopolysaccharide with a yield of 34.7%.

[0056] Comparative Example 2

[0057] The preparation steps of biopolysaccharide are as follows:

[0058] (1) adding 8 times the amount of water as the medicinal material to the medicinal material yam, adding 0.5% of cellulase as the medicinal material, enzymolysis at 50° C. for 60 minutes, adding 0.5% of mannanase as the medicinal material, enzymolysis at 50° C. for 15 minutes, heating to above 95° C. for extraction for 30 minutes, filtering with gauze, and obtaining filtrate I and medicinal residues;

[0059] (2) adding 10 times the amount of water as the medicinal material to the medicinal residue of step (1), adding 0.5% of cellulase as the medicinal material, enzymolysis at 50° C. for 60 minutes, adding 0.5% of mannanase as the medicinal material, enzymolysis for 15 minutes, heating to above 95° C. for extraction for 30 minutes, filtering with gauze to obtain filtrate II;

[0060] (3) Filtrate I and filtrate II are combined, filtered until clear, and passed through a molecular interception device to intercept a portion with a molecular weight less than 3000 Daltons. The portion is concentrated to 80% of the weight of the input medicinal materials through a 300 Dalton membrane concentration device, and freeze-dried to obtain yam biopolysaccharide with a yield of 31.3%.

[0061] Comparative Example 3

[0062] The preparation steps of biopolysaccharide are as follows:

[0063] (1) Add 3 parts of Polygonatum odoratum and 7 parts of Dioscorea opposita to 8 times the amount of water, heat to above 95°C, extract for 30 minutes, filter with gauze, and obtain filtrate I and residue;

[0064] (2) adding 10 times the amount of water as the medicinal material to the residue of step (1), heating to above 95° C., extracting for 30 minutes, filtering with gauze, and obtaining filtrate II;

[0065] (3) Filtrate I and filtrate II were combined, filtered until clear, and passed through a molecular interception device to intercept a portion with a molecular weight less than 3,000 Daltons. The portion was concentrated to 80% of the weight of the input medicinal materials through a 300 Dalton membrane concentration device, and freeze-dried to obtain biopolysaccharide with a yield of 12.2%.

[0066] Comparative Example 4

[0067] The preparation steps of biopolysaccharide are as follows:

[0068] (1) Add 3 parts of Polygonatum odoratum and 7 parts of Dioscorea opposita to 8 times the amount of water, add 0.5% cellulase in the amount of the medicinal materials, perform enzymolysis at 50°C for 60 minutes, heat to above 95°C for extraction for 30 minutes, filter through gauze, and obtain filtrate I and medicinal residues;

[0069] (2) adding 10 times the amount of water as the medicinal material to the medicinal residue of step (1), adding 0.5% cellulase as the medicinal material, performing enzymatic hydrolysis at 50° C. for 60 minutes, heating to above 95° C. for extraction for 30 minutes, filtering with gauze, and obtaining filtrate II;

[0070] (3) Filtrate I and filtrate II are combined, filtered until clear, and passed through a molecular interception device to intercept a portion with a molecular weight less than 3,000 Daltons. The portion is concentrated to 80% of the weight of the input medicinal material through a 300 Dalton membrane concentration device, and freeze-dried to obtain biopolysaccharide with a yield of 23.5%.

[0071] Comparative Example 5

[0072] The preparation steps of biopolysaccharide are as follows:

[0073] (1) Add 3 parts of Polygonatum odoratum and 7 parts of Dioscorea opposita to 8 times the amount of water in the amount of the medicinal materials, add 0.5% mannanase in the amount of the medicinal materials, perform enzymolysis at 50°C for 15 minutes, heat to above 95°C for extraction for 30 minutes, filter through gauze, and obtain filtrate I and medicinal residue;

[0074] (2) adding 10 times the amount of water as the medicinal material to the medicinal residue of step (1), adding 0.5% mannanase as the medicinal material, performing enzymatic hydrolysis at 50° C. for 15 minutes, heating to above 95° C. for extraction for 30 minutes, filtering with gauze, and obtaining filtrate II;

[0075] (3) Filtrate I and filtrate II are combined, filtered until clear, and passed through a molecular interception device to intercept a portion with a molecular weight less than 3,000 Daltons. The portion is concentrated to 80% of the weight of the input medicinal materials through a 300 Dalton membrane concentration device, and freeze-dried to obtain biopolysaccharides with a yield of 22.6%.

[0076] Comparative Example 6

[0077] The preparation steps of biopolysaccharide are as follows:

[0078] (1) 3 parts of Polygonatum odoratum and 7 parts of Dioscorea opposita were added to 8 times the amount of water in the amount of the medicinal materials, and 0.5% of cellulase and 0.5% of mannanase in the amount of the medicinal materials were added, and the mixture was enzymolyzed at 50° C. for 60 minutes, and then heated to above 95° C. for extraction for 30 minutes, and filtered through gauze to obtain filtrate I and medicinal residues;

[0079] (2) adding 10 times the amount of water as the medicinal material to the medicinal residue of step (1), adding 0.5% cellulase and 0.5% mannanase as the medicinal material, performing enzymatic hydrolysis at 50° C. for 60 minutes, heating to above 95° C. for extraction for 30 minutes, filtering with gauze to obtain filtrate II;

[0080] (3) Filtrate I and filtrate II are combined, filtered until clear, and passed through a molecular interception device to intercept a portion with a molecular weight less than 3,000 Daltons. The portion is concentrated to 80% of the weight of the input medicinal material through a 300 Dalton membrane concentration device, and freeze-dried to obtain biopolysaccharide with a yield of 29.3%.

[0081] Comparative Example 7

[0082] The preparation steps of biopolysaccharide are as follows:

[0083] (1) Add 3 parts of Polygonatum odoratum and 7 parts of Dioscorea opposita to 8 times the amount of water in the amount of medicinal materials, add 0.5% cellulase in the amount of medicinal materials, and perform enzymolysis at 50°C for 60 minutes, add 0.5% mannanase in the amount of medicinal materials, and perform enzymolysis at 50°C for 15 minutes, heat to above 95°C, extract for 30 minutes, filter with gauze, and obtain filtrate I and medicinal residue;

[0084] (2) adding 10 times the amount of water as the medicinal material to the medicinal residue of step (1), adding 0.5% of cellulase as the medicinal material, enzymolysis at 50° C. for 60 minutes, adding 0.5% of mannanase as the medicinal material, enzymolysis for 15 minutes, heating to above 95° C. for extraction for 30 minutes, filtering with gauze to obtain filtrate II;

[0085] (3) Filtrate I and filtrate II are combined, filtered until clear, concentrated to 80% of the weight of the input medicinal materials, and freeze-dried to obtain biopolysaccharide with a yield of 41.5%.

[0086] Comparative Example 8

[0087] The preparation steps of biopolysaccharide are as follows:

[0088] (1) Add 3 parts of Polygonatum odoratum and 7 parts of Dioscorea opposita to 8 times the amount of water, heat to above 95°C, extract for 30 minutes, filter with gauze, and obtain filtrate I and residue;

[0089] (2) adding 10 times the amount of water as the medicinal material to the medicinal residue in step (1), filtering through gauze to obtain filtrate II;

[0090] (3) Combine filtrate I and filtrate II, filter until clear, concentrate to the amount of medicinal material, add 5 times the amount of 95% ethanol, and let stand at 4°C overnight;

[0091] (4) centrifugation to obtain the precipitate, adding 15 times the amount of water as the medicinal material, dissolving until clear, adding 0.5% cellulase as the medicinal material, enzymatic hydrolysis at 50°C for 60 minutes, adding 0.5% mannanase as the medicinal material, enzymatic hydrolysis for 15 minutes, and heating to above 95°C for 30 minutes to inactivate the enzyme;

[0092] (5) After the filtrate is filtered until it is clarified, it is passed through a molecular interception device to intercept the portion with a molecular weight less than 3000 Daltons, and is concentrated to 80% of the weight of the input medicinal materials through a 300 Dalton membrane concentration device, and then freeze-dried to obtain biopolysaccharides with a yield of 26.7%.

[0093] Test Example 1

[0094] 1 Materials and methods

[0095] 1.1 Main Reagents

[0096] Reagents: DMEM culture medium, fetal bovine serum (FBS), T25 cell culture flasks, and 96-well plates were purchased from Corning; cell counting kit (cck)-8 was purchased from Dojindo Molecular Technologies; phosphate buffered saline (PBS, 1X) was purchased from Beyotime; trypsin, total RNA extraction reagent (Trizol), chloroform, isopropanol, ethanol, DEPC water, PrimeScriptTMRTMaster Mix (Takara), TB Green Premix Ex TaqTMⅡ (Takara), and primers related to each gene.

[0097] 1.2 Cell lines and cell culture

[0098] Cell lines used: Human immortalized keratinocytes HaCaT were derived from Shanghai Dermatology Hospital. HaCaT cells were cultured in a cell culture incubator (5% CO2, 37°C) using DMEM+10% FBS medium.

[0099] 1.3 Effects of the test samples on the expression of relevant barrier genes

[0100] 20w HaCaT cells were seeded in a 6-well plate per well. After culturing for 24 hours, culture medium or 2 mL of the sample solution to be tested was added and incubated for another 24 hours. Total RNA of HaCaT cells was extracted and reverse transcription reaction was performed according to the instructions of the kit.

[0101] Detected genes: hyaluronan synthase (HAS1) and ceramide synthase (CerS2).

[0102] Table 1 Primer list

[0103] Primer Name Sequence (5' to 3') Human - HAS1 - S CTGCGATACTGGGTAGCCTTCAATG(Seq_1) Human - HAS1 - A TGTACCTAGAGGACCGCTGATGC(Seq_2) Human - CERS2 - S GCCTTGCTCTTCCTCATCGTTCG(Seq_3) Human - CERS2 - A GCCACTGGTCAGGTAGAAATGTTCC(Seq_4)

[0104] 1.4 Effects of each sample on HaCaT cells on the expression of detected genes

[0105] Table 2 Effects of each sample on the mRNA expression of hyaluronan synthase and ceramide synthase

[0106]

[0107]

[0108]

[0109] According to Table 2, embodiments 1-4 and comparative examples 1-8 have good promoting effects on hyaluronic acid synthase and ceramide synthase mRNA expression. At the same time, the effect of embodiment 1-4 is obviously better than comparative example 1-2, and the effect of polygonatum and yam after compound use is obviously better than the effect of single flavor plants, and has good synergistic effect. According to the results of comparative examples 3-6, 8 and embodiment 1, the addition and addition order of cellulase and mannanase have a greater impact on hyaluronic acid synthase and ceramide synthase mRNA expression, which may be related to the molecular weight of the sugar extracted therefrom, and the sugar with a smaller molecular weight has good biological activity. According to the results of comparative example 7 and embodiment 1, the sugar with a molecular weight of 300-3000 has good biological activity.

[0110] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. A biopolysaccharide that synergistically promotes the expression of ceramide synthase and / or hyaluronic acid synthase, characterized in that: The biopolysaccharide is prepared by the following steps: (1) Add water to the medicinal materials Polygonatum odoratum and Dioscorea opposita, and successively hydrolyze them with cellulase and mannanase, extract and filter to obtain filtrate I and medicinal residue; (2) adding water to the medicinal residue in step (1), and successively hydrolyzing with cellulase and mannanase, extracting and filtering to obtain filtrate II; (3) combining filtrate I and filtrate II, cutting off the portion with a molecular weight less than 3000 Daltons, and concentrating the portion through a 300 Dalton membrane concentration device to obtain a biopolysaccharide concentrate; (4) Drying the biopolysaccharide concentrate to obtain; In the step (1), the mass of water added is 8-15 times the mass of the medicinal material, the mass of cellulase added is 0.5-2% of the mass of the medicinal material, the enzymolysis temperature is 50-70°C, the enzymolysis time is 30-60 minutes, the mass of mannanase added is 0.5-2% of the mass of the medicinal material, the enzymolysis temperature is 50-70°C, the enzymolysis time is 10-15 minutes, and the mass ratio of polygonatum odoratum to yam is 1:9-9:1; In the step (2), the mass of water added is 5-10 times the mass of the medicinal material, the mass of cellulase added is 0.5-2% of the mass of the medicinal material, the enzymatic hydrolysis temperature is 50-70°C, the enzymatic hydrolysis time is 30-60 minutes, the mass of mannanase added is 0.5-2% of the mass of the medicinal material, the enzymatic hydrolysis temperature is 50-70°C, and the enzymatic hydrolysis time is 10-15 minutes.

2. The biopolysaccharide according to claim 1, characterized in that In the step (1) and the step (2), the extraction temperature is independently selected from above 95° C., and the extraction time is independently selected from 30-60 minutes.

3. The biopolysaccharide according to claim 1, characterized in that: The concentration in step (3) is to concentrate to 80% of the quality of the medicinal material.

4. The biopolysaccharide according to claim 1, characterized in that The drying in step (4) is reduced pressure drying or freeze drying.

5. The biopolysaccharide according to claim 1, characterized in that: In the step (4), the biopolysaccharide concentrate is not subjected to low-temperature drying, but is directly prepared into a solution with an equal weight to the medicinal material, wherein one or two of butylene glycol, propylene glycol, glycerol and dipropylene glycol are added to a weight content of 5%, a preservative is added, and deionized water is added to an equal weight to the medicinal material.

6. The biopolysaccharide according to claim 5, characterized in that: The preservative is at least one of 1,2-hexanediol and p-hydroxyacetophenone; the added mass of the 1,2-hexanediol is 0.5-3%; the added mass of the p-hydroxyacetophenone is 0.1-1%.

7. Use of the biopolysaccharide according to any one of claims 1 to 6 in the preparation of an external preparation for treating and / or preventing ceramide and / or hyaluronic acid deficiency.

Images