Application of Bna-miRNA397a in regulating plant cold resistance and low temperature adaptation

Abstract

The present invention relates to the field of plant genetic engineering, and in particular to the application of Bna-miRNA397a in regulating plant cold resistance and low-temperature adaptability. The present invention discovered a miRNA related to rapeseed cold resistance, Bna-miRNA397a. Bna-miRNA397a can regulate the cold resistance and low-temperature adaptability of plants. Overexpression of Bna-miRNA397a can enhance the cold resistance and low-temperature adaptability of transgenic plants; inhibiting the expression of Bna-miRNA397a reduces the cold resistance and low-temperature adaptability of transgenic plants. Therefore, Bna-miRNA397a can be used in plant breeding, and the present invention provides a new direction for plant breeding.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, in particular to the application of Bna-miRNA397a in regulating plant cold resistance and low temperature adaptability. Background Art

[0002] During the promotion of the multiple-cropping system for rice-oil rapeseed, rapeseed production faces challenges such as tight crop rotation, difficulty germinating rapeseed due to late sowing and low temperatures, weak growth due to reduced temperature and light resources, and significant damage to seedlings caused by low temperatures. Growth temperature is a key factor affecting rapeseed seedling growth, photosynthetic efficiency, and yield. Winter rapeseed, however, experiences a decrease in effective accumulated temperature, slowing plant growth and making it susceptible to low-temperature damage, which in turn leads to weakened crop photosynthesis, slower biomass accumulation, and reduced yield. The cold resistance of rapeseed varieties is directly related to their ability to safely survive the winter and limits their cultivation range. Therefore, the creation of specific cold-resistant rapeseed germplasm is crucial for breeding cold-resistant rapeseed. Summary of the Invention

[0003] The present invention aims to provide a method for regulating plant cold resistance and low-temperature adaptability using Bna-miRNA397a, thereby overcoming the problems of the prior art. Overexpression of Bna-miRNA397a can improve plant cold resistance and low-temperature adaptability, which is of great significance for improving cold-resistant rapeseed varieties.

[0004] To achieve the above object, the present invention provides the following solutions:

[0005] The present invention provides the use of Bna-miRNA397a or a biological material containing the precursor sequence of Bna-miRNA397a in regulating plant cold resistance. The nucleotide sequence of Bna-miRNA397a is shown as SEQ ID NO.2; the nucleotide sequence of the precursor sequence of Bna-miRNA397a is shown as SEQ ID NO.1.

[0006] Preferably, the effect of enhancing the cold tolerance of plants is achieved by overexpressing the Bna-miRNA397a in plants; and the effect of reducing the cold tolerance of plants is achieved by inhibiting the expression of the Bna-miRNA397a in plants.

[0007] Preferably, the biological material includes a recombinant plasmid or a recombinant bacterium.

[0008] Further preferably, the plant is rapeseed.

[0009] The present invention provides the use of Bna-miRNA397a or a biological material containing the precursor sequence of Bna-miRNA397a in regulating the low temperature adaptability of plants. The nucleotide sequence of Bna-miRNA397a is shown as SEQ ID NO.2; the nucleotide sequence of the precursor sequence of Bna-miRNA397a is shown as SEQ ID NO.1.

[0010] Preferably, by overexpressing the Bna-miRNA397a in the plant, the effect of improving the low temperature adaptability of the plant is achieved; by inhibiting the expression of the Bna-miRNA397a in the plant, the effect of weakening the low temperature adaptability of the plant is achieved.

[0011] Preferably, the biological material includes a recombinant plasmid or a recombinant bacterium.

[0012] Further preferably, the plant is rapeseed.

[0013] The present invention provides the use of Bna-miRNA397a or a biological material containing the precursor sequence of Bna-miRNA397a in cultivating cold-resistant plants. The nucleotide sequence of Bna-miRNA397a is shown as SEQ ID NO.2; the nucleotide sequence of the precursor sequence of Bna-miRNA397a is shown as SEQ ID NO.1.

[0014] Further preferably, the plant is rapeseed.

[0015] The present invention provides a method for cultivating cold-resistant plants, comprising the step of enhancing the cold resistance of the plants by overexpressing Bna-miRNA397a in the plants; the nucleotide sequence of the Bna-miRNA397a is shown in SEQ ID NO.2.

[0016] Further preferably, the plant is rapeseed.

[0017] The present invention provides the use of Bna-miRNA397a or a biological material containing the precursor sequence of Bna-miRNA397a in cultivating plants with strong low-temperature adaptability. The nucleotide sequence of Bna-miRNA397a is shown as SEQ ID NO.2; the nucleotide sequence of the precursor sequence of Bna-miRNA397a is shown as SEQ ID NO.1.

[0018] Further preferably, the plant is rapeseed.

[0019] The present invention provides a method for cultivating plants with strong low-temperature adaptability, comprising the step of improving the low-temperature adaptability of the plants by overexpressing Bna-miRNA397a in the plants; the nucleotide sequence of the Bna-miRNA397a is shown in SEQ ID NO.2.

[0020] Further preferably, the plant is rapeseed.

[0021] The present invention discloses the following technical effects:

[0022] This study discovered a miRNA, Bna-miRNA397a, that is associated with rapeseed's cold tolerance. Bna-miRNA397a regulates the plant's cold tolerance and low-temperature adaptability. Overexpression of Bna-miRNA397a enhances cold tolerance and low-temperature adaptability in transgenic plants, while inhibition of Bna-miRNA397a expression reduces these traits. This suggests that Bna-miRNA397a can be applied to plant breeding, and this study provides a new direction for plant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 The first lane is the marker, and the second lane is the precursor sequence of Bna-miRNA397A used for overexpression vector construction.

[0025] Figure 2 Figures 1 and 2 show the expression analysis of Bna-miRNA397a in wild-type rapeseed and overexpressing transgenic rapeseed (A), the expression analysis of Bna-miRNA397a in wild-type rapeseed and suppressed expression transgenic rapeseed (B), and the legends for A and B (C); Zhongshuang 6 is the low-temperature-sensitive material Zhongshuang 6, Bna-miRNA397a-OE1, Bna-miRNA397a-OE2, and Bna-miRNA397a-OE3 are three independent overexpressing transgenic families, Westar is the Brassica napus variety “Westar” Zhongshuang 6, and Bna-STTM397a-1, Bna-STTM397a-2, and Bna-STTM397a-3 are three independent suppressed expression transgenic families;

[0026] Figure 3Figure 2 is the functional validation result of Bna-miRNA397a in rapeseed; A shows the phenotypes of Bna-miRNA397a overexpression plants and wild-type plants before and after short-term chilling stress, as well as the phenotypes of Bna-miRNA397a suppression expression plants and wild-type plants before and after chilling stress; B shows the statistical analysis of the survival rate of transgenic plants after chilling stress; the standard error is based on three biological replicates, and "**" indicates that the P value of the t-test is less than 0.01, indicating an extremely significant difference; Zhongshuang No. 6 is the low-temperature sensitive material Zhongshuang No. 6, Bna-miRNA397a-OE1, Bna-miRNA397a-OE2 and Bna-miRNA397a-OE3 are three independent overexpression transgenic families, Westar is the Brassica napus "Westar", and Bna-STTM397a-1, Bna-STTM397a-2 and Bna-STTM397a-3 are three independent suppression expression transgenic families;

[0027] Figure 4 Figure 2 is the functional validation result of Bna-miRNA397a in rapeseed; A is the phenotype of Bna-miRNA397a overexpression plants, Bna-miRNA397a suppression expression plants and wild-type plants before and after long-term chilling stress; B is the statistical analysis of biomass of Bna-miRNA397a overexpression transgenic rapeseed after chilling stress; C is the statistical analysis of biomass of Bna-miRNA397a suppression expression transgenic rapeseed after chilling stress; standard error is based on 3 biological replicates. **" indicates that the P value of the t test is less than 0.01, and the difference is extremely significant; D is the legend of B and C; Zhongshuang 6 is the low-temperature-sensitive material Zhongshuang 6, Bna-miRNA397a-OE1, Bna-miRNA397a-OE2, and Bna-miRNA397a-OE3 are three independent overexpression transgenic lines, Westar is Brassica napus "Westar", and Bna-STTM397a-1, Bna-STTM397a-2, and Bna-STTM397a-3 are three independent suppressed expression transgenic lines. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0033] Example 1 Discovery of miRNA-Bna-miRNA397a Related to Rapeseed Cold Resistance

[0034] 1. Small RNA sequencing analysis was performed on seedlings of the cold-resistant material C18 (disclosed in the document "Identification and Screening of Late-sowing Short-Growing Period Rapeseed Varieties") and the cold-sensitive material Zhongshuang 6 (disclosed in the document "Establishment of Cold Resistance Identification Methods and Screening of Germplasm Resources in Brassica napus") before cold stress and 1, 7, 14, and 21 days after low temperature treatment (4°C dark for 8 hours / 8°C daytime for 16 hours). The relevant data were submitted to the NCBI database (PRJNA596550). It was found that a microRNA member, Bna-miRNA397a, was specifically induced by cold stress in the cold-resistant material C18, with an induction multiple of more than 3 times that of Zhongshuang 6. Its precursor sequence is shown in SEQ ID NO. 1, specifically: 5'-GAACATCATTGAGTGCAGCGTTGATGTGATTTACTTCTCTTTTTCATTGTTGAATGGA TTAAAGCAATTTACATCAACGTTGGCTCAATTATGTTT-3', the mature sequence of which is shown in SEQ ID NO.2, specifically: TCATTGAGTGCAGCGTTGATGT, and the above sequence has no base difference in C18 and Zhongshuang No. 6.

[0035] 2. Select rapeseed seedlings of the Zhongshuang No. 6 material that are about 3 weeks old, extract total DNA, use this DNA as a template, design primers for amplifying the Bna-miRNA397a precursor sequence, and amplify the Bna-miRNA397a precursor sequence.

[0036] The PCR reaction system is 20 μL, specifically: I-5 TM 2× High-Fidelity Master Mix 10 μL, upstream primer Bna-miRNA397a-F (5'-CGGAATTCCTACATGTAGTTCCATGGTGATT-3', SEQ ID NO.3) 10 μM 0.5 μL, downstream primer Bna-miRNA397a-R (5'-GGGGTACCTGGAGTTGGAATGACATCAATG-3', SEQ ID NO.4) 10 μM 0.5 μL, DNA 1 μL, ddH2O 8 μL.

[0037] The PCR reaction program was as follows: 95°C for 5 min; 95°C for 30 s, 58°C for 20 s, and 72°C for 1 min, for a total of 32 cycles; and extension at 72°C for 5 min.

[0038] Then take 2 μL of PCR product and perform electrophoresis on 1% agarose gel. Figure 1 .Depend on Figure 1It can be seen that a 228 bp sequence containing the precursor sequence was amplified (sequence: 5'-CTACATGTAGTTCCATGGTGATTAAACATAGCAAGAAAGGGTTTTTTTCCTGGATTT GTACGAACATCATTGAGTGCAGCGTTGATGTGATTTACTTCTCTTTTTCATTGTTGAATG GATTAAAGCAATTTACATCAACGTTGGCTCAATTATGTTTTTCTGATTTTCAGGATCAT AGAGAAAAAACATTCACAAACAAATTTTATCATTGATGTCATTCCAACTCCA-3', SEQ ID NO. 5).

[0039] Example 2 Construction of transgenic rapeseed overexpressing Bna-miRNA397a

[0040] 1. Double digest the PCR amplification product from Example 1 with restriction endonucleases EcoRI and KpnI, and recover the digestion product. Enzyme digestion system: EcoRI 1.5 μL, KpnI 1.5 μL, 10× buffer 5 μL, PCR amplification product 12 μL, ddH2O 30 μL, total volume 50 μL; digestion conditions: digestion at 37°C for 1.5 h.

[0041] 2. Double-digest the vector pCambia1302 (Wuhan Transduction Biological Laboratory Co., Ltd.) with restriction endonucleases EcoRI and KpnI to obtain the vector backbone. Enzyme digestion system: EcoRI 1.5μL, KpnI 1.5μL, 10× buffer 5μL, plasmid DNA 12μL, ddH2O 30μL, total volume 50μL; digestion conditions: digest at 37°C for 1.5 h.

[0042] 3. Use T4 ligase to ligate the digested product from step 1 with the vector backbone from step 2 to obtain the recombinant plasmid. The ligation system is: 0.5 μL of vector backbone, 3.5 μL of digested product, 0.5 μL of T4 ligase, and 0.5 μL of T4 buffer, for a total volume of 5 μL. Ligation conditions: Ligation at room temperature for 0.5 h. Next, transform the ligated recombinant plasmid pCambia1302-miRNA397a into competent E. coli DH5ɑ cells, plate them onto solid LB medium plates supplemented with kanamycin, and culture overnight before selecting colonies for sequencing.

[0043] 4. Sequencing results confirmed that the inserted sequence contained the Bna-miRNA397a precursor nucleotide sequence, as shown in SEQ ID NO. 5. Bna-miRNA397a was then inserted into pCambia1302 between the CaMV35S promoter and the nos terminator, with restriction enzyme cleavage sites located at EcoRI at the 5' end and KpnI at the 3' end.

[0044] 5. The recombinant plasmid pCambia1302-miRNA397a was transformed into competent Agrobacterium GV3101 (TRANSGEN) to obtain recombinant Agrobacterium.

[0045] 6. The recombinant Agrobacterium obtained in step 5 is transformed into the hypocotyls of Brassica napus. The specific steps are as follows:

[0046] 1. Sowing

[0047] Soak rapeseed seeds in an appropriate amount of 75% (volume percentage) alcohol for 1 minute. Pour off the alcohol and rinse with sterile water. Pour off the water. Sterilize the seeds with 50% (volume percentage) 84 disinfectant (sterile water and commercial 84 disinfectant mixed in a 1:1 volume ratio) for 10 minutes. Pour the disinfectant into a waste tank. For heavily contaminated seeds, the sterilization time can be extended to 20 minutes. Wash the seeds five times with an appropriate amount of sterile water. Use sterile tweezers to sow the treated seeds onto seeding medium M0, sowing 25 seeds per dish. Place the dish in a sterile incubator and incubate at 24°C in the dark for 6 days.

[0048] 2. Activation and preparation of Agrobacterium

[0049] (1) One day before infection, add antibiotics to 100 mL of sterilized liquid LB medium, inoculate the Agrobacterium strain, and culture overnight in a shaker at 28°C and 200 rpm. Measure the OD value of the bacteria (an OD value of around 0.8 in LB medium is ideal, and 16 hours is generally sufficient).

[0050] (2) Pour the cultured bacterial solution equally into two 50 mL sterile centrifuge tubes and centrifuge at 3000 rpm for 20 min. Remove the culture to a clean bench and discard the supernatant. Gently wash the cells with 1 mL of DM activation medium (with AS (acetosyringone) added), then discard the supernatant. Add 1 mL of DM activation medium and pipette to mix thoroughly. After the infiltration solution is prepared, place it on ice for activation.

[0051] (3) At the same time, use sterile tweezers and a scalpel to vertically cut the hypocotyls of the seedlings cultured in the dark, and cut them in the bacterial liquid activation medium DM. The optimal length of the explant is 0.8-1.0 cm. Place the cut explants in a dish containing the target bacterial liquid with a prepared concentration and immerse them for 15 minutes. The number of explants in each dish should be about 150, and shake them 5 times at intervals.

[0052] (4) After infection, use sterile tweezers to gently remove the explants, place them on sterile filter paper to remove excess bacterial liquid on the surface, and then use sterile tweezers to place the explants on the co-culture medium M1. Co-culture at 24°C in the dark for 48 hours.

[0053] 3. Selective training

[0054] After co-cultivation, the explants were transferred to selective medium M2 for 18 days under the conditions of 24°C light culture, 16 h daytime / 8 h nighttime.

[0055] 4. Differentiation Culture

[0056] After selective culture, the explants were transferred to differentiation medium M3 for differentiation culture, and subcultured every 20 days until buds appeared. The culture conditions were 24°C light culture, 16 hours daytime and 8 hours nighttime.

[0057] 5. Rooting culture and transplanting

[0058] Once the shoots have differentiated and a distinct growth point is visible, they are carefully excised from the callus using sterile forceps and a scalpel, avoiding any excess callus tissue and damaging the growth point. The shoots are then transferred to rooting medium M4 for rooting. The vitrified shoots require a period of incubation before returning to normal growth and rooting, resulting in transformed seedlings, which are the T0 generation transgenic rapeseed plants.

[0059] Preparation of transformation medium:

[0060] (1) Seeding medium M0: Add 2.22 g of MS and 8 g of agar to 1 L of culture medium and adjust the pH to 5.8-5.9;

[0061] (2) Bacterial activation medium DM: Add 4.43 g of MS and 30 g of sucrose to 1 L of culture medium, adjust the pH to 5.8-5.9, and after sterilization, add 1 mL of AS (100 mmol / mL), 2 mL of 2,4-D (0.5 mg / mL), and 1.5 mL of KT (0.2 mg / mL);

[0062] (3) Co-culture medium M1: Add 4.43 g of MS, 30 g of sucrose, 18 g of mannitol, 2 mL (0.5 mg / mL) of 2,4-D, and 1.5 mL (0.2 mg / mL) of KT to 1 L of culture medium, adjust the pH to 5.8-5.9, and add 1 mL of AS after sterilization;

[0063] (4) Selective medium M2: Add 4.43 g MS, 30 g sucrose, 18 g mannitol, 2 mL (0.5 mg / mL) 2,4-D, 1.5 mL (0.2 mg / mL) KT to 1 L of culture medium, adjust the pH to 5.8-5.9, and after sterilization, add 13 μL (20 mM / L) AgNO3, 1 mL (300 mg / mL) Timentin, and 500 μL hygromycin (50 mg / mL);

[0064] (5) Differentiation medium M3: Add 4.43 g MS, 10 g glucose, 0.25 g xylose, and 0.6 g MES to 1 L of culture medium, adjust the pH to 5.8-5.9, and after sterilization, add 4 mL ZT (0.5 mg / mL), 200 μL IAA (0.5 mg / mL), 1 mL Timentin (300 mg / mL), and 500 μL hygromycin (50 mg / mL);

[0065] (6) Rooting medium M4: Add 2.22 g of MS, 10 g of sucrose, 5 mL of IBA (0.1 mg / mL), and 8 g of agar to 1 L of culture medium. After sterilization, add 500 μL of Timentin (300 mg / mL).

[0066] (7) Liquid LB medium: add 10 g of sodium chloride, 10 g of peptone, and 5 g of yeast to 1 L of medium;

[0067] (8) Solid LB medium: Add 10 g of sodium chloride, 10 g of peptone, 5 g of yeast, and 8 g of agar to 1 L of medium.

[0068] 6. RNA was extracted from T0 generation transgenic rapeseed plants and reverse transcribed using the reverse transcription kit of Quanshijin Biotechnology to obtain cDNA. The reverse transcription system was as follows: 3 μg RNA, add ddH2O to adjust the system to 6 μL, gRNARemoval 1 μL, cDNA Synthesis Super Mix 1 μL, 2× buffer 10 μL, 397 stem-loop primer (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACATCA, SEQ ID NO.6) 1 μL, U6 reverse transcription primer (TTGGACCATTTCTCGATTTGTG, SEQ ID NO.7) 1 μL, incubate in a 42°C water bath for 15 min, and terminate the reaction at 85°C for 15 s.

[0069] (9) The product was diluted 10 times and then quantitative real-time PCR (qRT-PCR) analysis was performed. A 96-well PCR plate specifically for qRT-PCR and Vazyme's ChamQ Universal SYBR qPCR MasterMix were used to prepare the reaction system for qRT-PCR. U6 was used as the internal reference, and the primers were (F: TTGGAACGATACAGAGAAGATTAGCA, SEQ ID NO.8; R: GTGCAGGGTCCGAGGTATTC, SEQ ID NO.9); the amplification primers for Bna-miRNA397a were F: AGCAGCCATCATTGAGTGCAGCG (SEQ ID NO.10), R: GTGCAGGGTCCGAGGTATTC (SEQ ID NO.9). The program was pre-denaturation at 95°C for 30s, followed by 95°C for 15s, 60°C for 30s, and 40 cycles. The expression data were sorted using Excel and analyzed according to 2 -ΔΔCt The relative expression level of each plant was calculated by the method. The expression analysis of Bna-miRNA397a in wild-type rapeseed plants and overexpressed transgenic rapeseed is shown in Figure 2 A and C in Figure 3. The results showed that the expression level of Bna-miRNA397a in the overexpression transgenic plants was significantly higher than that in the wild-type plants.

[0070] Example 3 Construction of Bna-miRNA397a rapeseed inhibitory material

[0071] The short tandem targets mimic (STTM) technology was used to effectively inhibit the activity of endogenous miRNA in rapeseed. A target sequence containing the mature sequence of Bna-miRNA397a (GGTACCACATCAACGCTctaGCACTCAATGAGTTGTTGTTGTTATGGTCTAATTTAAAT ATGGTCTAAAGAAGAAGAATACATCAACGCTCTAGCACTCAATGAGGATCC, SEQ ID NO. 11) was synthesized in vitro, where the bold portion indicates the restriction endonuclease site. The specific steps are as follows:

[0072] 1. Double-digest the in vitro synthesized target sequence with restriction endonucleases Kpn I and BamH I, and recover the digestion product. Digestion system: Kpn I 1.5 μL, BamH I 1.5 μL, 10× buffer 5 μL, PCR amplification product 12 μL, ddH2O 30 μL, total volume 50 μL; Digestion conditions: Digest at 37°C for 1.5 h.

[0073] 2. Double-digest the PGTV-FLAG III vector (Wuhan Transduction Biological Laboratory Co., Ltd.) with the restriction endonucleases Kpn I and BamH I to obtain the vector backbone. Enzyme digestion system: Kpn I 1.5 μL, BamH I 1.5 μL, 10× buffer 5 μL, plasmid DNA 12 μL, ddH2O 30 μL, total volume 50 μL; digestion conditions: digest at 37°C for 1.5 h.

[0074] 3. Use T4 ligase to ligate the digested product from step 1 with the vector backbone from step 2 to obtain a recombinant plasmid. The ligation system is: 0.5 μL of vector backbone, 3.5 μL of digested product, 0.5 μL of T4 ligase, and 0.5 μL of T4 buffer, for a total volume of 5 μL. Ligation conditions: Ligation at room temperature for 0.5 h. Next, transform the ligated recombinant plasmid PGTV-FLAG III-miRNA397a into competent E. coli DH5α cells, plate them onto solid LB medium plates supplemented with kanamycin, and culture overnight before selecting colonies for sequencing.

[0075] 4. According to the sequencing results, the inserted sequence was clearly the target sequence synthesized in vitro, and the nucleotide sequence was shown as SEQ ID NO.11.

[0076] 5. The recombinant plasmid PGTV-FLAG III-miRNA397a was transformed into competent Agrobacterium GV3101 (TRANSGEN) to obtain recombinant Agrobacterium.

[0077] 6. The recombinant Agrobacterium obtained in step 5 was transformed into the hypocotyls of Brassica napus "Westar". The subsequent detection method of rapeseed transgenic plants was the same as above, and multiple Bna-miRNA397a rapeseed suppression materials were obtained. The expression analysis of Bna-miRNA397a in wild-type rapeseed plants and suppressed expression transgenic rapeseed is shown in Figure 2 The results showed that the expression level of Bna-miRNA397a in the suppressed transgenic plants was significantly lower than that in the wild-type plants.

[0078] Example 4 Identification of cold resistance of transgenic lines

[0079] 1. The overexpression transgenic plants obtained in Example 2, the suppressed expression transgenic plants obtained in Example 3, and wild-type rapeseed were sown simultaneously in 1 / 2MS solid culture medium. One week later, they were transferred to a culture medium (vermiculite: nutrient soil mixed in a volume ratio of 1:1) and cultured under the same conditions for one month.

[0080] 2. Select seedlings with consistent growth and place them in a low-temperature incubator. Treat them at -2°C for 1 hour, then at -4°C for 1 hour, and then at -6°C for 1 hour. For specific steps, please refer to the "Establishment of Cold Resistance Identification Methods and Germplasm Resource Screening of Brassica napus"; after 3 hours, remove the seedlings and transfer them to normal growth conditions for 3 days to recover.

[0081] 3. The results are as follows Figure 3 As shown in the figure, wild-type rapeseed seedlings (WT) wilt and die after chilling stress, while overexpressing transgenic plants (Bna-miRNA397a-OE1, Bna-miRNA397a-OE2 and Bna-miRNA397a-OE3) can still maintain normal growth after chilling stress ( Figure 3 ), the survival rate was significantly higher than that of wild-type plants. On the contrary, the cold resistance of the transgenic plants with suppressed expression (Bna-STTM397a-1, Bna-STTM397a-2 and Bna-STTM397a-3) was significantly lower than that of the wild-type plants ( Figure 4 ), and the survival rate was also lower than that of wild-type plants ( Figure 4 ). This shows that the cold resistance of overexpression transgenic plants is significantly higher than that of wild-type rapeseed and suppressed expression transgenic plants, and Bna-miRNA397a can be used for plant cold resistance breeding.

[0082] Example 5 Identification of the ability of transgenic lines to resist long-term low temperature

[0083] 1. The overexpression transgenic plants, suppressed expression transgenic plants and wild-type rapeseed obtained in Example 2 and Example 3 were sown simultaneously in 1 / 2MS solid culture medium. After one week, they were transferred to a culture medium (vermiculite: nutrient soil mixed in a volume ratio of 1:1) and cultured under normal conditions (22°C) for one month.

[0084] 2. Select seedlings with consistent growth and subject them to continuous low temperature stress treatment (4℃ night / 8℃ day) for three weeks, while using normal culture conditions (22℃) as a control.

[0085] 3. The results are as follows Figure 4 As shown in Figure 2, after three weeks of continuous low temperature stress treatment, the growth of overexpressing transgenic plants was significantly better than that of wild-type plants ( Figure 4 A in the figure), the growth of the transgenic plants with suppressed expression was significantly weaker than that of the wild-type plants ( Figure 4 A in the figure), the difference in biomass statistics is consistent with the phenotype ( Figure 4 B and C in ).

[0086] In summary, Bna-miRNA397a can regulate plant cold resistance and low-temperature adaptability. Overexpression of Bna-miRNA397a can enhance the cold resistance and low-temperature adaptability of transgenic plants, while inhibition of Bna-miRNA397a expression reduces the cold resistance and low-temperature adaptability of transgenic plants. Therefore, Bna-miRNA397a can be used in plant breeding, and this invention provides a new direction for plant breeding.

[0087] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Use of Bna-miRNA397a or a biological material containing the precursor sequence of Bna-miRNA397a in regulating plant cold tolerance, characterized in that: The nucleotide sequence of the Bna-miRNA397a is shown as SEQ ID NO.2; the nucleotide sequence of the precursor sequence of the Bna-miRNA397a is shown as SEQ ID NO.1; the biological material is a recombinant plasmid or a recombinant bacterium; and the plant is rapeseed.

2. The use according to claim 1, characterized in that By overexpressing the Bna-miRNA397a in plants, the effect of enhancing the cold tolerance of plants is achieved; by inhibiting the expression of the Bna-miRNA397a in plants, the effect of reducing the cold tolerance of plants is achieved.

3. Use of Bna-miRNA397a or a biological material containing the precursor sequence of Bna-miRNA397a in regulating plant low temperature adaptability, characterized in that: The nucleotide sequence of the Bna-miRNA397a is shown as SEQ ID NO.2; the nucleotide sequence of the precursor sequence of the Bna-miRNA397a is shown as SEQ ID NO.1; the biological material is a recombinant plasmid or a recombinant bacterium; and the plant is rapeseed.

4. The use according to claim 3, characterized in that By overexpressing the Bna-miRNA397a in plants, the effect of improving the low-temperature adaptability of plants is achieved; by inhibiting the expression of the Bna-miRNA397a in plants, the effect of weakening the low-temperature adaptability of plants is achieved.

5. Use of Bna-miRNA397a or a biological material containing the precursor sequence of Bna-miRNA397a in cultivating cold-resistant plants, characterized in that: The nucleotide sequence of the Bna-miRNA397a is shown as SEQ ID NO.2; the nucleotide sequence of the precursor sequence of the Bna-miRNA397a is shown as SEQ ID NO.1; the biological material is a recombinant plasmid or a recombinant bacterium; and the plant is rapeseed.

6. A method for cultivating cold-resistant plants, characterized in that: The method comprises the steps of enhancing the cold resistance of the plant by overexpressing Bna-miRNA397a in the plant; the nucleotide sequence of the Bna-miRNA397a is shown in SEQ ID NO.2; and the plant is rapeseed.

7. Use of Bna-miRNA397a or a biological material containing the precursor sequence of Bna-miRNA397a in cultivating plants with strong low-temperature adaptability, characterized in that: The nucleotide sequence of the Bna-miRNA397a is shown as SEQ ID NO.2; the nucleotide sequence of the precursor sequence of the Bna-miRNA397a is shown as SEQ ID NO.1; the biological material is a recombinant plasmid or a recombinant bacterium; and the plant is rapeseed.

8. A method for cultivating plants with strong low temperature adaptability, characterized in that: The method comprises the steps of promoting the low temperature adaptability of the plant by overexpressing Bna-miRNA397a in the plant; the nucleotide sequence of the Bna-miRNA397a is shown in SEQ ID NO.2; and the plant is rapeseed.

Images