Lactobacillus plantarum LP07-A12-10 and its application in producing conjugated linoleic acid

Abstract

The present invention provides the application of oleate hydratase gene mcra in improving the production of conjugated linoleic acid by fermentation of Lactobacillus plantarum. The present invention also provides a strain of Lactobacillus plantarum LP07‑A12‑10, which has a deposit number of CGMCC No.30362. The present invention also provides the application of the above-mentioned Lactobacillus plantarum in the production of conjugated linoleic acid and / or conjugated linolenic acid. The plant lactobacillus LP07‑A12‑10 of the present invention can achieve a CLA concentration of 1.331 mg / ml and a conversion rate of 42.50%, of which c9, t11‑CLA accounts for 92.04% of the total CLA content; CLNA is 0.303 mg / ml, and the conversion rate is 47.64%, of which c9, t11, c15‑CLNA accounts for 81.85% of the total CLNA content.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, in particular to a strain of Lactobacillus plantarum LP07-A12-10, and also to a method for producing conjugated linoleic acid and conjugated linolenic acid by biotransformation of the Lactobacillus plantarum with soybean oil as a substrate. Background Art

[0002] Conjugated fatty acids are a group of positional isomers and geometric isomers of polyunsaturated fatty acids with conjugated double bonds. There are several subclasses of conjugated fatty acids, including conjugated linoleic acids (CLA), conjugated linolenic acids (CLNA), conjugated eicosapentaenoic acids (CEPA) and conjugated docosahexaenoic acids (CDHA). Conjugated linoleic acids (CLA) are a general term for various positional and geometric isomers of octadecadienoic acid containing conjugated double bonds derived from linoleic acid (LA). The most physiologically active isomers are c9, t11-CLA and t10, c12-CLA, and these two CLA isomers have been certified as safe, allowing them to be added to foods such as dairy products and fruit juices as safe food additives. Conjugated linolenic acid (CLNA) is a general term for various positional and geometric isomers of octadecadienoic acid containing conjugated double bonds derived from linolenic acid (LNA), among which the main isomers are c9, t11, c15-CLNA and t9, t11, c15-CLNA. Studies have shown that CLA has applications in anti-cancer, diabetes, prevention of cardiovascular disease, and weight control, and has become an indispensable health food in life. CLNA has multiple functions such as anti-inflammatory, weight loss, anti-tumor, cardiovascular protection, hormone replacement, and neuroprotection, so it has received more and more attention.

[0003] Conjugated fatty acids are essential fatty acids that cannot be synthesized by the human body and must be obtained from external food. Compared with other ways to obtain conjugated fatty acids, the use of microorganisms to synthesize conjugated fatty acids has technical advantages and potential. Chinese invention patent application CN 1928071A discloses that Lactobacillus plantarum CCTCC NO.M206033 can produce 312.4 μg / mL of CLA using linoleic acid as a substrate. In Chinese invention patent application CN 201610547034.1, Bifidobacterium breve C11 produces 0.4703 mg / mL of conjugated linoleic acid using linolenic acid as a substrate, and produces 0.3347 mg / mL of conjugated linolenic acid using linolenic acid as a substrate. For example, Lactobacillus plantarum CCFM261 produced 0.186 mg / mL of CLNA, with a conversion rate of more than 50% [Yang Qin, Yang Bo, Liu Lizhi, et al. Screening and characterization of Lactobacillus plantarum for biotransformation of conjugated α-linolenic acid [J]. Food and Fermentation Industries, 2016, 42(10): 34-38].

[0004] It is known that lactic acid bacteria that can synthesize CLA and CLNA by themselves will be inhibited by high-concentration substrates during growth, thereby limiting the addition of high-concentration substrates, resulting in low final CLA and CLNA yields. Therefore, it is also necessary to screen out lactic acid bacteria strains with better substrate tolerance and higher yields to synthesize CLA and CLNA. In addition, most strains currently produce conjugated linoleic acid using linolenic acid as a substrate and conjugated linolenic acid using linolenic acid as a substrate, and the substrate cost is relatively high. Summary of the invention

[0005] The purpose of the present invention is to overcome the defects of the prior art and obtain a new strain of Lactobacillus plantarum by screening and mutation, so as to obtain a strain with better tolerance to high-concentration substrates and lower production cost, and produce more conjugated linoleic acid and conjugated linolenic acid.

[0006] Based on this, the present invention provides the use of oleate hydratase gene mcra in improving the production of conjugated linoleic acid by Lactobacillus plantarum fermentation.

[0007] Wherein, the conjugated linoleic acid includes cis-9, trans-11-conjugated linoleic acid, trans-9, trans-11-conjugated linoleic acid and trans-10, cis-12-conjugated linoleic acid.

[0008] Specifically, the nucleic acid sequence of the oleate hydratase gene mcra is shown in SEQ ID No.2.

[0009] The present invention also provides a strain of Lactobacillus plantarum LP07-A12-10, which was deposited in the General Microbiology Center of the China Microbiological Culture Collection Committee, Institute of Microbiology, Chinese Academy of Sciences on April 17, 2024, and its deposit number is CGMCC No.30362.

[0010] The present invention also provides the use of the Lactobacillus plantarum LP07-A12-10 in producing conjugated linoleic acid and / or conjugated linolenic acid.

[0011] Preferably, the Lactobacillus plantarum LP07-A12-10 of the present invention ferments soybean oil as a substrate to produce conjugated linoleic acid and / or conjugated linolenic acid. Soybean oil as a substrate has the advantage of being cheaper and more readily available.

[0012] The present invention also provides a method for producing conjugated linoleic acid and / or conjugated linolenic acid using soybean oil as a substrate by using Lactobacillus plantarum LP07-A12-10. The method comprises the following steps:

[0013] A. Bacteria Activation

[0014] Lactobacillus plantarum LP07-A12-10 was diluted with sterile water, spread on an MRS solid medium plate, and cultured at 37°C for 48 hours to obtain a single colony;

[0015] B. Seed cultivation

[0016] Use an inoculation loop to pick up a single colony obtained in step A, inoculate it into an anaerobic test tube containing MRS liquid culture medium, and culture it at 37°C and 200 rpm for 12 hours to obtain a seed solution;

[0017] C. Shake flask fermentation

[0018] The obtained seed liquid was inoculated into a stoppered ground-mouth conical flask filled with MRS liquid culture medium at a volume ratio of 2%, 1.0-10 mg / mL soybean oil was added to the culture medium, and cultured at 37° C. and 200 rpm for 48 h.

[0019] In the present invention, the composition of the MRS solid culture medium is: peptone 10g / L, beef extract 10g / L, glucose 20g / L, sodium acetate 2g / L, yeast powder 5g / L, diammonium hydrogen citrate 2g / L, K2HPO4·3H2O 2.6g / L, MgSO4·7H2O0.1g / L, MnSO4·H2O 0.05g / L, Tween-80 1mL / L, agar 15g / L, and cysteine ​​amino acid salt 0.5g / L.

[0020] The composition of the MRS liquid culture medium is: 10 g / L peptone, 10 g / L beef extract, 20 g / L glucose, 2 g / L sodium acetate, 5 g / L yeast powder, 2 g / L diammonium hydrogen citrate, 2.6 g / L K2HPO4·3H2O, 0.1 g / L MgSO4·7H2O, 0.05 g / L MnSO4·H2O, 1 mL / L Tween-80, and 0.5 g / L cysteine ​​salt.

[0021] It has been verified that the plant lactobacillus LP07-A12-10 of the present invention is fermented in a stoppered ground-mouth conical flask containing 10 mL of MRS liquid culture medium, and the culture medium is an MRS liquid culture medium with a soybean oil concentration of 6.0 mg / mL, and the final CLA concentration is 1.331 mg / ml (including cis-9, trans-11-conjugated linoleic acid, trans-9, trans-11-conjugated linoleic acid and trans-10, cis-12-conjugated linoleic acid), and the conversion rate is 42.50%, of which c9, t11-CLA is 1.225 mg / ml, accounting for 92.04% of the total CLA content; CLNA is 0.303 mg / ml, and the conversion rate is 47.64%, of which c9, t11, c15-CLNA is 0.248 mg / ml, accounting for 81.85% of the total CLNA content.

[0022] Microbial information: Lactobacillus plantarum LP07-A12-10, the strain was deposited at the General Microbiology Center of China Microbiological Culture Collection Committee, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing on April 17, 2024, and its deposit number is CGMCC No.30362. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Colony morphology of LP07-A12-10 strain on plate

[0024] Figure 2 LP07-A12-10 strain under 100x oil microscope

[0025] Figure 3 Flowchart of strain adaptive evolution

[0026] Figure 4 Absorbance of conjugated fatty acids in fermentation broth after adding different concentrations of soybean oil

[0027] Figure 5 LP07-A12-10-8 strain 16s rDNA PCR amplification verification gel image

[0028] Figure 6 Fatty acid composition of fermentation broth of LP07-A12-10 strain after adding soybean oil

[0029] Figure 7 Changes in mRNA transcription levels of mcra, dh, and dc genes DETAILED DESCRIPTION

[0030] The following examples are used to explain the technical solutions of the present invention in a non-limiting manner.

[0031] In the present invention, unless otherwise specified, "%" used to explain concentrations refers to weight percentage, and ":" refers to weight ratio.

[0032] The present invention relates to the following culture medium:

[0033] The composition of MRS solid culture medium is: peptone 10g / L, beef powder 5g / L, glucose 20g / L, yeast powder 4g / L, triammonium citrate 2g / L, C2H3NaO2·3H2O 5.0g / L, K2HPO4·7H2O 2.0g / L, MgSO4·7H2O 0.2g / L, MnSO4·4H2O 0.05g / L, Tween-80 1mL / L, agar 15g / L, and cysteine ​​salt 0.5g / L.

[0034] The composition of MRS liquid culture medium is: peptone 10g / L, beef powder 5g / L, glucose 20g / L, yeast powder 4g / L, triammonium citrate 2g / L, C2H3NaO2·3H2O 5.0g / L, K2HPO4·7H2O 2.0g / L, MgSO4·7H2O 0.2g / L, MnSO4·4H2O 0.05g / L, Tween-80 1mL / L, and cysteine ​​salt 0.5g / L.

[0035] The present invention relates to the following detection method:

[0036] Rapid screening of high-yield conjugated linoleic acid or conjugated linolenic acid strains: Take 1 mL of fermentation broth, add 0.5 mL of isopropanol, shake thoroughly to mix, then add 1 mL of n-hexane, shake thoroughly to mix again, centrifuge at 4°C and 5000g for 10 min, take the top n-hexane layer, measure the absorbance at 233 nm with a UV spectrophotometer, and quickly screen high-yield strains based on the absorbance.

[0037] Extraction and methylation of fatty acids in fermentation broth: Take 4 mL of bacterial broth, add heptadecanoic acid (C17:0) to the fermentation broth to a final mass concentration of 0.5000 mg / mL as an internal standard, add 2 mL of isopropanol, shake and mix thoroughly, then add 4 mL of n-hexane, shake and mix thoroughly again, centrifuge at 5000g for 10 minutes, take the n-hexane layer to a clean centrifuge tube, and blow dry with nitrogen. Add 400 μL of methanol to the dried sample, shake and mix thoroughly, add 400 μL of trimethylsilyldiazomethane for methylation, blow dry with nitrogen after the yellow color is maintained for 15 minutes, add 1 mL of n-hexane to dissolve, transfer to a gas phase vial, and detect by GC-MS.

[0038] GC-MS detection method: Agilent gas chromatograph was used for detection. Agilent gas chromatograph (8860GC), gas column HP-WAX (30m, 0.25mm, 0.25μm), Agilent mass spectrometer (5977CGC / MSD). Program temperature conditions: initial 170℃, heated to 200℃ at a rate of 10℃ / min, maintained for 3min, heated to 210℃ at a rate of 4℃ / min, maintained for 10min. Split injection was used, the injection volume was 1μL, the split ratio was 10:1, and helium was used as the carrier gas. The injector temperature and detector temperature were both 240℃. The ion source was 220℃, and the intensity was 70eV.

[0039] Example 1: Screening of Lactobacillus plantarum

[0040] 1. Strain isolation and purification

[0041] Stir the kimchi liquid from the naturally fermented farm kimchi jars in Yangling District, Xianyang City, Shaanxi Province and Huazhou District, Weinan City, Shaanxi Province, and place the sample in a sterile sealed container, put in an ice pack, and store it at low temperature before taking it back. Take 1 mL of the sample, add sterile water, and dilute it to 10 -1 Up to 10 -5 Times, take 50-100μL respectively and spread on MRS solid medium, and culture at 37℃ for 48h. Select the white or light yellow strains with smooth surface, neat edges and moistness on the plate and streak them on MRS solid medium for purification. After 3-4 streaking purifications, each single colony is inoculated in MRS liquid medium and cultured at 37℃ and 200rpm for 48h. Take 1mL of bacteria, centrifuge at 2000g for 1min, discard the supernatant, add 1mL of sterilized 20% glycerol to the bacteria, shake and mix, and store in a refrigerator at -80℃ for later use, and 37 different strains are obtained.

[0042] 2. Strain identification

[0043] A. Gram staining

[0044] The 37 preserved glycerol strains were activated on MRS plate medium and cultured at 37°C for 48 hours. The colony morphology on the plate was observed, and the colonies to be tested were picked on a slide, diluted with physiological saline, and then Gram-stained. After staining, the bacterial morphology was observed under a microscope, including 17 strains of Gram-positive bacteria (purple) and 20 strains of Gram-negative bacteria (red).

[0045] B. Hydrogen peroxide tolerance assessment

[0046] Use an inoculating loop to pick up a loop of colonies on the solid culture medium, place it in a clean test tube, add 2mL of 3% hydrogen peroxide solution, and observe the results. Those that produce bubbles within half a minute are determined to be positive, totaling 21 strains, and those that do not produce bubbles are determined to be negative, totaling 16 strains.

[0047] The strains that were positive by Gram staining and negative by hydrogen peroxide tolerance were lactic acid bacteria, and 13 lactic acid bacteria were obtained. The results are shown in Table 1.

[0048] Table 1: Gram staining and hydrogen peroxide tolerance test

[0049]

[0050] 3. Fermentation screening of strains with high CLA and CLNA production

[0051] Preparation of soybean oil hydrolysate: weigh 10g soybean oil into a beaker, add 2g Tween-80 into the beaker, add 5mL water to dissolve, mix by ultrasonic, add 1.0g lipase, mix and keep warm at 37°C for 6 hours, then add water to make the volume to 20mL, mix and filter with a 0.22μm sterile filter membrane to obtain a soybean oil hydrolysate with a soybean oil content of 0.5g / mL (52.2% linoleic acid and 10.6% α-linolenic acid in soybean oil).

[0052] The 13 lactic acid bacteria obtained were activated on MRS plate medium and cultured at 37°C for 48h. Single colonies were picked and inoculated into anaerobic test tubes containing 2mL MRS liquid medium, cultured at 37°C, 200rpm for 12h, and then inoculated into stoppered ground-mouth conical flasks containing 10mL MRS liquid medium (soybean oil enzymatic hydrolysate was added to the MRS liquid medium to make the soybean oil concentration 1.0mg / mL) at a 2% inoculum, and cultured at 37°C, 200rpm for 48h.

[0053] 4 mL of fermentation broth was taken from each conical flask, fatty acids in the fermentation broth were extracted, the fatty acids were methylated by the diazomethane method, and the content was detected and calculated by GC-MS to obtain the LP07 strain with higher CLA and CLNA production. The production of different strains is shown in Table 2.

[0054] Table 2: Production of CLA and CLNA in different strains

[0055]

[0056] 4. Composite mutagenesis breeding

[0057] The LP07 strain was activated on the MRS plate medium and cultured at 37°C for 48 h. Then a single colony was picked into a 10 mL centrifuge tube, 5 mL of sterile water was added, and the bacterial suspension was obtained after oscillation and gradient dilution to obtain the OD 600 5 mL of bacterial suspension was placed in a sterile culture dish, and irradiated with a 15W UV lamp at a distance of 30 cm for 30 seconds, then cultured in the dark for 1 hour, and then 0.1 M sodium nitrite was added to the culture dish, and cultured at 37°C for 3 minutes.

[0058] After the mutagenesis was completed, disodium hydrogen phosphate solution was immediately added to terminate the reaction. -1 Up to 10 -5 , then spread on MRS plate medium and cultured at 37°C for 48h. Pick a single colony and inoculate it into an anaerobic test tube containing 2mL MRS liquid medium, culture it at 37°C, 200rpm for 12h, and inoculate it into a 96-well culture plate containing 1mL MRS liquid medium (soybean oil enzymatic hydrolysate is added to the MRS liquid medium to make the soybean oil concentration 1.0mg / mL) at an inoculum of 2%, culture it at 37°C, 200rpm for 48h, and ferment it together with the unmutagenized LP07 as a control strain. Take 0.8 mL of bacterial solution, add 0.4 mL of isopropanol, shake and mix thoroughly, add 0.8 mL of n-hexane, shake and mix thoroughly again, centrifuge at 4 ° C, 5000 g for 10 min, take the top n-hexane layer, use an ultraviolet spectrophotometer to measure the absorbance at 233 nm, select mutant strains with absorbance significantly greater than that of the control strain, and screen strains with high conjugated fatty acid content based on the absorbance, and obtain two positive mutant strains LP07-A12 and LP07-C05 with significantly higher yields than the control strain.

[0059] The LP07-A12 and LP07-C05 strains were rescreened by shaking flasks, and the positive mutants on the MRS plate medium were inoculated into anaerobic test tubes containing 2 mL of MRS liquid medium, and cultured at 37°C, 200 rpm for 12 h, and then inoculated into stoppered ground-mouth conical flasks containing 10 mL of MRS liquid medium (soybean oil enzymatic hydrolysate was added to the MRS liquid medium to make the soybean oil concentration 1.0 mg / mL) at a 2% inoculum, and cultured at 37°C, 200 rpm for 48 h. 4 mL of fermentation broth was taken from each conical flask, and fatty acids in the fermentation broth were extracted, and the fatty acids were methylated by the diazomethane method, and the contents were detected and calculated by GC-MS. The CLA and CLNA yields are shown in Tables 3 and 4.

[0060] Table 3: CLA and CLNA production of strains after compound mutagenesis

[0061]

[0062]

[0063] Table 4: CLA and CLNA contents of strains after compound mutagenesis

[0064]

[0065] 5. Adaptive evolution

[0066] The strain LP07-A12 was activated on MRS solid plate medium and cultured at 37°C for 48h. A single colony was picked and inoculated into an anaerobic test tube containing 2mL of MRS liquid medium, and cultured at 37°C, 200rpm for 12h, and then inoculated in turn with 2% inoculum into a stoppered ground-mouth conical flask containing 10mL of MRS liquid medium (soybean oil hydrolysate was added to the MRS liquid medium to make the soybean oil concentration of 1.0mg / mL), and cultured at 37°C, 200rpm for 24h; continued to be inoculated in turn with 2% inoculum into a stoppered ground-mouth conical flask containing 10mL of MRS liquid medium (soybean oil hydrolysate was added to the MRS liquid medium to make the soybean oil concentration of 2.0mg / mL), and cultured at 37°C, 200rpm for 24h; continued to be inoculated in turn with 2% inoculum into a stoppered ground-mouth conical flask containing 10mL of MRS liquid medium (soybean oil hydrolysate was added to the MRS liquid medium to make the soybean oil concentration of 2.0mg / mL), and cultured at 37°C, 200rpm for 24h; continued to be inoculated in turn with 2% inoculum into a stoppered ground-mouth conical flask containing 10mL of The culture medium was prepared in a stoppered conical flask containing MRS liquid medium (soybean oil hydrolysate was added to the MRS liquid medium to make the soybean oil concentration of 3.0 mg / mL), and the culture was carried out at 37°C, 200 rpm for 24 h. The culture was subcultured 9 times in succession. The soybean oil contents in the culture medium were 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10 mg / mL, respectively. MRS solid plate medium was applied at the same time of each inoculation. The strain was adaptively evolved by gradually increasing the pressure to obtain strain LP07-A12-10.

[0067] The LP07-A12-10 strain and the control strain LP07-A12 on the MRS solid plate were inoculated into anaerobic test tubes containing 2 mL of MRS liquid culture medium, and cultured at 37°C, 200 rpm for 12 h. Then, they were inoculated at a 2% inoculum size into stoppered ground-mouth conical flasks containing 10 mL of MRS liquid culture medium (the soybean oil content in the culture medium was 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, and 10 mg / mL, respectively), and cultured at 37°C, 200 rpm for 48 h.

[0068] Take 1 mL of bacterial solution, add 0.5 mL of isopropanol, shake well and mix, add 1 mL of n-hexane, shake well and mix again, centrifuge at 4°C, 5000g for 10 min, take the top n-hexane layer, and use a UV spectrophotometer to measure the absorbance at 233 nm. It was found that when 6.0 mg / mL soybean oil was added to the LP07-A12-10 strain, the absorbance was the highest and the total content of CLA and CLNA was the highest. The fermentation broth was extracted and methylated and then detected by GC-MS. The results are shown in Tables 4 and 5.

[0069] The control strain LP07-A12 had the highest absorbance and the highest total content of CLA and CLNA when 4.0 mg / mL soybean oil was added. The fermentation broth was extracted and methylated and then tested by GC-MS. The results are shown in Tables 6 and 7.

[0070] It can be seen that after adaptive evolution, the production of conjugated linoleic acid in strain LP07-A12-10 was significantly improved, but the increase in conjugated linolenic acid production was not particularly significant.

[0071] Table 4: CLA and CLNA production of strain LP07-A12-10

[0072]

[0073] Table 5: CLA and CLNA content of LP07-A12-10 strain

[0074]

[0075] Table 6: CLA and CLNA production of LP07-A12 strain

[0076]

[0077] Table 7: CLA and CLNA content of LP07-A12 strain

[0078]

[0079] 6. 16s rDNA identification of bacterial species

[0080] Extraction of genomic DNA from LP07-A12-10 strain: Take 1 mL of cultured bacterial solution, centrifuge, and discard the supernatant; add 200 μL of 200 mM LioAc, 1% SDS solution, and oscillate to mix; place in a metal bath at 70°C for 15 min; add an equal volume (200 μL) of saturated phenol: chloroform: isoamyl alcohol (25:24:1, v / v) solution, vortex to milky white, and centrifuge for 10 min; aspirate the aqueous phase into a new sterilized 1.5 mL centrifuge tube, add an equal volume of isopropanol, and mix; place at -20°C for 1-2 h, and centrifuge at 12000×g for 10 min to obtain DNA; add 1 mL of 70 volume % ethanol to wash the DNA (repeat 2 times), centrifuge for 4 min, and discard the supernatant; turn the centrifuge tube containing the DNA upside down on a clean filter paper for 15 min, and place in a metal bath at 50°C for 2 min to completely evaporate the ethanol; dissolve the DNA in 50 μL of deionized water and store at -20°C for later use.

[0081] The extracted genomic DNA was diluted to a concentration of about 100 ng / μL, and the diluted genomic DNA was used as a template for PCR amplification with 16srDNA universal primers (27F: AGAGTTTGATCCTGGCTCAG, 1492R: GGTTACCTTGTTACGACTT), and verified by agarose gel electrophoresis. The strain with the correct verification result was sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. The sequencing result is shown in SEQ ID NO.1, and the sequencing result was subjected to Blast sequence alignment in Genbank of NCBI. The results showed that the similarity between the 16s rDNA sequence of the LP07-A12-10 strain and multiple Lactobacillus plantarum sequences was 99% or more, thereby determining that the LP07-A12-10 strain was Lactobacillus plantarum.

[0082] 7. Transcription levels of related genes

[0083] Further verification was carried out based on the possible related genes for conjugated linoleic acid production reported in existing literature.

[0084] Inoculate LP07-A12-10 strain in 3mL MRS liquid medium, culture at 37°C, 200rpm for 12h; inoculate the bacterial solution in 10mL MRS liquid medium at 2% inoculum volume, culture at 37°C, 200rpm for 24h; take 1mL of fermentation broth in a sterile, enzyme-free 1.5mL centrifuge tube, centrifuge at 4000×g, 4°C for 4min, discard the supernatant, and grind with liquid nitrogen; add 1mL Trizol reagent and mix well, let stand at room temperature for 5min; add 0.2mL pre-cooled chloroform, vortex and shake for 15s until milky white, let stand for 5min; centrifuge at 12000×g, 4°C for 15min; take the supernatant, add an equal amount of pre-cooled isopropanol, let stand at room temperature for 10min; centrifuge at 12000×g, 4°C for 10min, discard the supernatant; add 1mL 75% (DEPC water) ethanol, wash the precipitate; centrifuge at 7500×g, 4℃ for 5min, discard the supernatant, repeat the washing twice; dry in ice bath for 10min, add 20μL DEPC water to dissolve, and detect the concentration. If the concentration is higher than 1000ng / μL, it needs to be diluted to less than 1000ng / μL. Use the reverse transcription kit (EasyScript One-Step gDNARemoval andcDNASynthesis SuperMix) to reverse transcribe RNA into cDNA and store at -20℃ for later use.

[0085] The transcription levels of genes related to the production of conjugated linoleic acid using linoleic acid as a substrate were detected. Primers were designed based on the (lin)oleate hydratase mcra gene sequence of Lactobacillus plantarum ST-III (ADN97339.1) or the mcra gene sequence of Lactobacillus plantarum ZS2058 (JF747255.1), and the mcra gene was amplified using the cDNA of Lactobacillus plantarum LP07-A12-10 and LP07-A12 as templates.

[0086] Based on the short-chain dehydrogenase / oxidoreductase dh gene sequence of Lactobacillus plantarum ST-III (ADN97274.1) or the dh gene sequence of Lactobacillus plantarum ZS2058 (KJ019513), the cDNA of Lactobacillus plantarum LP07-A12-10 and LP07-A12 was used as a template to amplify the dh gene.

[0087] Based on the acetoacetate decarboxylase dc gene sequence of Lactobacillus plantarum ST-III (ADN97275.1) or the dc gene sequence of Lactobacillus plantarum ZS2058 (KJ019514), the cDNA of Lactobacillus plantarum LP07-A12-10 and LP07-A12 was used as a template to amplify the dc gene.

[0088] All primers listed in Table 6 were sent to Shanghai Shenggong Biotechnology Co., Ltd. for synthesis and qRT-PCR kit ( Real-time fluorescence quantitative PCR was performed using II Multiplex Probe One-Step qRT-PCR SuperMix UDG).

[0089] Table 6: LP07-A12 primer sequences

[0090]

[0091] The results showed that the transcription level of the oleate hydratase mcra gene in LP07-A12-10 was 1.97 times that of the control strain LP07-A12, and the transcription levels of the dh and dc genes were not significantly increased. The mcra protein is related to stress resistance, so it can be understood to a certain extent that Lactobacillus plantarum can convert free linoleic acid into 10-HOE, and further into CLA or oleic acid, or even stearic acid, to reduce the stress of free linoleic acid on cells.

[0092] Using the genome of Lactobacillus plantarum LP07-A12-10 as a template, the mcra, dh and dc genes were amplified by PCR and sent to Shanghai Shenggong Biotechnology Co., Ltd. for sequencing. The results are shown in SEQ ID No. 2-4, which is verified to be correct.

[0093] In summary, the plant lactobacillus LP07-A12-10 of the present invention uses 6.0 mg / mL of soybean oil as a substrate, and finally achieves a CLA concentration of 1.331 mg / ml (including cis-9, trans-11-conjugated linoleic acid, trans-9, trans-11-conjugated linoleic acid and trans-10, cis-12-conjugated linoleic acid), with a conversion rate of 42.50%, of which c9, t11-CLA is 1.225 mg / ml, accounting for 92.04% of the total CLA content; CLNA is 0.303 mg / ml, with a conversion rate of 47.64%, of which c9, t11, c15-CLNA is 0.248 mg / ml, accounting for 81.85% of the total CLNA content, which is significantly higher than the prior art level.

Claims

1. Lactobacillus plantarum LP07-A12-10, this strain was deposited at the General Microbiology Center of China Microbiological Culture Collection Administration, Institute of Microbiology, Chinese Academy of Sciences on April 17, 2024, and its deposit number is CGMCC No.30362.

2. Use of Lactobacillus plantarum LP07-A12-10 according to claim 1 in the production of conjugated linoleic acid and / or conjugated linolenic acid.

3. The application according to claim 2, characterized in that The Lactobacillus plantarum LP07-A12-10 uses soybean oil as a substrate to ferment and produce conjugated linoleic acid and / or conjugated linolenic acid.

4. A method for producing conjugated linoleic acid and / or conjugated linolenic acid using soybean oil as a substrate by Lactobacillus plantarum LP07-A12-10, the method comprising the following steps: A. Bacteria Activation Lactobacillus plantarum LP07-A12-10 was diluted with sterile water, spread on an MRS solid culture medium plate, and cultured at 37° C. for 48 hours to obtain a single colony; the Lactobacillus plantarum LP07-A12-10 was deposited at the General Microbiology Center of the China Microbiological Culture Collection Administration Committee, Institute of Microbiology, Chinese Academy of Sciences on April 17, 2024, and its deposit number is CGMCC No.30362; B. Seed cultivation Use an inoculation loop to pick up a single colony obtained in step A, inoculate it into an anaerobic test tube containing MRS liquid culture medium, and culture it at 37°C and 200 rpm for 12 hours to obtain a seed solution; C. Shake flask fermentation The obtained seed liquid was inoculated into a stoppered ground-mouth conical flask filled with MRS liquid culture medium at a volume ratio of 2%, 1.0-10 mg / mL soybean oil was added to the culture medium, and cultured at 37° C. and 200 rpm for 48 h.

Images