A method for breeding fry of scorpionfish with Vibrio resistance

Abstract

The purpose of the present invention is to provide a breeding method for fry of scorpionfish with Vibrio resistance, by analyzing the susceptible and resistant populations of scorpionfish to screen molecular markers linked to disease resistance traits, and using the screened molecular markers to screen parents, and use them for genetic breeding of scorpionfish. The molecular markers related to the anti-Vibrio infection performance of scorpionfish screened by the present invention are used to screen parents resistant to Vibrio harveyi, thereby accelerating the genetic breeding and selection speed of scorpionfish and reducing the harm of bacterial diseases to scorpionfish culture.

Description

Technical Field

[0001] The invention belongs to the technical field of seed and seedling cultivation of aquatic species, and specifically provides a method for breeding fry of scorpionfish with Vibrio resistance. Background Art

[0002] Sebastes schlegelii is a ray-finned fish of the Scorpionfish genus of the Scorpionfish family of the order Scorpioniformes. It is a cold-temperate nearshore bottom fish that prefers to live in the muddy and sandy seabed of rocky reefs. It is mainly distributed in the Bohai Sea and the Yellow Sea, and is also found in the offshore rocky reefs of the East China Sea, as well as the Korean Peninsula and the coast of Japan. Sebastes schlegelii has delicious meat and rich nutrition. It can be stewed, fried, grilled, or eaten raw. It is known as the black grouper along the Shandong coast. At present, Sebastes schlegelii resources are the main target for the development of offshore proliferation and artificial breeding.

[0003] The breeding of Xu's flathead fish began in the late 1990s, initially mainly concentrated in Changdao, Shandong and other places. With the continuous development of breeding technology and the increase in market demand, the breeding scale of Xu's flathead fish has gradually expanded and become an important part of the local aquaculture industry. Its output has grown rapidly in the past 20 years.

[0004] During the breeding process, it was found that Vibrio harveyi has a strong pathogenicity to the flathead fish, which can cause serious lesions in the fish. When the flathead fish is infected with Vibrio harveyi, the fish will show major symptoms such as mouth opening, scale shedding, fin ulceration and body surface ulceration, especially the caudal fin ulceration is the most serious. After the fish is infected, bleeding and ulceration symptoms will also occur, leading to physical deterioration, loss of appetite and even death, causing huge economic losses to the breeding industry.

[0005] For many years, the breeding work of Xu's flathead catfish has mainly focused on selection and hybrid breeding. The development of modern biological high-tech has provided new means for germplasm improvement, especially the molecular marker technology-assisted breeding technology that has developed rapidly in recent years, which can greatly shorten the breeding process and change the backward situation of Xu's flathead catfish variety breeding as soon as possible. Summary of the invention

[0006] The present invention aims to provide a breeding method for fry of scorpionfish with Vibrio resistance, by analyzing the Vibrio susceptible population and the Vibrio resistant population of scorpionfish to screen molecular markers linked to the disease resistance trait, and using the screened molecular markers to screen parents, and use them for genetic breeding of scorpionfish.

[0007] The present invention first provides a molecular marker linked to resistance to Vibrio sesquipedalis, wherein the molecular marker is a microsatellite locus Se-5, and the nucleotide sequence thereof is as follows:

[0008] CTTGGCAAAAACCTTGACCCGGCCGGGGGAGGGGACCCAAT

[0009] CCTTTACCATATCAATTCCTACTTTGGTATTTCACATATCGTCGCC

[0010] TATTACTCTGCATGCTATTTCGCAATTGCTATATGGGTATAGTGTG

[0011] AGCAATAATGGCACTT(TG) n ATTCTCTGTGTGAACTTTGGGGTTCT TCGGACACCCGGAAGTATACATGCCACGTAGCTCTATCCCACCGG TGTTAAAGTGTTTAGCAATGACAGACCTCCTCATTTATTGTATGAGCTCATTCACAGTTGGCATGGCT;

[0012] Where n is a natural number 5-7;

[0013] In another aspect, the present invention provides a use of the molecular marker in screening individuals of Hystrix schrenkii with Vibrio resistance.

[0014] Another aspect of the present invention is to provide a method for screening a parent of P. schrenkiana for Vibrio resistance, which comprises screening an individual whose TG repeat number of the microsatellite marker is 6;

[0015] The method described is to amplify the nucleic acid sample of the screened individual by PCR primers, and then type or sequence the amplified product.

[0016] The specific sequence information of the primer pair used is as follows:

[0017] Forward primer F: GCAAAAACCTTGACCCGGC (SEQ ID NO: 2),

[0018] Reverse primer R: GGTGTCCGAAGAACCCCAAA (SEQ ID NO: 3),

[0019] The above primer amplification products, in which individuals with genotype 192 / 192 have better disease resistance than individuals with genotype 190 / 192 and 194 / 194.

[0020] The molecular markers related to the anti-Vibrio infection performance of the schullers are screened and obtained by the present invention, and are used for screening parents resistant to Vibrio harveyi, thereby accelerating the genetic breeding and selection speed of the schullers and reducing the harm of bacterial diseases to the cultivation of the schullers. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 :Screening of microsatellite loci with amplified products;

[0022] Figure 2 : Genotype detection results of disease-resistant population;

[0023] Figure 3 : Genotype test results of susceptible groups;

[0024] Figure 4 : Data graph of median lethal concentration of offspring of Hystrix xu's flathead. DETAILED DESCRIPTION

[0025] The present invention is described in detail below in conjunction with embodiments and drawings.

[0026] Example 1: Screening and establishment of susceptible and resistant populations of Vibrio harveyi

[0027] 1. Determination of the median lethal concentration of Vibrio harveyi

[0028] 960 Sebastes schlegelii were placed in a breeding pond for temporary breeding. The selected Sebastes schlegelii seedlings had an average body length of 5 cm, small individual differences, and good development. The salinity of the breeding pond was 3%, pH 8.5, and temperature 20°C. Adaptive breeding was performed for one week.

[0029] One week later, the fish were divided into 6 groups and cultured with Vibrio harveyi (2.5 x 10 8 cfu / mL) was diluted 10-fold to obtain 5 gradient dilutions, which were respectively added to each group. The blank group was used as the control group for infection experiments to determine the median lethal concentration (LC50).

[0030] One week after infection, the infection and mortality of the fish were calculated, and the median lethal concentration of Vibrio harveyi infecting the fish was 2.5x10 5 cfu / mL.

[0031] 2. Screening of individuals resistant to Vibrio harveyi

[0032] The surviving P. philippinarum selected in the above experiment was used as the mother for breeding. Among the offspring, 200 healthy and intact seedlings with a body length of 50.5 mm ± 0.9 mm, a total wet weight of 8.58 g ± 0.48 g were selected for inoculation with Vibrio harveyi (2.5 x 10 5cfu / mL) infection, 30 early dead and 30 late surviving were collected as susceptible and resistant groups, respectively. Tissues from each group were collected by non-destructive sampling and stored in anhydrous ethanol.

[0033] Example 2: Screening for microsatellite markers associated with Vibrio harveyi traits

[0034] 1. Screening of microsatellite loci

[0035] The microsatellite loci of H. schrenkiana were screened from NCBI, and primer pairs for amplifying microsatellite loci were designed. The designed primer pairs were synthesized, and the 5′ end of the forward primer was labeled with fluorescein. The synthesized primer pairs were used to perform preliminary amplification product screening using genomic DNA of 5 H. schrenkiana ( Figure 1 The microsatellite primer pairs with amplified products were selected for further analysis (Table 1).

[0036] Table 1: Primer information of microsatellites of P. xu

[0037]

[0038]

[0039] 2. Polymorphism amplification in susceptible and resistant populations of P. schrenkiana

[0040] The specific steps for extracting genomic DNA from Pseudomonas schrenkiana are as follows:

[0041] 1) Add 50 μl DNA lysis buffer to a 1.5 ml sterile centrifuge tube, cut 100 mg of the abdominal tissue of P. schrenkiana and chop it into small pieces; add 3-5 μl proteinase K and mix well, and digest at 37°C overnight or at 55°C for 2 hours.

[0042] 2) Add an equal amount of PCI solution, stir upside down for 20 minutes, centrifuge at 5000 rpm (room temperature) for 15 minutes, aspirate the supernatant and place it in a new centrifuge tube, and repeat 2-3 times.

[0043] 3) Add an equal amount of CIA solution, stir upside down for 20 minutes, centrifuge at 5000 rpm (room temperature) for 15 minutes, aspirate the supernatant and place it in a new centrifuge tube, repeat 2-3 times

[0044] 4) Add 1 / 10 volume of 3M sodium acetate to the supernatant, then add 2 times volume of anhydrous ethanol, gently invert several times, and place at -20℃ overnight.

[0045] 5) Centrifuge at 12000rpm and 4℃ for 30 minutes, discard the supernatant, add 1ml of anhydrous ethanol; centrifuge at 12000rpm and 4℃ for 1 minute, discard the supernatant, rinse 1-2 times with 70% ethanol, collect the precipitate after centrifugation, and invert it on absorbent paper to dry.

[0046] 6) Dissolve the dried DNA in 20-50 μl of 1×TE, measure the concentration and purity with a UV spectrophotometer before use, and store at 4°C for later use

[0047] Take 1 μl template DNA and dilute it 10 times, use UV spectrophotometer to measure A260 and A280 OD values, record the concentration and OD260 / OD280 ratio. OD260 / OD280 ratio greater than 1.8 confirms that the sample is of good purity and has no protein contamination.

[0048] The extracted DNA samples were subjected to agarose gel electrophoresis and the DNA concentration was detected using an enzyme reader. The results showed that the bands were clear and the extraction quality was good. The 260 / 280 value was between 1.8 and 2.0, which met the requirements of subsequent experiments.

[0049] 3. Microsatellite amplification in susceptible and resistant populations of P. schrenkiana

[0050] The susceptible group and the disease-resistant group DNA templates were divided into groups of 5, and the genomic DNA was mixed in equal volumes and used as templates for PCR amplification.

[0051] The PCR reaction was a 25 μL system: 20 ng DNA template, 1x PCR buffer, 0.2 mM dNTPs mixture, 1 μM primer, 1.4 mM MgCl2 and 0.25 U Tag DNA polymerase (Takara Inc.).

[0052] The PCR reaction conditions were as follows: 94°C for 3 minutes; 94°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute and 30 seconds, for a total of 35 cycles; extension at 72°C for 7 minutes; and insulation at 4°C.

[0053] The amplified products were detected by automatic fluorescence detection using ABI3730XL DNA analyzer, and the map files of each locus were generated using Genemapper4.0 software. The length of PCR amplified products and the peak fluorescence intensity were measured to obtain the genotype of each locus. Popgene32 was used to calculate the number of alleles (Na), the number of effective alleles (Ne), the expected heterozygosity (Ha), the observed heterozygosity (Ho), and the Hard-Weinberg equilibrium test (P value).

[0054] The results are shown in Table 2. A total of 32 alleles were amplified from the 10 microsatellite loci in the resistant population, while a total of 30 alleles were detected in the susceptible population.

[0055] Table 2: Genetic diversity analysis data of two populations of Hsu’s flathead fish with high temperature tolerance

[0056]

[0057] 4. Microsatellite locus markers related to growth

[0058] The susceptible and resistant groups of H. xu'sii were amplified, and the amplification map file of each sample was generated using Genemapper4.0 software to obtain the genotype of the microsatellite loci of each tested individual, and to determine the allele fragments unique to the resistant group.

[0059] The amplification results showed that the microsatellite locus Se-5 amplified a specific fragment in the disease-resistant population. The microsatellite locus Se-5 used a primer pair with the following sequence:

[0060] Forward primer F: GCAAAAACCTTGACCCGGC (SEQ ID NO: 2),

[0061] Reverse primer R: GGTGTCCGAAGAACCCCAAA (SEQ ID NO: 3),

[0062] A special 192bp band was amplified in the disease-resistant population, and there were 190 / 192 genotypes and 192 / 192 genotypes in the disease-resistant population ( Figure 2 ); in the susceptible population, only the 194 / 194 genotype was amplified ( Figure 3 ).

[0063] The nucleotide sequence of the microsatellite locus Se-5 is as follows:

[0064] CTTGGCAAAAACCTTGACCCGGCCGGGGGAGGGGACCCAATCC

[0065] TTTACCATATCAATTCCTACTTTGGTATTTCACATATCGTCGCCTA

[0066] TTACTCTGCATGCTATTTCGCAATTGCTATATGGGTATAGTGTGAG

[0067] CAATAATGGCACTTTGTGTGTGTGTGATTCTCTGTGTGAACTTTGG

[0068] GGTTCTTCGGACACCCGGAAGTATACATGCCACGTAGCTCTATCC

[0069] CACCGGTGTTAAAGTGTTTAGCAATGACAGACCTCCTCATTTATT

[0070] GTATGAGCTCATTCACAGTTGGCATGGCT (SEQ ID NO: 1).

[0071] Its core repeating unit is (TG) n Therefore, by using a primer pair with upstream and downstream sequences of SEQ ID NO: 2 and SEQ ID NO: 3, the parent population with disease resistance can be screened by whether the individual to be screened has a specific band; wherein the specific band is a 192 bp band.

[0072] Example 3: Screening of individuals of P. xueri that are resistant to Vibrio for seedling cultivation

[0073] In May 2022, 1,000 offspring individuals of Xu's flathead carp were tested at a Xu's flathead carp breeding company in Shandong Province. The genomic DNA of each Xu's flathead carp was obtained by non-destructive sampling. Microsatellite amplification detection was performed using a primer pair with upstream and downstream sequences of SEQ ID NO: 2 and SEQ ID NO: 3, and a band of 192 bp was screened.

[0074] 240 Schulichthys schulichthys with the specific fragment were selected from a total of 1,000 Schulichthys schulichthys, of which 80 had the 192 / 192 genotype. The selected Schulichthys schulichthys were used as parents for breeding.

[0075] The offspring of the fry of the fry were raised in an indoor cement pool. The water for breeding was taken from the sea area, and after sedimentation, filtration, and cooling by a cold water exchanger, it was pumped into the breeding pool. The salinity of the breeding pool was 3%, the pH was 8.5, and the temperature was 20℃. Every day, 3% of the weight of the fry was fed. The water in the whole pool was changed at 7 am and 7 pm every day, and the dead fry were picked out, and the residual bait and feces were removed. The offspring obtained were tested for Vibrio harveyi infection when they grew to a body length of about 50 mm.

[0076] According to the method in Example 1, the offspring of H. philippinarum were divided into 10 groups, and the cultured Vibrio harveyi liquid (2.5×10 6 cfu / mL) was diluted 3-fold to obtain 10 gradient dilutions, which were respectively put into each group. The same size of common mullet group was used as the control group for infection experiment to determine the median lethal concentration (LC50). The results showed that the median lethal concentration (LC50) of the screened mullet progeny was 7.5x10 6 The cfu / mL was significantly higher than that of the normal group, indicating better disease resistance.

[0077] The above results confirm that the Schulichthys schulii screened by the method provided by the present invention has good disease resistance to Vibrio harveyi and can be used for the breeding of excellent Schulichthys schulii varieties.

Claims

1. A method for screening a parent of Hystrix schrenkii having Vibrio resistance, characterized in that: The method described is to amplify the individual to be detected by using a PCR primer pair to amplify the molecular marker fragment of the following sequence: CTTGGCAAAAACCTTGACCCGGCCGGGGGAGGGGACCCAATCCTTTACCATATCAATTCCTACTTTGGTATTTCACATATCGTCGCCTATTACTCTGCATGCTATTTCGCAATTGCTATATGGGTATAGTGTGAGCAATAATGGCACTT(TG) n ATTCTCTGTGTGAACTTTGGGGTTCTTCGGACACCCGGAAGTATACATGCCACGTAGCTCTATCCCACCGGTGTTAAAGTGTTTAGCAATGACAGACCTCCTCATTTATTGTATGAGCTCATTCACAGTTGGCATGGCT, where n is a natural number from 5 to 7; After typing or sequencing the amplified product, individuals with a genotype of 192 / 192 are screened; the primer pair used has a forward primer sequence of SEQ ID NO: 2 and a reverse primer sequence of SEQ ID NO: 3.

Images