Molecular marker for rapid detection of apple fruit firmness and ripening stage and application thereof

Abstract

The application belongs to but is not limited to the technical field of molecular breeding, and discloses a molecular marker for rapid detection of apple fruit hardness and ripening period and application thereof. The molecular marker for rapid detection of apple fruit hardness and ripening period comprises: SNP base A / A at the 517th position of the coding region of MdNAC5 corresponds to early maturity or small hardness germplasm, and SNP base A / T or T / T corresponds to late maturity or extremely hard germplasm. The application verifies the significant SNP on the coding region of MdNAC5 through resequencing and KASP technology, SNP base A / A at the 517th position corresponds to early maturity or small hardness germplasm, and SNP base A / T or T / T corresponds to late maturity or extremely hard germplasm. The SNP site can be used to develop a molecular marker for detecting apple fruit hardness and ripening period. The method for product typing after PCR amplification by designing specific primers at the site is fast, efficient and accurate, and can effectively improve the breeding efficiency of apples and shorten the breeding process.

Description

Technical Field

[0001] The present invention belongs to but is not limited to the field of molecular breeding technology, and in particular relates to a molecular marker for rapid detection of apple fruit firmness and maturity and application thereof. Background Art

[0002] Apple (Malus × domestica Borkh.) is a global commercial crop. In 2022, my country's apple cultivation area reached 2.1291 million hectares, ranking first in the world. Apple fruit firmness, a key indicator of intrinsic fruit quality, influences ripening and determines storage characteristics, ultimately influencing consumer choice and the market competitiveness of the product. Improving fruit quality is key to enhancing market competitiveness and promoting sustainable development of the industry.

[0003] Apple hybrid breeding is the most important and effective way to improve fruit quality. Domestic and foreign apple breeding units mainly use "large-scale" hybridization to create a large number of hybrid offspring. However, apples are perennial woody plants with complex genetic backgrounds and high heterozygosity. Therefore, the cost and workload of variety breeding are high, which makes the breeding cycle longer and seriously affects the process of selecting new apple varieties. With the application and development of sequencing technology and the application of genome sequencing in apples, the current breeding methods used in apple breeding are all based on conventional hybridization, using genetic maps, cluster segregation analysis or whole-genome association analysis to explore the variation sites of key genes for apple-related traits. Among them, competitive allele-specific PCR (KASP) technology is a high-throughput genotyping technology mainly based on single nucleotide polymorphisms (SNPs). KASP typing is based on the specificity of the primer terminal base for matching. This method is simple, fast and has a high accuracy rate. KASP can be used to quickly detect the firmness and maturity of apple fruit. When used in the early selection of target traits, it can greatly shorten the breeding period, improve breeding efficiency, and provide an important reference for the application of apple molecular breeding.

[0004] Currently, a large number of SNPs related to apple fruit firmness and maturity have been located, but the vast majority of SNPs that can be used for early selection are relatively few. The reason is that most SNPs have a small contribution rate to the phenotype, poor repeatability between different populations or between different years, and poor accuracy, making it difficult to quickly detect apple fruit firmness and maturity in the early stages of breeding and apply them to breeding improvement. Summary of the Invention

[0005] In response to the problems existing in the prior art, the present invention provides a molecular marker for rapid detection of apple fruit firmness and maturity and its application, and in particular relates to a SNP molecular marker for identifying the firmness and early or late maturity of apple fruit.

[0006] The present invention is achieved by providing a molecular marker for rapid detection of apple fruit firmness and maturity, comprising a single nucleotide polymorphism (SNP) site at the 517th base from the 5' end of the coding region of the gene MdNAC5, wherein the genotype of the SNP site is closely linked to the apple fruit firmness and maturity traits; and the gene sequence is as shown in SEQ ID NO: 1 (ATGGAGTGCACCGACTCGTCCGCGGGCTCACAACAGCAACAGCACCAGC AGCCGCCACCTCCGCAGCCAAACCTGCCGCCCGGGTTCCGCTTCCACCCGACGGACGAAGAGCTAGTCGTCCACTATCTCAAGAAAAAGGCCACCTCCGCTCCCCTCCCGGTTGCTATTATCGCTGAAGTCGACCTTTACAAGTTCGACCCCTGGGAGCTCCCAGCTAAGGCTACGTTTGGAGAGCAAGAGTGGTATTTTTTCAGTCCTAGGGACCGGAAGTACCCGAACGGAGCGAGACCCAATAGGGCAG CGACTTCCGGGTATTGGAAAGCGACGGGGACTGATAAGCCGGTGCTGACTTCCGGCGATACTCAGAAAGTTGGTGTGAAAAAAGCACTTGTGTTCTATGGAGGAAAACCCCCAAAAGGAATTAAAA CCAATTGGATTATGCACGAGTACAGGCTTGCTGATAACAAGCCCAACAACAAGCCACCTGGGTGTGACTTGGGCAACAAGAAGAACTCC(A / T)TGAGGCTTGATGATTGGGTGCTGTGTAGAATT) as shown.

[0007] Furthermore, the genotype of the 517th base from the 5' end in the gene sequence is A / A, the genotype of the apple germplasm is homozygous, the fruit has low firmness and matures early.

[0008] Furthermore, the genotype of the 517th base from the 5' end of the gene sequence is A / T, the apple germplasm genotype is heterozygous, the fruit has medium firmness and medium maturity.

[0009] Furthermore, the genotype of the 517th base from the 5' end in the gene sequence is T / T, the genotype of the apple germplasm is homozygous, the fruit is firm and matures late.

[0010] Furthermore, the molecular marker primers for rapid detection of apple fruit firmness and maturity include upstream typing primer F1, upstream typing primer F2 and downstream universal primer R,

[0011] The nucleic acid sequence of the upstream typing primer F1 is A517-F1: 5′-GAAGGTGACCAAGTTCATGCTGACTTGGGCAACAAGAAGAACTCCA-3′;

[0012] The nucleic acid sequence of the upstream typing primer F2 is A517-F2: 5′-GAAGGTCGGAGTCAACGGATTGACTTGGGCAACAAGAAGAACTCCT-3′;

[0013] The nucleic acid sequence of the downstream universal primer R is A517-R: 5'-TTCTTGTAAATTCTACACAGCACCC-3'.

[0014] Another object of the present invention is to provide a molecular marker for rapid detection of apple fruit firmness and maturity and its application in apple breeding.

[0015] Another object of the present invention is to provide a SNP molecular marker for rapid detection of apple fruit firmness and maturity, and to apply it in identifying apple fruit firmness and maturity early or late germplasm resources.

[0016] Furthermore, a method for applying the SNP molecular marker for rapid detection of apple fruit firmness and maturity in identifying apple fruit firmness and maturity germplasm resources includes the following steps: extracting genomic DNA of the sample to be tested; using the extracted DNA as a template, performing PCR amplification using the primer combination A517-F1, A517-F2 and A517-R; and performing genotyping on the PCR products to determine the fruit firmness and maturity of the sample to be tested.

[0017] Another object of the present invention is to provide an application of a SNP molecular marker for rapid detection of apple fruit firmness and maturity in apple molecular marker-assisted breeding.

[0018] Another object of the present invention is to provide a gene MdNAC5 for regulating the firmness and ripening period of apple fruit. The gene MdNAC5 is MD03G1222600. By using genetic engineering methods, overexpressing two genotypes of apple MdNAC5 promotes the reduction of apple firmness and early ripening of fruit.

[0019] In combination with the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solutions to be protected by the present invention are as follows:

[0020] First, the present invention used the Illumina HiSeq 2500 sequencing platform to resequence the genomes of 294 F1 hybrids of 'Fuji' and 'Pink Lady.' A high-density genetic map was constructed by base calling, removing low-quality data, and aligning the genomes with a reference genome. The present invention also measured the firmness of the fruit of the hybrids using a texture analyzer and analyzed the fruit maturity. Correlation analysis between the obtained phenotypic data and the map revealed that the gene MdNAC5 significantly contributes to both fruit firmness and early maturity. A single polymorphism (SNP) at position 517 from the 5' end of the MdNAC5 coding region can distinguish fruit firmness and early maturity in hybrids. Therefore, the present invention developed a molecular marker for selecting apple varieties for fruit firmness and early maturity based on this SNP. Furthermore, the present invention verified the SNP at position 517 in the MdNAC5 coding region in other hybrids and germplasm resources using the KASP technique. The verification results found that the SNP position bases of high hardness and late-maturing germplasm are T / T or A / T, and the SNP position bases of low hardness and early-maturing germplasm are A / A. This SNP site can be used to develop molecular markers for the firmness and maturity of apple fruit.

[0021] The present invention utilizes KASP technology to design specific primers for SNP at the mutation site for PCR amplification or sequencing, thereby solving the problem of breeding apple varieties with suitable fruit firmness and early or late maturity, and can screen apple germplasm resources with suitable fruit firmness and later maturity.

[0022] Second, the expected benefits and commercial value of the present invention after transformation are as follows: The SNP at base 517 from the 5' end of the MdNAC5 coding region can distinguish between fruit firmness and early maturity in hybrid offspring. By designing specific primers for PCR amplification and sequencing or KASP identification at this site, this method can make early apple breeding more efficient and targeted. By identifying offspring with moderate firmness and maturity, the breeding process can be accelerated and the hybrid breeding period shortened. Traditional breeding methods rely on extensive phenotypic screening, while the KASP markers of the present invention enable early screening through genotyping, significantly reducing the workload and breeding costs of apple hybrids. Compared with traditional SNP marker technology, KASP markers offer advantages in cost-effectiveness and accuracy. Furthermore, KASP marker technology facilitates the study and verification of gene function, supporting basic research on apple fruit firmness, thereby promoting progress and technological innovation in the field of agricultural biotechnology. Through efficient genotyping analysis, KASP markers provide a deeper understanding of crop genetic characteristics and advance apple genetic improvement research.

[0023] The technical solution of this invention fills a technological gap in the industry, both domestically and internationally: Traditional molecular marker development typically requires complex experimental processes and extensive experimental verification, while KASP marker technology simplifies this process through optimized PCR methods. Other genotyping methods, such as SNP chips and traditional PCR, are costly, complex, and have low throughput. KASP markers, with their high precision and high throughput, fill this gap. Furthermore, functional research on genes related to apple fruit firmness and maturity requires precise genotyping and phenotypic data, and the high-precision typing of KASP markers provides the necessary technical support for gene function research. Therefore, KASP markers' rapid typing of apple fruit firmness and maturity fills the gaps in traditional marker technology applications in hybrid breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Schematic diagram of the MdNAC5 gene structure and the distribution of fruit firmness and maturity at the variant SNP sites provided by an embodiment of the present invention; A is the MdNAC5 gene located after resequencing the genomes of 294 F1 hybrid offspring of 'Fuji' and 'Pink Lady' using the Illumina HiSeq 2500 sequencing platform, constructing a high-density genetic map, and performing association analysis with the fruit firmness and maturity phenotypes. The figure shows the distribution of SNP variants in the coding region of the MdNAC5 gene; B is the variation distribution of SNPs at positions 30,697,394 of Chr3 (base 517 of the MdNAC5 coding region) in the 294 hybrid offspring; C is the relationship between different genotypes and fruit firmness before and after the SNP variant at position 517 of the MdNAC5 coding region; D is the relationship between different genotypes and fruit maturity before and after the SNP variant at position 517 of the MdNAC5 coding region.

[0025] Figure 2 This is a diagram showing the genotyping results of different SNP genotypes at base 517 of the gene MdNAC5 in some varieties.

[0026] Figure 3 This is the protein spatial structure prediction result of the two genotypes of the gene MdNAC5.

[0027] Figure 4 This is a diagram showing the verification results of the transcriptional activity of transcripts of two genotypes of the gene MdNAC5 in yeast.

[0028] Figure 5 This is a schematic diagram of the fruit characteristics and firmness of tomatoes after overexpression of the two genotypes of the gene MdNAC5. DETAILED DESCRIPTION

[0029] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0030] In this study, the genomes of 294 F1 hybrids of 'Fuji' and 'Pink Lady' were resequenced using the Illumina HiSeq 2500 sequencing platform. A high-density genetic map was constructed, and the MdNAC5 gene was mapped after association analysis with fruit firmness and maturity phenotypes. Analysis of SNPs in the MdNAC5 coding region of these 294 hybrids revealed that only the mutation at position 30,697,394 on Chr3 (base 517 in the MdNAC5 coding region) was non-synonymous. The MdNAC5 genotypes derived from this site can distinguish between fruit firmness and early maturity phenotypes in hybrids. Therefore, this SNP site has been used to develop molecular markers for selecting apple varieties tailored to fruit firmness and early maturity.

[0031] The embodiment of the present invention also provides primers for SNP molecular markers for rapid detection of apple fruit firmness and maturity, including an upstream typing primer F1, an upstream typing primer F2, and a downstream universal primer R; wherein the nucleic acid sequence of the upstream typing primer F1 is A517-F1: 5'-GAAGGTGACCAAGTTCATGCTGACTTGGGCAACAAGAAGAACTCCA-3'; the nucleic acid sequence of the upstream typing primer F2 is A517-F2: 5'-GAAGGTCGGAGTCAACGGATTGACTTGGGCAACAAGAAGAACTCCT-3'; and the nucleic acid sequence of the downstream universal primer R is A517-R: 5'-TTCTTGTAAATTCTACACAGCACCC-3'.

[0032] In the embodiment of the present invention, the significant SNPs in the MdNAC5 coding region were verified using the KASP technology using the above-mentioned primers; the verification results showed that the SNP position bases of varieties or offspring with low fruit firmness and early maturity were A / A, the SNP position bases of varieties or offspring with moderate fruit firmness and medium to late maturity were A / T, and the SNP position bases of varieties or offspring with high fruit firmness and late maturity were T / T.

[0033] The embodiment of the present invention also provides an application of a SNP molecular marker for rapid detection of apple fruit firmness and maturity in apple molecular marker-assisted breeding.

[0034] The embodiment of the present invention also provides a SNP for rapid detection of apple fruit firmness and maturity in the gene MdNAC5 for regulating fruit firmness and early or late maturity.

[0035] The present invention also provides a gene MdNAC5 (MD03G1222600) for regulating the firmness and ripening of apple fruit. By using genetic engineering, overexpression of two apple genotypes of MdNAC5 promotes reduced apple firmness and early fruit ripening.

[0036] The specific application fields or related products of the present invention.

[0037] The present invention belongs to, but is not limited to, the field of molecular breeding technology, and more particularly relates to a molecular marker for rapid detection of apple fruit firmness and maturity, and its application. The KASP marker described in the embodiments of the present invention can be used for rapid screening in the early selection of apple hybrid offspring, enabling targeted selection based on fruit firmness and maturity. Using the KASP marker for precision breeding can more quickly identify and select apple individuals with superior fruit firmness and maturity traits, accelerating the breeding process.

[0038] Relevant evidence of the technical effects achieved by the embodiments of the present invention.

[0039] (I) Acquisition of the MdNAC5 gene and verification of SNPs in the coding region

[0040] In this study, the genomes of 294 F1 hybrid offspring from 'Fuji' and 'Pink Lady' were resequenced using the Illumina HiSeq 2500 sequencing platform. A high-density genetic map was constructed, and the MdNAC5 gene was mapped after association analysis with fruit firmness and maturity phenotypes. Analysis of SNPs in the MdNAC5 coding region of these 294 hybrid offspring revealed that only the mutation at position 30,697,394 on Chr3 (base 517 in the MdNAC5 coding region) was non-synonymous. The MdNAC5 genotypes derived from this site can distinguish between fruit firmness and early or late maturity phenotypes in the hybrid offspring. Based on this, the study used KASP technology to identify significant SNPs in the MdNAC5 coding region of progeny from several cultivars. This SNP was then used to develop a SNP molecular marker for rapid detection of apple fruit firmness and maturity.

[0041] The specific method is as follows:

[0042] 1. DNA Extraction from Apple Leaves

[0043] Leaves of apple hybrids and cultivars were collected at the Baishui Apple Experimental Station of Northwest Agriculture and Forestry University, wrapped in tin foil, labeled, and stored in liquid nitrogen.

[0044] The samples were ground into powder in liquid nitrogen and placed in siliconized tubes;

[0045] Preheat CTAB in a 65°C water bath, add 700 μL CTAB and 40 μL β-mercaptoethanol to the sample, vortex mix, and then place in a 65°C water bath for 10 min;

[0046] After the water bath, the sample was taken out and cooled to room temperature, and 700 μL of chloroform:isoamyl alcohol (24:1) was added and mixed;

[0047] The sample was centrifuged at 12000 rpm for 10 min at 4°C;

[0048] Transfer 500 μL of supernatant to a new siliconized tube, add 500 μL of chloroform:isoamyl alcohol (24:1) to the sample, and mix thoroughly by inversion;

[0049] The sample was centrifuged at 12000 rpm for 10 min at 4°C;

[0050] 300 μL of supernatant was transferred to a new siliconized tube, and 30 μL of 3 mol / L sodium acetate (pH=5.2) and 600 μL of anhydrous ethanol were added to the sample. The tube was mixed by inversion and allowed to stand at -20°C overnight.

[0051] The mixture was centrifuged at 12000 rpm at 4°C for 10 min, the supernatant was discarded, 500 μL of 70% ethanol was added, the mixture was centrifuged at 12000 rpm at 4°C for 10 min, and the supernatant was discarded.

[0052] Add 500 μL of anhydrous ethanol, centrifuge at 12000 rpm at 4°C for 10 min, discard the supernatant, and dry in a fume hood;

[0053] Dissolve the solution in 30 μL of water and store at -20°C. Dilute the solution to a concentration of 10-50 ng / ul before use.

[0054] 2. KASP verification of SNP sites in the MdNAC5 coding region

[0055] The coding region fragment containing the SNP was amplified using the DNA of the apple varieties and progeny extracted above as templates. The system is as follows:

[0056] Mix 5ul

[0057]

[0058] The KASP reaction procedure was as follows: (1) pre-denaturation at 95°C for 10 min; (2) denaturation at 95°C for 15 s, followed by annealing and extension at 61–55°C for 60 s, for approximately 10 cycles, with the annealing temperature decreasing by 0.6°C each cycle to 55°C; (3) denaturation at 95°C for 15 s, followed by annealing and extension at 50°C for 60 s, for 30–50 cycles; (4) fluorescence reading at 30°C for 1 min. PCR amplification and fluorescence signal reading were performed using an ABI StepOnePlus fluorometer.

[0059] Finally, the genotype of the apple germplasm to be tested is determined based on the position of the typing point. Figure 2 As shown, through genotyping detection, if the genotype result of the 517th base SNP in the coding region is A / A ( Figure 2 If the SNP genotype result of the 517th base in the coding region is A / T ( Figure 2 If the SNP genotype result of the 517th base in the coding region is T / T( Figure 2 The apple sample to be tested is judged to be late-ripening and extremely hard.

[0060] (II) Comparison of protein structure and transcriptional activity between two genotypes of MdNAC5

[0061] 1. Protein structure prediction of two MdNAC5 genotypes

[0062] The amino acid sequences of the two genotype proteins of MdNAC5 were obtained, and the two protein sequences of MdNAC5 were modeled from scratch using Alphafold. The protein spatial structure is shown in Figure 3 As shown, the protein structure when the SNP genotype at base 517 in the coding region is A / A is Figure 2 The yellow color on the middle left indicates the protein structure when the SNP genotype at position 517 in the coding region is T / T. Figure 2 In purple on the middle right, the spatial conformation of the protein has changed.

[0063] 2. Analysis of protein activity of two MdNAC5 genotypes

[0064] The full-length CDS of the two genotypes of MdNAC5 were cloned and ligated into the pGBKT7 vector, transformed into the Y2HGold yeast strain and diluted to a uniform concentration, and cultured in SD / -Trp, SD / -Trp / X-α-Gal (40 μg mL-1), and SD / -Trp / X-α-Gal / AbA (200 ng mL-1) media for 3-5 days. Figure 4 As shown, the yeast growth when the SNP genotype at the 517th base of the coding region is A / A is stronger than the yeast growth when the SNP genotype at the 517th base of the coding region is T / T, which indicates that the MdNAC5 protein activity is stronger when the SNP genotype at the 517th base of the coding region is A / A.

[0065] (III) Characteristic analysis of two genotypes of MdNAC5-overexpressing tomatoes

[0066] The CDS sequences of two MdNAC5 genotypes were cloned and ligated into the plant overexpression vector pCAMIBA2300-GFP. The tomato cotyledons were transformed using Agrobacterium-mediated genetic transformation to obtain two homozygous genotype tomato overexpression materials.

[0067] Agrobacterium infection of tomato process: Agrobacterium was shaken in the incubator until OD 600 Set the slurry to approximately 0.8, then spin at 5000 rpm for 5 minutes to harvest the bacteria. Wash the bacteria twice with the resuspension solution. Discard the supernatant and resuspend the bacteria with the resuspension solution. Place sterile tomato cotyledons in the resuspension solution. Use a scalpel to quickly cut off the ends of the cotyledons. Place the leaves in the bacterial solution and shake them in the dark for 10 minutes. Drain the leaves with filter paper. After blotting with sterile filter paper, spread the leaves face down on the co-culture medium and incubate at room temperature in the dark. After one day, remove the leaves and replace them with differentiation medium. Once differentiated plants have formed, cut them off and place them in rooting medium for rooting. Transplant and culture to the T2 generation, and then observe and measure the fruit phenotype.

[0068] Two genotypes of overexpressing tomato plants were obtained by Agrobacterium-mediated method, such as Figure 5 As shown in the figure, the two genotypes overexpressing tomatoes mature earlier than the wild type and have smaller fruit firmness; A (The SNP genotype at base 517 in the coding region is A / A) The fruit ripening time of tomato lines overexpressing MdNAC5 was shorter than that of T (The SNP genotype at base 517 in the coding region is T / T) and the fruit firmness is also smaller.

[0069] The above description is only a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with this technical field within the technical scope disclosed by the present invention and within the spirit and principles of the present invention should be covered by the scope of protection of the present invention.

Claims

1. Application of a reagent for detecting molecular markers in apple fruit firmness and maturity breeding, characterized in that: The molecular marker is an apple gene sequence with a nucleotide sequence as shown in SEQ ID NO: 1, wherein the 517th base from the 5' end of the gene sequence is a SNP site, and the genotype of the SNP site is closely linked to the apple fruit firmness and maturity traits, wherein the genotype of the 517th base from the 5' end of the gene sequence is A / A, the apple germplasm genotype is homozygous, the fruit firmness is small, and the maturity period is early; the genotype of the 517th base from the 5' end of the gene sequence is A / T, the apple germplasm genotype is heterozygous, the fruit firmness is medium, and the maturity period is medium; the genotype of the 517th base from the 5' end of the gene sequence is T / T, the apple germplasm genotype is homozygous, the fruit firmness is large, and the maturity period is late.

2. A reagent for detecting molecular markers is used in identifying apple fruit firmness and maturity stage germplasm resources, characterized in that: The molecular marker is an apple gene sequence with a nucleotide sequence as shown in SEQ ID NO: 1, wherein the 517th base from the 5' end of the gene sequence is a SNP site, and the genotype of the SNP site is closely linked to the apple fruit firmness and maturity traits, wherein the genotype of the 517th base from the 5' end of the gene sequence is A / A, the apple germplasm genotype is homozygous, the fruit firmness is small, and the maturity period is early; the genotype of the 517th base from the 5' end of the gene sequence is A / T, the apple germplasm genotype is heterozygous, the fruit firmness is medium, and the maturity period is medium; the genotype of the 517th base from the 5' end of the gene sequence is T / T, the apple germplasm genotype is homozygous, the fruit firmness is large, and the maturity period is late.

3. The use according to claim 2, characterized in that The method comprises the following steps: extracting genomic DNA of the sample to be tested; using the extracted DNA as a template, performing PCR amplification using primer combination A517-F1, A517-F2 and A517-R; performing genotyping on the PCR product to determine the fruit firmness and maturity of the sample to be tested; wherein A517‐F1: 5‐GAAGGTGACCAAGTTCATGCTGACTTGGGCAACAAGAAGAACTCCA‐3'; A517‐F2: 5‐GAAGGTCGGAGTCAACGGATTGACTTGGGCAACAAGAAGAACTCCT-3'; A517‐R: 5'‐TTCTTGTAAATTCTACACAGCACCC‐3'.

Images