A siRNA for regulating AGT gene expression and its use

Abstract

The present disclosure provides a siRNA for regulating AGT gene expression and its application. The siRNA has been shown to have a significant inhibitory effect on AGT gene expression in cell experiments and can be used to develop drugs for treating and / or preventing diseases related to AGT gene expression.

Description

Technical Field

[0001] The present invention belongs to the field of small nucleic acid drugs, and specifically relates to a siRNA for regulating AGT gene expression and its application. Background Art

[0002] Nucleic acid drugs, especially oligonucleotide drugs, are widely used due to their simple synthesis and high activity. Oligonucleotide drugs usually include antisense oligonucleotides (ASO), small interfering RNA (siRNA), micro RNA (miRNA) and nucleic acid aptamers.

[0003] RNA interference is a natural defense mechanism against foreign genes. siRNA can knock out target genes by recognizing specific sequences and degrading target mRNA.

[0004] The effective molecules of classical RNA interference are composed of the iconic 19 + 2 nucleotide polymer structure, that is, a double helix composed of 21 nucleotide RNA molecules and 19 corresponding base nucleotide molecules, including a 2-nucleotide 3' end overhang. One strand of siRNA, the guide strand or antisense strand, is complementary to the mRNA transcript of the target gene, and the other strand is labeled as the passenger strand or sense strand. The siRNA antisense strand guides Argonne protein to complement the target transcript and become part of the RNA-guided silencing complex. The complete complementarity of the siRNA antisense strand with the target leads to the breakage of the target transcript at the opposite position of the antisense strand 10-11 under the catalysis of Argonne protein.

[0005] By chemically modifying the synthetic antisense oligonucleotides, the serum stability of the antisense oligonucleotides can be increased, thereby effectively inhibiting the expression of the target gene.

[0006] Chemical modification of oligonucleotide structure is an effective way to improve its activity. Chemically modified and transformed oligonucleotides can improve their stability to nucleases, affinity to RNA, and better promote cellular endocytosis and tissue targeting, thereby improving their activity. All oligonucleotide drugs that have been marketed have been chemically modified. Since the first nucleic acid drug Fomivirsen (Vitravene) was approved for marketing in 1998, the chemical modification and transformation technology of nucleic acid drugs has been continuously upgraded.

[0007] Based on the basic structure of oligonucleotides, namely the base, sugar ring, phosphate backbone and end, chemical modification can be performed in four parts.

[0008] Base modification: mainly divided into three forms: purine modification, pyrimidine modification and base substitution. Purine modification includes N6-methyladenosine, N1-methyladenosine, 7-methylguanylate modification; pyrimidine modification includes 3-methyluridine, 5-methyluridine, 5-methylcytosine, N4-acetylcytidine, pseudouridine, thiouridine, propyne uridine and dihydrouridine.

[0009] Sugar ring modification: mainly divided into sugar ring modification and replacement. Sugar ring modification includes 2'-modification, 4'-modification, 5'-modification and isomeric modification, as well as the combination of these modifications.

[0010] Modification of the phosphate backbone: Since the hydrolysis of the phosphodiester bond of oligonucleotides by nucleases in the body is the main reason for the rapid degradation of oligonucleotides in the body, choosing other suitable analogs to replace the phosphodiester bond backbone can increase its stability. The main modification methods of the phosphate backbone are: thiophosphate, methyl phosphate, selenophosphate, methyl borophosphate or dithiophosphate; or replacing the entire phosphate group between nucleosides with a group that does not contain a phosphorus atom, such as replacing the P atom with C, S and N atoms to form a guanidine group, S-methylthiourea, etc.

[0011] Terminal modification: Covalently coupling special groups at the 5' or / and 3' end of siRNA can enhance affinity with cells, tissue selectivity and cell targeting. Modifying fat-soluble small molecules at the end can improve their compatibility with cell membranes and increase the efficiency of cell entry. The asialoglycoprotein receptor (ASGPR) is an endocytic receptor specifically expressed by hepatocytes. The coupling of ASGPR's high-affinity ligand N-acetylgalactosamine (GalNAc) with siRNA can achieve liver-targeted delivery of oligonucleotide drugs.

[0012] Angiotensinogen (AGT) protein is a secretory protein that is mainly expressed in the liver in the human body. Other tissues that express AGT include the brain, gallbladder, heart, and kidneys. AGT protein is cleaved by renin to produce angiotensin I (Ang I), which is then cleaved by angiotensin converting enzyme (ACE) to produce physiologically active angiotensin II (Ang II). Ang II binds to angiotensin receptors (ATR), causing vasoconstriction and increasing blood pressure.

[0013] Although there are a large number of antihypertensive drugs currently used to treat hypertension, more than two-thirds of patients still have difficulty controlling their blood pressure with one drug and need two or more drugs to control their blood pressure, which leads to decreased compliance with the therapy and increased potential side effects, affecting the effectiveness of the therapy. Therefore, there is a need in the art for alternative therapies and combination therapies for patients with angiotensinogen-related diseases. Summary of the invention

[0014] In order to solve the problem that the inhibitory effect of siRNA against angiotensinogen (AGT) in the prior art is not good, the present disclosure provides a siRNA. After the drug constructed by the siRNA enters the blood, it is endocytosed into the cell by the liver cell and stored in the endosomal structure of the cell. After the siRNA is released from the endosome or lysosome and enters the cytoplasm, it binds to the RNA-induced silencing complex (RISC), and binds to the mRNA transcribed from the AGT gene under the mediation of the antisense strand, inducing mRNA degradation, thereby inhibiting the translation of the AGT protein. As an upstream protein of the renin-angiotensin-aldosterone system (RAAS), inhibiting its expression will fundamentally inhibit the effect of the RAAS system in raising blood pressure, thereby lowering blood pressure. The siRNA provided by the present disclosure can significantly reduce the expression of the AGT gene in in vitro cell experiments.

[0015] In order to solve the above technical problems, the present disclosure provides a technical solution: a siRNA (small interfering RNA), wherein the siRNA comprises a sense strand and an antisense strand, and the siRNA comprises any of the following oligonucleotide duplexes:

[0016] 1) the sense strand has a sequence as shown in SEQ ID NO: 34 or a fragment thereof, or a modified sequence thereof, and the antisense strand has a sequence as shown in SEQ ID NO: 82 or a fragment thereof, or a modified sequence thereof;

[0017] 2) the sense strand has a sequence as shown in SEQ ID NO: 39 or a fragment thereof, or a modified sequence thereof, and the antisense strand has a sequence as shown in SEQ ID NO: 87 or a fragment thereof, or a modified sequence thereof;

[0018] 3) the sense strand has a sequence as shown in SEQ ID NO: 23 or a fragment thereof, or a modified sequence thereof, and the antisense strand has a sequence as shown in SEQ ID NO: 71 or a fragment thereof, or a modified sequence thereof;

[0019] 4) the sense strand has a sequence as shown in SEQ ID NO: 17 or a fragment thereof, or a modified sequence thereof, and the antisense strand has a sequence as shown in SEQ ID NO: 65 or a fragment thereof, or a modified sequence thereof;

[0020] 5) the sense strand has a sequence as shown in SEQ ID NO: 35 or a fragment thereof, or a modified sequence thereof, and the antisense strand has a sequence as shown in SEQ ID NO: 83 or a fragment thereof, or a modified sequence thereof;

[0021] 6) the sense strand has a sequence as shown in SEQ ID NO: 45 or a fragment thereof, or a modified sequence thereof, and the antisense strand has a sequence as shown in SEQ ID NO: 93 or a fragment thereof, or a modified sequence thereof;

[0022] 7) the sense strand has a sequence as shown in SEQ ID NO: 27 or a fragment thereof, or a modified sequence thereof, and the antisense strand has a sequence as shown in SEQ ID NO: 75 or a fragment thereof, or a modified sequence thereof;

[0023] 8) the sense strand has a sequence as shown in SEQ ID NO: 30 or a fragment thereof, or a modified sequence thereof, and the antisense strand has a sequence as shown in SEQ ID NO: 78 or a fragment thereof, or a modified sequence thereof;

[0024] 9) the sense strand has a sequence as shown in SEQ ID NO: 22 or a fragment thereof, or a modified sequence thereof, and the antisense strand has a sequence as shown in SEQ ID NO: 70 or a fragment thereof, or a modified sequence thereof;

[0025] The modified sequence comprises one or more modified nucleotides.

[0026] In a preferred embodiment of the present disclosure, the length of the sense strand is 19-27 nucleotides.

[0027] In a preferred embodiment of the present disclosure, the antisense strand is 19-27 nucleotides in length.

[0028] In a preferred embodiment of the present disclosure, the siRNA comprises any of the following oligonucleotide duplexes:

[0029] 1) the sense strand has a sequence as shown in SEQ ID NO: 34 or a modified sequence of SEQ ID NO: 34, and the antisense strand has a sequence as shown in SEQ ID NO: 82 or a modified sequence of SEQ ID NO: 82;

[0030] 2) the sense strand has a sequence as shown in SEQ ID NO: 39 or a modified sequence of SEQ ID NO: 39, and the antisense strand has a sequence as shown in SEQ ID NO: 87 or a modified sequence of SEQ ID NO: 87;

[0031] 3) the sense strand has a sequence as shown in SEQ ID NO: 23 or a modified sequence of SEQ ID NO: 23, and the antisense strand has a sequence as shown in SEQ ID NO: 71 or a modified sequence of SEQ ID NO: 71;

[0032] 4) the sense strand has a sequence as shown in SEQ ID NO: 17 or a modified sequence of SEQ ID NO: 17, and the antisense strand has a sequence as shown in SEQ ID NO: 65 or a modified sequence of SEQ ID NO: 65;

[0033] 5) the sense strand has a sequence as shown in SEQ ID NO: 35 or a modified sequence of SEQ ID NO: 35, and the antisense strand has a sequence as shown in SEQ ID NO: 83 or a modified sequence of SEQ ID NO: 83;

[0034] 6) the sense strand has a sequence as shown in SEQ ID NO: 45 or a modified sequence of SEQ ID NO: 45, and the antisense strand has a sequence as shown in SEQ ID NO: 93 or a modified sequence of SEQ ID NO: 93;

[0035] 7) the sense strand has a sequence as shown in SEQ ID NO: 27 or a modified sequence of SEQ ID NO: 27, and the antisense strand has a sequence as shown in SEQ ID NO: 75 or a modified sequence of SEQ ID NO: 75;

[0036] 8) the sense strand has a sequence as shown in SEQ ID NO: 30 or a modified sequence of SEQ ID NO: 30, and the antisense strand has a sequence as shown in SEQ ID NO: 78 or a modified sequence of SEQ ID NO: 78;

[0037] 9) the sense strand has a sequence as shown in SEQ ID NO: 22 or a modified sequence of SEQ ID NO: 22, and the antisense strand has a sequence as shown in SEQ ID NO: 70 or a modified sequence of SEQ ID NO: 70;

[0038] The modified sequence comprises one or more modified nucleotides.

[0039] In a preferred embodiment of the present disclosure, the modification included in the modified nucleotide is a 2'-modification of the ribose of the nucleotide.

[0040] In a preferred embodiment of the present disclosure, the 2'-modification is selected from the following modifications: 2'-methoxy, 2'-O-methoxyethyl, 2'-fluoro, 2'-O-benzyl and 2'-O-methyl-4-pyridine.

[0041] In a preferred embodiment of the present disclosure, the 2'-modification is 2'-methoxy and 2'-fluoro.

[0042] In a preferred embodiment of the present disclosure, the 2'-modification of the ribose of each nucleotide is an alternating combination of 2'-methoxy and 2'-fluoro.

[0043] In a preferred embodiment of the present disclosure, the nucleotide monomers in the sense strand and the antisense strand are connected by a phosphodiester bond or a thiophosphodiester bond, preferably a 3',5'-phosphodiester bond.

[0044] In a preferred embodiment of the present disclosure, the siRNA comprises any of the following oligonucleotide duplexes:

[0045] 1) the sense strand has the sequence shown in SEQ ID NO: 34 and the antisense strand has the sequence shown in SEQ ID NO: 82; or, the sense strand has the sequence shown in SEQ ID NO: 130 and the antisense strand has the sequence shown in SEQ ID NO: 178;

[0046] 2) the sense strand has the sequence shown in SEQ ID NO: 39 and the antisense strand has the sequence shown in SEQ ID NO: 87; or, the sense strand has the sequence shown in SEQ ID NO: 135 and the antisense strand has the sequence shown in SEQ ID NO: 183;

[0047] 3) the sense strand has the sequence shown in SEQ ID NO: 23 and the antisense strand has the sequence shown in SEQ ID NO: 71; or, the sense strand has the sequence shown in SEQ ID NO: 119 and the antisense strand has the sequence shown in SEQ ID NO: 167;

[0048] 4) the sense strand has the sequence shown in SEQ ID NO: 17 and the antisense strand has the sequence shown in SEQ ID NO: 65; or, the sense strand has the sequence shown in SEQ ID NO: 113 and the antisense strand has the sequence shown in SEQ ID NO: 161;

[0049] 5) the sense strand has the sequence shown in SEQ ID NO: 35 and the antisense strand has the sequence shown in SEQ ID NO: 83; or, the sense strand has the sequence shown in SEQ ID NO: 131 and the antisense strand has the sequence shown in SEQ ID NO: 179;

[0050] 6) the sense strand has the sequence shown in SEQ ID NO: 45 and the antisense strand has the sequence shown in SEQ ID NO: 93; or, the sense strand has the sequence shown in SEQ ID NO: 141 and the antisense strand has the sequence shown in SEQ ID NO: 189;

[0051] 7) the sense strand has the sequence shown in SEQ ID NO: 27 and the antisense strand has the sequence shown in SEQ ID NO: 75; or, the sense strand has the sequence shown in SEQ ID NO: 123 and the antisense strand has the sequence shown in SEQ ID NO: 171;

[0052] 8) the sense strand has the sequence shown in SEQ ID NO: 30 and the antisense strand has the sequence shown in SEQ ID NO: 78; or, the sense strand has the sequence shown in SEQ ID NO: 126 and the antisense strand has the sequence shown in SEQ ID NO: 174;

[0053] 9) the sense strand has the sequence shown in SEQ ID NO: 22 and the antisense strand has the sequence shown in SEQ ID NO: 70; or, the sense strand has the sequence shown in SEQ ID NO: 118 and the antisense strand has the sequence shown in SEQ ID NO: 166.

[0054] In a preferred embodiment of the present disclosure, at least one nucleotide of the siRNA is conjugated to one or more targeting ligands.

[0055] In a preferred embodiment of the present disclosure, the targeting ligand comprises carbohydrates, amino sugars, cholesterol, polypeptides or lipids.

[0056] In a preferred embodiment of the present disclosure, the targeting ligand comprises a GalNAc (N-acetylgalactosamine) moiety.

[0057] In a preferred embodiment of the present disclosure, the GalNac moiety is a monovalent GalNAc moiety, a divalent GalNAc moiety, a trivalent GalNAc moiety or a tetravalent GalNAc moiety.

[0058] In order to solve the aforementioned technical problems, the present disclosure provides a technical solution: a pharmaceutical composition, which comprises the siRNA as described in the present disclosure and a pharmaceutically acceptable carrier.

[0059] The pharmaceutical composition can be used to treat diseases or conditions associated with the expression or activity of the AGT gene, such as various hypertension. Such pharmaceutical compositions can be formulated based on the delivery model. One example is a composition formulated for systemic administration or targeted delivery to the liver by parenteral delivery, such as intravenous (iv) delivery. One example is a composition formulated for direct delivery to the brain parenchyma, such as by infusion into the brain, such as by continuous pump infusion.

[0060] The pharmaceutical composition may be a solution with or without a buffer or a composition containing a pharmaceutically acceptable carrier. Such compositions include, for example, aqueous or crystalline compositions, liposomal formulations, micellar formulations, emulsions, and gene therapy vectors.

[0061] In a preferred embodiment of the present disclosure, the liposome (a pharmaceutically acceptable carrier) in the liposome formulation is LNP.

[0062] In a preferred embodiment of the present disclosure, the pharmaceutical composition further comprises one or both of an AGT gene inhibitor and an AGT protein inhibitor, the AGT protein inhibitor comprising an antibody targeting the AGT protein, the AGT gene inhibitor comprising one or more of a clip editor targeting the AGT gene, an antisense oligonucleotide (ASO) targeting the mRNA transcribed from the AGT gene, and a microRNA (miRNA).

[0063] In a preferred embodiment of the present disclosure, the pharmaceutical composition further comprises a drug for treating hypertension, and the drug for treating hypertension comprises one or more of a diuretic, angiotensin converting enzyme inhibitor, angiotensin II receptor blocker, calcium channel blocker and beta-receptor blocker.

[0064] In the methods of the present disclosure, the siRNA can be administered in a solution. A free siRNA can be administered in a non-buffered solution, such as in saline or in water. Alternatively, the free siRNA can also be administered in a suitable buffer solution. The buffer solution can include acetate, citrate, prolamin, carbonate or phosphate, or any combination thereof. In a preferred embodiment, the buffer solution is phosphate buffered saline (PBS). The pH and volume molar osmotic pressure concentration of the buffer containing the iRNA agent can be adjusted so that it is suitable for administration to a subject.

[0065] In some embodiments, the buffer solution further comprises a reagent for controlling the osmotic pressure concentration of the solution so that the osmotic pressure concentration is maintained at a desired value, such as the physiological value of human plasma. Solutes that can be added to the buffer solution to control the osmotic pressure concentration include, but are not limited to, proteins, peptides, amino acids, non-metabolizable polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the reagent for controlling the osmotic pressure concentration of the solution is a salt. In certain embodiments, the reagent for controlling the osmotic pressure concentration of the solution is sodium chloride or potassium chloride.

[0066] The pharmaceutical composition of the present invention can be administered at a dose sufficient to inhibit the expression of the AGT gene. Typically, a suitable dose of the siRNA of the present invention is in the range of about 0.001 to about 200.0 mg per kg of body weight of the recipient per day, typically in the range of about 1 to 50 mg per kg of body weight per day. The siRNA can be administered, for example, at a single dose of about 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 5. 5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7. 7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19 48, 49, or about 50 mg / kg.

[0067] The pharmaceutical composition can be given once a day, or given multiple times at different time intervals of 1 to 365 days, or the siRNA can be given twice, three times or more sub-doses at appropriate intervals within one year, or even can be given by continuous infusion or delivery through a controlled release formulation. In this case, the siRNA contained in each sub-dose must be correspondingly less, so as to achieve a daily total dose. The dosage unit can also be compounded for delivery within a few days, for example, using a conventional sustained release formulation that provides a lasting siRNA release within a few days time frame. Sustained release formulations are well known in the art and are particularly useful for delivering agents at specific sites, and can be used with agents of the present disclosure thus. In this embodiment, the dosage unit comprises a corresponding plurality of daily doses.

[0068] In other embodiments, a single dose of the siRNA or the pharmaceutical composition can be long-lasting, so that subsequent doses are administered at intervals of no more than 3, 4, or 5 days or at intervals of no more than 1, 2, 3, or 4 weeks. In some embodiments of the present disclosure, a single dose of the pharmaceutical composition is administered once a week. In other embodiments of the present disclosure, a single dose of the pharmaceutical composition is administered once every two months.

[0069] Those skilled in the art will appreciate that certain factors may affect the dosage and timing required to effectively treat a subject, including, but not limited to, the severity of the disease or condition, previous treatment, the subject's overall health and / or age, and other existing diseases. In addition, treating a subject with a therapeutically effective dose of a composition may include a single treatment or a series of treatments. As described elsewhere herein, the effective dose and in vivo half-life of each siRNA encompassed by the present disclosure may be estimated using conventional methods or based on in vivo testing using appropriate animal models.

[0070] The pharmaceutical compositions of the present disclosure may be administered in a number of ways, depending on whether local or systemic treatment is desired and on the area to be treated. Administration may be topical (e.g., by a skin patch); pulmonary; for example, by inhalation or insufflation of a powder or aerosol, including by a nebulizer; intratracheal; intranasal; epidermal and transdermal, oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subdermal, for example, via an implant device; or intracranial, for example, intraparenchymal, intrathecal or intraventricular administration.

[0071] The siRNA used in the pharmaceutical composition, method and use of the present disclosure can be formulated for delivery in a membrane molecular assembly such as a liposome or micelle. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in at least one bilayer (e.g., one bilayer or multiple bilayers). Liposomes include single-layer or multi-layer vesicles having a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the siRNA. The lipophilic material separates the aqueous interior from the aqueous exterior that typically does not include the siRNA (although in some instances, it may include). Liposomes are useful for transferring and delivering active ingredients to the site of action. Because the liposome membrane is structurally similar to a biological membrane, when the liposome is applied to a tissue, the liposome bilayer fuses with the bilayer of the cell membrane. As the fusion of the liposome and the cell proceeds, the internal aqueous content including the siRNA is delivered to the cell, wherein the siRNA can specifically bind to a target RNA and can mediate RNAi. In some cases, these liposomes are also specifically targeted, for example to direct the siRNA to a particular cell type.

[0072] Liposomes comprising the siRNA can be prepared by a variety of methods. In one example, the lipid component of the liposome is dissolved in a detergent so that micelles are formed with the lipid component. For example, the lipid component can be an amphipathic cationic lipid or a lipid conjugate. The detergent can have a high critical micelle concentration and can be nonionic. Exemplary detergents include cholate, CHAPS, octyl glucoside, deoxycholate, and lauroyl sarcosine. The siRNA is then added to the micelle comprising the lipid component. The cationic group on the lipid interacts with the siRNA and condenses around the siRNA to form a liposome. After condensation, the detergent is removed, for example, by dialysis to obtain a liposome formulation of the siRNA.

[0073] An iRNA, such as a siRNA of the present disclosure, can be fully encapsulated in a lipid formulation (eg, LNP or other nucleic acid-lipid particle).

[0074] As used herein, the term "LNP" refers to a stable nucleic acid-lipid particle. LNP contains a cationic lipid, a non-cationic lipid, and a lipid (e.g., a PEG-lipid conjugate) that prevents the particle from gathering. LNP is extremely useful for synthetic applications because they demonstrate a prolonged circulation life after intravenous (iv) injection and accumulate at distal sites (e.g., at a site physically separated from the site of administration).

[0075] In one embodiment, the ratio of lipid to drug (mass / mass ratio) (e.g., lipid to siRNA ratio) will be in the range of from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or about 6:1 to about 9:1.

[0076] In a preferred embodiment of the present disclosure, the lipid nanoparticles include cationic lipids, neutral lipids, structural lipids, and polymer-conjugated lipids.

[0077] In a preferred embodiment of the present disclosure, the cationic lipid is a compound of formula (I), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein G1 is C 1～6 Alkylene; G2 is C 2～8 Alkylene; G3 is C 1～3 Alkylene; L1 is C 6～15 Straight chain alkyl; L2 is C 12～25 Branched alkyl. For example, YK-009 of formula (II) (see patent CN114044741B).

[0078] (I)

[0079] (II)

[0080] In a preferred embodiment of the present disclosure, the cationic lipid is a compound of formula (II), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein: G1 is C 2~8 Alkylene; G2 is C 2~8 Alkylene; L1 is -C(O)O- or -OC(O)-; L2 is -C(O)O- or -OC(O)-; R1 is C 6~25 Straight or branched alkyl; R2 is C 6~25 Straight or branched alkyl; G3 is HO(CH2)2- or HO(CH2)3-; G4 is HO(CH2)2- or HO(CH2)3-; L is (CH2)2- or -(CH2)3- or -(CH2)4-. For example, YK-401 with the structure of formula (II-I) and YK-402 with the structure of formula (II-II) (see patent CN115784921B).

[0081] (II)

[0082] (II-I)

[0083] (II-II)

[0084] In a preferred embodiment of the present disclosure, the cationic lipid is a compound of formula (III), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein: G1 is C 1~6 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~20 Straight or branched alkyl; R2 is C 12~25 Branched alkyl; G3 is: HO(CH2)2N(CH3)(CH2)2-, HO(CH2)2N(CH2CH3)(CH2)2-, (HO(CH2)2)2N(CH2)2-, CH3O(CH2)2N(CH3)(CH2)2-, (CH3)2N(CH2)3SC(O)O(CH2)2-, (CH3)2N(CH2)3SC(O)-, CH3NH(CH2)2N(CH3)(CH2)2- or CH3CH2NH(CH2)2-. For example, YK-201 with the structure of formula (III-I) and YK-202 with the structure of formula (III-II) (see patent CN115677518B).

[0085] (III)

[0086] (III-I)

[0087] (III-II)

[0088] In a preferred embodiment of the present disclosure, the cationic lipid is a compound of formula (IV), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein G1 is C 1~8 Alkylene; G2 is C 2~8 Alkylene; R1 is C 6~25 Straight or branched alkyl; R2 is C 12~25 Straight or branched alkyl; G3 is: HO(CH2)2N(R3)CH2CH(OH)CH2-, wherein R3 is -CH3 or -CH2CH3 or -CH2CH2OH For example, YK-305 of formula (IV-I) and YK-310 of formula (IV-II) (see patent CN115745820B).

[0089] (IV)

[0090] (IV-I)

[0091] (IV-II)

[0092] In a preferred embodiment of the present disclosure, the cationic lipid is a compound of formula (V), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein G 1 and G 2 Each independently is an unsubstituted C6-C 10 Alkylene; G 3 For unsubstituted C1-C 12 Alkylene; R 1 and R 2 Each independently is C6-C 24 Alkyl or C6-C 24 Alkenyl; R 3 OR 5 、N、-C(=O)OR 4 、-OC(=O)R 4 or -NR 5 C(=O)R 4 ; R 4 C1-C 12 A hydrocarbon group; and R 5 is H or a C1-C6 hydrocarbon group; for example, ALC0315 of the formula (VI) (see patent CN108368028B).

[0093] (V)

[0094] (VI)

[0095] In a preferred embodiment of the present disclosure, the cationic lipid is a compound of formula (VI), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof, wherein R4 is selected from -(CH2) n Q and -(CH2) n CHQR; Q is selected from the group consisting of: -OR, -OH, -O(CH2) n N(R)2, -OC(O)R, -CX3, -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O)2R, -N(H)S(O)2R, -N(R)C(O)N(R)2, -N(H)C(O)N(R)2, -N(H)C(O)N(H)(R), -N(R)C(S)N(R)2, -N(H)C(S)N(R)2, -N(H)C(S)N(H)(R), -N(R)S(O)2R8 and heterocycle; n is 1, 2 or 3; for example, SM102 of formula (VI-I) (see patent CN110520409A).

[0096] (VI)

[0097] (VI-I)

[0098] In a preferred embodiment of the present disclosure, the cationic lipid is a compound of formula (VII), or an N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer thereof (see CN102625696B, DLIN-MC3-DMA),

[0099] (VII).

[0100] In a more preferred embodiment of the present disclosure, the cationic lipids include YK-009, YK-401, YK-305, ALC0315, SM102, and DLIN-MC3-DMA.

[0101] In a preferred embodiment of the present disclosure, the molar ratio of the cationic lipid to the neutral lipid is 1:1 to 10:1.

[0102] In a preferred embodiment of the present disclosure, the molar ratio of the cationic lipid to the structural lipid is 1:1 to 5:1.

[0103] In a preferred embodiment of the present disclosure, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer conjugated lipid is (25~65):(5~25):(25~70):(0.5~5).

[0104] In a preferred embodiment of the present disclosure, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer conjugated lipid is (25~65):(5~25):(25~45):(0.5~5).

[0105] In some more preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is 50:10:38.5:1.5 or 49:10:39.5:1.5.

[0106] In a preferred embodiment of the present disclosure, the neutral lipids include one or more of phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, sterol and their derivatives.

[0107] In some more preferred embodiments, the neutral lipid is selected from one or more of the following: 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diondecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dialinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoyl phosphatidylethanolamine (POPE), distearoyl-phosphatidyl-ethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearoylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyloleoylphosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE) and mixtures thereof.

[0108] In some more preferred embodiments, the neutral lipid is DOPE and / or DSPC.

[0109] In a preferred embodiment of the present disclosure, the structured lipid is selected from one or more of the following: cholesterol, non-sterols, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, α-tocopherol and corticosteroids.

[0110] In some more preferred embodiments, the structured lipid is cholesterol.

[0111] In a preferred embodiment of the present disclosure, the polymer conjugated lipid is selected from one or more of the following: PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol.

[0112] In some more preferred embodiments, the polymer conjugated lipid is selected from one or more of the following: distearoylphosphatidylethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristoylglycerol-3-methoxy polyethylene glycol 2000 (DMG-PEG2000) and methoxy polyethylene glycol ditetradecanoyl acetamide (ALC-0159).

[0113] In a specific embodiment of the present disclosure, the LNP is Lipofectamine ® RNAiMAX.

[0114] Pharmaceutical compositions disclosed herein include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions can be produced from a variety of components, including, but not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semisolids. Particularly preferred are formulations that target the liver when treating liver disorders (e.g., liver cancer).

[0115] The pharmaceutical formulations of the present disclosure, which may conveniently be in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the steps of combining the active ingredients with the pharmaceutical carrier(s) or excipient(s). Generally speaking, the formulations are prepared by uniformly and finely combining the active ingredients with liquid carriers or finely dispersed solid carriers or both, and, if desired, shaping the product.

[0116] The pharmaceutical composition of the present disclosure can be formulated into any of many possible dosage forms, such as but not limited to tablets, capsules, gel capsules, liquid syrups, soft capsules, suppositories and enemas. The pharmaceutical composition of the present disclosure can also be formulated into a suspension in an aqueous, non-aqueous medium or a mixed medium. The aqueous suspension can further include a substance that increases the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol and / or dextran. The suspension can also include a stabilizer.

[0117] Certain pharmaceutical compositions of the present disclosure also incorporate carrier compounds into the formulation. As used herein, a "carrier compound" or "carrier" may refer to a nucleic acid or its analog, which is inert (i.e., not biologically active per se), but is recognized as a nucleic acid during in vivo processes, such as by degrading biologically active nucleic acids or promoting their removal from circulation to reduce the bioavailability of biologically active nucleic acids. Co-administration of nucleic acids and carrier compounds (generally an excess of the latter) may result in a substantial reduction in the amount of nucleic acid recovered in the liver, kidneys, or other external circulation reservoirs, presumably due to competition between the carrier compound and the nucleic acid for common receptors. For example, the recovery of partially phosphorothioated dsRNA in liver tissue can be reduced when co-administered with polyinosinic acid, dextran sulfate, polycytidylic acid or 4-acetamido-4'isothiocyanatostilbene-2,2'-disulfonic acid (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183).

[0118] In contrast to carrier compounds, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent, or any other pharmaceutically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid, and when combined with the nucleic acid and other components of a particular pharmaceutical composition, the excipient is selected to provide the desired volume, consistency, etc., with reference to the intended mode of administration. Typical pharmaceutical carriers include, but are not limited to, binders (e.g., pregelatinized corn starch, polyvinyl pyrrolidone, or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates, or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silicon dioxide, colloidal silicon dioxide, stearic acid, metal stearates, hydrogenated vegetable oils, corn starch, polyethylene glycol, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulfate, etc.).

[0119] Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration, which do not react toxically with nucleic acids, can also be used to prepare the pharmaceutical compositions disclosed herein. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, saline solution, alcohol, polyethylene glycol, gelatin, lactose, straight-chain starch, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinyl pyrrolidone, and the like.

[0120] The preparation that is used for local administration of nucleic acid can comprise the aseptic or non-aseptic aqueous solution, non-aqueous solution in common solvent such as alcohol, or the nucleic acid solution in liquid or solid oil matrix.These solutions can also comprise buffer, diluent and other suitable additives.Can use be suitable for non-parenteral administration and do not have toxic reaction with nucleic acid, pharmaceutically acceptable organic or inorganic excipient.

[0121] Suitable pharmaceutically acceptable excipients include, but are not limited to, water, saline solution, alcohol, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinyl pyrrolidone, and the like.

[0122] In order to solve the above technical problems, the present disclosure provides a technical solution: a set of medicine kits, the set of medicine kits comprising medicine kit A, the medicine kit A comprising one or both of the siRNA described in the present disclosure or the pharmaceutical composition described in the present disclosure;

[0123] Preferably, the kit further comprises a kit B, wherein the kit B contains one or both of the following (1) and (2):

[0124] (1) AGT gene inhibitors or AGT protein inhibitors;

[0125] (2) Any one or a combination of two or more of the group consisting of hormonal agents, targeted small molecule agents, proteasome inhibitors, imaging agents, diagnostic agents, chemotherapeutic agents, oncolytic drugs, cytotoxic agents, cytokines, activators of co-stimulatory molecules, inhibitors of inhibitory molecules, and vaccines.

[0126] In a preferred embodiment of the present disclosure, the AGT protein inhibitor includes an antibody targeting the AGT protein, and the AGT gene inhibitor includes one or more of a clip editor targeting the AGT gene, an antisense oligonucleotide (ASO) targeting the mRNA transcribed from the AGT gene, and a microRNA (miRNA).

[0127] In order to solve the aforementioned technical problems, the present disclosure provides a technical solution: use of one or more of the siRNA described in the present disclosure, the pharmaceutical composition described in the present disclosure, and the drug kit described in the present disclosure in the preparation of a drug for treating and / or preventing diseases related to AGT gene expression.

[0128] In a preferred embodiment of the present disclosure, the AGT gene expression-related diseases include hypertension diseases or related diseases caused by hypertension.

[0129] In a preferred embodiment of the present disclosure, the hypertension diseases include critical hypertension, primary hypertension, secondary hypertension, hypertensive crisis, hypertensive emergency state, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, and unstable hypertension.

[0130] In a preferred embodiment of the present disclosure, the related diseases caused by hypertension include hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis and Cushing's syndrome.

[0131] To solve the aforementioned technical problems, the present disclosure provides a technical solution: an siRNA as described in the present disclosure, a pharmaceutical composition as described in the present disclosure, or a drug kit as described in the present disclosure for treating and / or preventing diseases related to AGT gene expression.

[0132] In a preferred embodiment of the present disclosure, the AGT gene expression-related diseases include hypertension diseases or related diseases caused by hypertension.

[0133] In a preferred embodiment of the present disclosure, the hypertension diseases include critical hypertension, primary hypertension, secondary hypertension, hypertensive crisis, hypertensive emergency state, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, and unstable hypertension.

[0134] In a preferred embodiment of the present disclosure, the related diseases caused by hypertension include hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis and Cushing's syndrome.

[0135] To solve the aforementioned technical problems, the present disclosure provides a technical solution: a method for treating or preventing diseases related to AGT gene expression, comprising administering a therapeutically effective amount of one or more of the siRNA, the pharmaceutical composition, and the kit described in the present disclosure to a subject in need. The method can achieve treatment or prevention by downregulating AGT gene expression.

[0136] In a preferred embodiment of the present disclosure, the AGT gene expression-related diseases include hypertension diseases or related diseases caused by hypertension.

[0137] In a preferred embodiment of the present disclosure, the hypertension diseases include critical hypertension, primary hypertension, secondary hypertension, hypertensive crisis, hypertensive emergency state, isolated systolic and diastolic hypertension, pregnancy-related hypertension, diabetic hypertension, refractory hypertension, intractable hypertension, paroxysmal hypertension, renovascular hypertension, Goldblatt's hypertension, ocular hypertension, glaucoma, pulmonary hypertension, portal hypertension, systemic venous hypertension, systolic hypertension, and unstable hypertension.

[0138] In a preferred embodiment of the present disclosure, the related diseases caused by hypertension include hypertensive heart disease, hypertensive nephropathy, atherosclerosis, arteriosclerosis, vascular disease, diabetic nephropathy, diabetic retinopathy, chronic heart failure, cardiomyopathy, diabetic cardiomyopathy, glomerulosclerosis, aortic coarctation, aortic aneurysm, ventricular fibrosis and Cushing's syndrome.

[0139] The siRNA described in the present disclosure can be administered to a subject using any mode of administration known in the art, including but not limited to subcutaneous, intravenous, intramuscular, intraocular, intrabronchial, intrapleural, intraperitoneal, intraarterial, translymphatic, cerebrospinal, and any combination thereof. In a preferred embodiment, these agents are administered subcutaneously.

[0140] In other embodiments, the siRNA is administered in combination with an additional therapeutic agent. The siRNA and additional therapeutic agent can be administered in combination in the same composition, e.g., parenterally, or the additional therapeutic agent can be administered as part of a separate composition or by another method described herein.

[0141] Examples of additional therapeutic agents include agents known to treat hypertension or agents known to treat cardiovascular and cerebrovascular diseases. For example, additional agents for treating hypertension are selected from angiotensin converting enzyme inhibitors (e.g., captopril, enalapril, benazepril, perindopril, etc.), angiotensin II receptor antagonists (e.g., losartan, losartan hydrochlorothiazide, valsartan, valsartan hydrochlorothiazide, telmisartan, telmisartan hydrochlorothiazide, olmesartan medoxomil, etc.), beta-blockers (e.g., propranolol, bisoprolol, metoprolol tartrate, metoprolol succinate, etc.).

[0142] In one embodiment, the siRNA agent is administered to a patient and subsequently an additional therapeutic agent is administered to the patient (or vice versa). In another embodiment, the iRNA agent and the additional therapeutic agent are administered simultaneously.

[0143] To solve the above technical problems, the present disclosure provides a technical solution: a method for reducing AGT gene expression or inhibiting AGT replication, characterized in that the method comprises administering one or more of the siRNA described in the present disclosure, the pharmaceutical composition described in the present disclosure, and the kit described in the present disclosure to the sample. Preferably, the method is for non-therapeutic purposes.

[0144] In the present invention, the amino acid sequence of AGT targeted is shown in NCBI Accession No: NM_001384479.1 and NM_001382817.3, and the nucleotide sequence of the gene encoding AGT is shown in NCBI Accession No: NM_001384479.1 and NM_001382817.3.

[0145] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0146] The reagents and raw materials used in the present invention are commercially available.

[0147] The positive and progressive effects of the present invention are:

[0148] The unmodified siRNA provided by the present invention has a significant inhibitory effect on the expression of AGT mRNA, for example, the inhibition rate is higher than 50%. After further modification of these siRNAs, some of the modified siRNAs still maintain a high inhibition rate or increase the inhibition rate (for example, the inhibition rate reaches more than 60%). BRIEF DESCRIPTION OF THE DRAWINGS

[0149] Figure 1 is the inhibition rate of unmodified siRNA on AGT, and the control is NC.

[0150] Figure 2 is the inhibition rate of modified siRNA on AGT, and the control is NC. DETAILED DESCRIPTION

[0151] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0152] The present invention designs 46 small interfering RNA (siRNA) sequences for the AGT mRNA sequence, including 46 sense chains and 46 antisense chains, and these sequences are modified alternately with 2'-F and 2'-Me. The specific modification strategy is: for the antisense chain of the siRNA sequence, the odd positions (i.e., positions 1, 3, 5, 7...21, 23) are modified with 2'-methoxy, and the even positions (i.e., positions 2, 4, 6, 8...20, 22) are modified with 2'-fluoro. For the sense chain that is complementary to the antisense chain, the complementary pairing position on the sense chain is modified with 2'-methoxy at the position modified with 2'-methoxy on the antisense chain; the complementary pairing position on the sense chain is modified with 2'-fluoro at the position modified with 2'-methoxy on the antisense chain. The positive control is APC (Zilebesiran drug sequence of Alnylam), and the negative control is NC (NegativeControl) that does not overlap with the AGT mRNA sequence. See the unmodified oligonucleotide sequence for details. , oligonucleotides modified with 2'-F and 2'-Me alternately, see .

[0153] surface Unmodified oligonucleotide sequence

[0154] Number Sense strand sequence (5'-3') SEQ ID NO Antisense strand sequence (5'-3') SEQ ID NO 11 CGAGCACCCCAGUCUGAGAUG 1 UCUCAGACUGGGGUGCUCGCU 49 50 CUGAGGGCCACCAUCCUCUGC 2 AGAGGAUGGUGGCCCUCAGGC 50 128 ACCUCGUCAUCCACAAUGA 3 UCAUUGUGGAUGACGAGGU 51 150 CCUGUGAGCAGCUGGCAAAGG 4 UUUGCCAGCUGCUCACAGGUA 52 187 CCUUCAUACCUGCUCCAAUUC 5 AUUGGAGCAGGUAUGAAGGUG 53 223 GACAUCCCCUGUGGAUGAAAA 6 UUCAUCCACAGGGGAUGUCUU 54 262 GCUGGUGCUAGUCGCUGCAAA 7 UGCAGCGACUAGCACCAGCUG 55 289 GACACCGAAGACAAGUUGA 8 UCAACUUGUCUUCGGUGUC 56 341 GGCUUCCGUAUAUAUGGCAUG 9 UGCCAUAUAUACGGAAGCCCA 57 407 GGCACCCUGGCCUCUCUCUAU 10 AGAGAGAGGCCAGGGUGCCAA 58 478 GGCAAUCCUGGGUGUUCCUUG 11 AGGAACACCCAGGAUUGCCUG 59 490 GGUGUUCCUUGGAAGGACA 12 UGUCCUUCCAAGGAACACC 60 556 CUGCCCUGCAGGCUGUACAGG 13 UGUACAGCCUGCAGGGCAGAC 61 622 GGUGGUGGGCGUGUUCACAGC 14 UGUGAACACGCCCACCACCGU 62 673 GCAGGGCCUGGCUCUCUAUAC 15 AUAGAGAGCCAGGCCCUGCAC 63 720 GGACUUCACAGAACUGGAU 16 AUCCAGUUCUGUGAAGUCC 64 740 GCUGCUGAGAAGAUUGACAGG 17 UGUCAAUCUUCUCAGCAGCAA 65 760 GUUCAUGCAGGCUGUGACAGG 18 UGUCACAGCCUGCAUGAACCU 66 830 UGGCUUUCAACACCUACGU 19 ACGUAGGUGUUGAAAGCCA 67 904 GGUGGACAACAGCACCUCAGU 20 UGAGGUGCUGUUGUCCACCCA 68 994 GACUCAAGUGCCCUUCACUGA 21 AGUGAAGGGCACUUGAGUCAC 69 1030 GCUGAUCCAGCCUCACUAUGC 22 AUAGUGAGGCUGGAUCAGCAG 70 1063 CAAGGUGGAGGGUCUCACUUU 23 AGUGAGACCCUCCACCUUGUC 71 1096 CURRENTAGUACU 24 WOWGGGGGA 72 1155 HOLDING 25 AUAAGAUCCUUGCAGCACC 73 1221 CCGADDRESSACCUGCAAAAAU 26 UUUUGCAGGUUCAGCUCGGUG 74 1267 GGAGGUGCUUUUU 27 AAUGCUGCCCCCC 75 1296 GCUUGAAGCGGAUGAGAGA 28 UCUCUCAUCCGCUUCAAGC 76 1323 AGAGUCACCAACAGCUU 29 CURRICULUM 77 1384 STORAGE 30 UUGACAAUSUMMER 78 1461 GCCAGGGCCCCACAGA 31 STOPGGGCCCUGGCCU 79 1494 CUCUGCCCCUGGCCUUUGAGG 32 UCAAAGGCCAGGGGCAGAGGC 80 1530 GAUAACAACCCCGGACAAAUC 33 UUUCCCGGGUUUUCUG 81 1583 HOUSEHOLD 34 AAAGUCAUUAGAGA 82 1615 GCCLOAKING 35 UAGACCAAGGAAACGGCUG 83 1642 GCAUGGAGUGAGAGAAG 36 UCUACCUCACUCCAUGCAG 84 1675 CAAAUGCACCUCCCAGUUUGC 37 AAACUGGGAGGUGCAUUUGUG 85 1748 GCGGHOLDINGAA 38 UUUGGACAGUACCCGC 86 1812 CCUUUUCAAAAAAAUU 39 AAUUUUUHOUGHAAAAGGGA 87 1876 HOLD UP 40 AAGACAAAAAAACC 88 1912 CCPRECAUTIONAUACC 41 UAUUACACCACACGGAG 89 1934 CUUAGUUUUUCCACAGUGCUUGU 42 AAAAACUAAGGU 90 1980 HOLDINGHOLDINGAUUUCUGUU 43 AACAGAAAUCAGGUGGUGUS 91 2010 GCGAACCAUAGCUGGUUA 44 UAACCAGCUAUGGUUCCGC 92 2034 CCCUUAWAAAAAAA 45 UUUAUUWATERAAGGG 93 2059 GCCACAAUAAGCCUCCAAA 46 UUUGGAGCUUAUUGUGGC 94 APC CHARACTERAUGAGAGAGA 47 UGUACUCUCAUUGUGGAUGACGA 95 NC UAACAUCUCGACGUAGACAUC 48 GAUGUCUACGUCGAGAUGUUACU 96

[0155] surface Modified oligonucleotides

[0156] Number Sense strand sequence (5'-3') Modified sequence SEQ ID NO / Corresponding unmodified SEQ ID NO Antisense strand sequence (5'-3') Modified sequence SEQ ID NO / Corresponding unmodified SEQ ID NO A11-AL Cfs-Gms-Af-Gm-Cf-Am-Cf-Cm-Cf-Cm-Af-Gm-Uf-Cm-Uf-Gm-Af-Gm-Af-Um-Gf 97 / 1 Ums-Cfs-Um-Cf-Am-Gf-Am-Cf-Um-Gf-Gm-Gf-Gm-Uf-Gm-Cf-Um-Cf-Gms-Cfs-Um 145 / 49 A50-AL Cfs-Ums-Gf-Am-Gf-Gm-Gf-Cm-Cf-Am-Cf-Cm-Af-Um-Cf-Cm-Uf-Cm-Uf-Gm-Cf 98 / 2 Ams-Gfs-Am-Gf-Gm-Af-Um-Gf-Gm-Uf-Gm-Gf-Cm-Cf-Cm-Uf-Cm-Af-Gms-Gfs-Cm 146 / 50 A128-AL Afs-Cms-Cf-Um-Cf-Gm-Uf-Cm-Af-Um-Cf-Cm-Af-Cm-Af-Am-Uf-Gm-Af 99 / 3 Ums-Cfs-Am-Uf-Um-Gf-Um-Gf-Gm-Af-Um-Gf-Am-Cf-Gm-Af-Gms-Gfs-Um 147 / 51 A150-AL Cfs-Cms-Uf-Gm-Uf-Gm-Af-Gm-Cf-Am-Gf-Cm-Uf-Gm-Gf-Cm-Af-Am-Af-Gm-Gf 100 / 4 Ums-Ufs-Um-Gf-Cm-Cf-Am-Gf-Cm-Uf-Gm-Cf-Um-Cf-Am-Cf-Am-Gf-Gms-Ufs-Am 148 / 52 A198-AL Cfs-Cms-Uf-Um-Cf-Am-Uf-Am-Cf-Cm-Uf-Gm-Cf-Um-Cf-Cm-Af-Am-Uf-Um-Cf 101 / 5 Ams-Ufs-Um-Gf-Gm-Af-Gm-Cf-Am-Gf-Gm-Uf-Am-Uf-Gm-Af-Am-Gf-Gms-Ufs-Gm 149 / 53 A226-AL Gfs-Ams-Cf-Am-Uf-Cm-Cf-Cm-Cf-Um-Gf-Um-Gf-Gm-Af-Um-Gf-Am-Af-Am-Af 102 / 6 Ums-Ufs-Cm-Af-Um-Cf-Cm-Af-Cm-Af-Gm-Gf-Gm-Gf-Am-Uf-Gm-Uf-Cms-Ufs-Um 150 / 54 A262-AL Gfs-Cms-Uf-Gm-Gf-Um-Gf-Cm-Uf-Am-Gf-Um-Cf-Gm-Cf-Um-Gf-Cm-Af-Am-Af 103 / 7 Ums-Gfs-Cm-Af-Gm-Cf-Gm-Af-Cm-Uf-Am-Gf-Cm-Af-Cm-Cf-Am-Gf-Cms-Ufs-Gm 151 / 55 A289-AL Gfs-Ams-Cf-Am-Cf-Cm-Gf-Am-Af-Gm-Af-Cm-Af-Am-Gf-Um-Uf-Gm-Af 104 / 8 Ums-Cfs-Am-Af-Cm-Uf-Um-Gf-Um-Cf-Um-Uf-Cm-Gf-Gm-Uf-Gms-Ufs-Cm 152 / 56 A341-AL Gfs-Gms-Cf-Um-Uf-Cm-Cf-Gm-Uf-Am-Uf-Am-Uf-Am-Uf-Gm-Gf-Cm-Af-Um-Gf 105 / 9 Ums-Gfs-Cm-Cf-Am-Uf-Am-Uf-Am-Uf-Am-Cf-Gm-Gf-Am-Af-Gm-Cf-Cms-Cfs-Am 153 / 57 A422-AL Gfs-Gms-Cf-Am-Cf-Cm-Cf-Um-Gf-Gm-Cf-Cm-Uf-Cm-Uf-Cm-Uf-Cm-Uf-Am-Uf 106 / 10 Ams-Gfs-Am-Gf-Am-Gf-Am-Gf-Gm-Cf-Cm-Af-Gm-Gf-Gm-Uf-Gm-Cf-Cms-Afs-Am 154 / 58 A478-AL Gfs-Gms-Cf-Am-Af-Um-Cf-Cm-Uf-Gm-Gf-Gm-Uf-Gm-Uf-Um-Cf-Cm-Uf-Um-Gf 107 / 11 Ams-Gfs-Gm-Af-Am-Cf-Am-Cf-Cm-Cf-Am-Gf-Gm-Af-Um-Uf-Gm-Cf-Cms-Ufs-Gm 155 / 59 A490-AL Gfs-Gms-Uf-Gm-Uf-Um-Cf-Cm-Uf-Um-Gf-Gm-Af-Am-Gf-Gm-Af-Cm-Af 108 / 12 Ums-Gfs-Um-Cf-Cm-Uf-Um-Cf-Cm-Af-Am-Gf-Gm-Af-Am-Cf-Ams-Cfs-Cm 156 / 60 A546-AL Cfs-Ums-Gf-Cm-Cf-Cm-Uf-Gm-Cf-Am-Gf-Gm-Cf-Um-Gf-Um-Af-Cm-Af-Gm-Gf 109 / 13 Ums-Gfs-Um-Af-Cm-Af-Gm-Cf-Cm-Uf-Gm-Cf-Am-Gf-Gm-Gf-Cm-Af-Gms-Afs-Cm 157 / 61 A622-AL Gfs-Gms-Uf-Gm-Gf-Um-Gf-Gm-Gf-Cm-Gf-Um-Gf-Um-Uf-Cm-Af-Cm-Af-Gm-Cf 110 / 14 Ums-Gfs-Um-Gf-Am-Af-Cm-Af-Cm-Gf-Cm-Cf-Cm-Af-Cm-Cf-Am-Cf-Cms-Gfs-Um 158 / 62 A673-AL Gfs-Cms-Af-Gm-Gf-Gm-Cf-Cm-Uf-Gm-Gf-Cm-Uf-Cm-Uf-Cm-Uf-Am-Uf-Am-Cf 111 / 15 Ams-Ufs-Am-Gf-Am-Gf-Am-Gf-Cm-Cf-Am-Gf-Gm-Cf-Cm-Cf-Um-Gf-Cms-Afs-Cm 159 / 63 A720-AL Gfs-Gms-Af-Cm-Uf-Um-Cf-Am-Cf-Am-Gf-Am-Af-Cm-Uf-Gm-Gf-Am-Uf 112 / 16 Ams-Ufs-Cm-Cf-Am-Gf-Um-Uf-Cm-Uf-Gm-Uf-Gm-Af-Am-Gf-Ums-Cfs-Cm 160 / 64 A740-AL Gfs-Cms-Uf-Gm-Cf-Um-Gf-Am-Gf-Am-Af-Gm-Af-Um-Uf-Gm-Af-Cm-Af-Gm-Gf 113 / 17 Ums-Gfs-Um-Cf-Am-Af-Um-Cf-Um-Uf-Cm-Uf-Cm-Af-Gm-Cf-Am-Gf-Cms-Afs-Am 161 / 65 A760-AL Gfs-Ums-Uf-Cm-Af-Um-Gf-Cm-Af-Gm-Gf-Cm-Uf-Gm-Uf-Gm-Af-Cm-Af-Gm-Gf 114 / 18 Ums-Gfs-Um-Cf-Am-Cf-Am-Gf-Cm-Cf-Um-Gf-Cm-Af-Um-Gf-Am-Af-Cms-Cfs-Um 162 / 66 A830-AL Ufs-Gms-Gf-Cm-Uf-Um-Uf-Cm-Af-Am-Cf-Am-Cf-Cm-Uf-Am-Cf-Gm-Uf 115 / 19 Ams-Cfs-Gm-Uf-Am-Gf-Gm-Uf-Gm-Uf-Um-Gf-Am-Af-Am-Gf-Cms-Cfs-Am 163 / 67 A904-AL Gfs-Gms-Uf-Gm-Gf-Am-Cf-Am-Af-Cm-Af-Gm-Cf-Am-Cf-Cm-Uf-Cm-Af-Gm-Uf 116 / 20 Ums-Gfs-Am-Gf-Gm-Uf-Gm-Cf-Um-Gf-Um-Uf-Gm-Uf-Cm-Cf-Am-Cf-Cms-Cfs-Am 164 / 68 A994-AL Gfs-Ams-Cf-Um-Cf-Am-Af-Gm-Uf-Gm-Cf-Cm-Cf-Um-Uf-Cm-Af-Cm-Uf-Gm-Af 117 / 21 Ams-Gfs-Um-Gf-Am-Af-Gm-Gf-Gm-Cf-Am-Cf-Um-Uf-Gm-Af-Gm-Uf-Cms-Afs-Cm 165 / 69 A1030-AL Gfs-Cms-Uf-Gm-Af-Um-Cf-Cm-Af-Gm-Cf-Cm-Uf-Cm-Af-Cm-Uf-Am-Uf-Gm-Cf 118 / 22 Ams-Ufs-Am-Gf-Um-Gf-Am-Gf-Gm-Cf-Um-Gf-Gm-Af-Um-Cf-Am-Gf-Cms-Afs-Gm 166 / 70 A1063-AL Cfs-Ams-Af-Gm-Gf-Um-Gf-Gm-Af-Gm-Gf-Gm-Uf-Cm-Uf-Cm-Af-Cm-Uf-Um-Uf 119 / 23 Ams-Gfs-Um-Gf-Am-Gf-Am-Cf-Cm-Cf-Um-Cf-Cm-Af-Cm-Cf-Um-Uf-Gms-Ufs-Cm 167 / 71 A1096-AL Cfs-Cms-Uf-Cm-Af-Am-Cf-Um-Gf-Gm-Af-Um-Gf-Am-Af-Gm-Af-Am-Af-Cm-Uf 120 / 24 Ums-Ufs-Um-Cf-Um-Uf-Cm-Af-Um-Cf-Cm-Af-Gm-Uf-Um-Gf-Am-Gf-Gms-Gfs-Am 168 / 72 A1155-AL Gfs-Gms-Uf-Gm-Cf-Um-Gf-Cm-Af-Am-Gf-Gm-Af-Um-Cf-Um-Uf-Am-Uf 121 / 25 Ams-Ufs-Am-Af-Gm-Af-Um-Cf-Cm-Uf-Um-Gf-Cm-Af-Gm-Cf-Ams-Cfs-Cm 169 / 73 A1221-AL Cfs-Cms-Gf-Am-Gf-Cm-Uf-Gm-Af-Am-Cf-Cm-Uf-Gm-Cf-Am-Af-Am-Af-Am-Uf 122 / 26 Ums-Ufs-Um-Uf-Gm-Cf-Am-Gf-Gm-Uf-Um-Cf-Am-Gf-Cm-Uf-Cm-Gf-Gms-Ufs-Gm 170 / 74 A1267-AL Gfs-Gms-Af-Gm-Gf-Um-Gf-Cm-Uf-Gm-Af-Am-Cf-Am-Gf-Cm-Af-Um-Uf-Um-Uf 123 / 27 Ams-Afs-Um-Gf-Cm-Uf-Gm-Uf-Um-Cf-Am-Gf-Cm-Af-Cm-Cf-Um-Cf-Cms-Cfs-Cm 171 / 75 A1296-AL Gfs-Cms-Uf-Um-Gf-Am-Af-Gm-Cf-Gm-Gf-Am-Uf-Gm-Af-Gm-Af-Gm-Af 124 / 28 Ums-Cfs-Um-Cf-Um-Cf-Am-Uf-Cm-Cf-Gm-Cf-Um-Uf-Cm-Af-Ams-Gfs-Cm 172 / 76 A1323-AL Afs-Gms-Af-Gm-Uf-Cm-Uf-Am-Cf-Cm-Cf-Am-Af-Cm-Af-Gm-Cf-Um-Uf 125 / 29 Ams-Afs-Gm-Cf-Um-Gf-Um-Uf-Gm-Gf-Gm-Uf-Am-Gf-Am-Cf-Ums-Cfs-Um 173 / 77 A1384-AL Gfs-Ums-Uf-Um-Gf-Cm-Uf-Gm-Uf-Gm-Uf-Am-Uf-Gm-Af-Um-Cf-Am-Af-Am-Gf 126 / 30 Ums-Ufs-Gm-Af-Um-Cf-Am-Uf-Am-Cf-Am-Cf-Am-Gf-Cm-Af-Am-Af-Cms-Afs-Gm 174 / 78 A1461-AL Gfs-Cms-Cf-Am-Gf-Gm-Gf-Cm-Cf-Cm-Cf-Am-Gf-Am-Af-Cm-Af-Cm-Af-Gm-Uf 127 / 31 Ums-Gfs-Um-Gf-Um-Uf-Cm-Uf-Gm-Gf-Gm-Gf-Cm-Cf-Cm-Uf-Gm-Gf-Cms-Cfs-Um 175 / 79 A1494-AL Cfs-Ums-Cf-Um-Gf-Cm-Cf-Cm-Cf-Um-Gf-Gm-Cf-Cm-Uf-Um-Uf-Gm-Af-Gm-Gf 128 / 32 Ums-Cfs-Am-Af-Am-Gf-Gm-Cf-Cm-Af-Gm-Gf-Gm-Gf-Cm-Af-Gm-Af-Gms-Gfs-Cm 176 / 80 A1530-AL Gfs-Ams-Uf-Am-Af-Cm-Af-Am-Cf-Cm-Cf-Cm-Gf-Gm-Af-Cm-Af-Am-Af-Um-Cf 129 / 33 Ums-Ufs-Um-Gf-Um-Cf-Cm-Gf-Gm-Gf-Gm-Uf-Um-Gf-Um-Uf-Am-Uf-Cms-Ufs-Gm 177 / 81 A1583-AL Cfs-Ums-Uf-Cm-Uf-Am-Af-Um-Gf-Am-Gf-Um-Cf-Gm-Af-Cm-Uf-Um-Uf-Gm-Af 130 / 34 Ams-Afs-Am-Gf-Um-Cf-Gm-Af-Cm-Uf-Cm-Af-Um-Uf-Am-Gf-Am-Af-Gms-Afs-Am 178 / 82 A1615-AL Gfs-Cms-Cf-Gm-Uf-Um-Uf-Cm-Uf-Cm-Cf-Um-Uf-Gm-Gf-Um-Cf-Um-Af-Am-Gf 131 / 35 Ums-Afs-Gm-Af-Cm-Cf-Am-Af-Gm-Gf-Am-Gf-Am-Af-Am-Cf-Gm-Gf-Cms-Ufs-Gm 179 / 83 A1642-AL Gfs-Cms-Af-Um-Gf-Gm-Af-Gm-Uf-Gm-Af-Gm-Cf-Am-Gf-Um-Af-Gm-Af-Am-Gf 132 / 36 Ums-Cfs-Um-Af-Cm-Uf-Gm-Cf-Um-Cf-Am-Cf-Um-Cf-Cm-Af-Um-Gf-Cms-Afs-Gm 180 / 84 A1675-AL Cfs-Ams-Af-Am-Uf-Gm-Cf-Am-Cf-Cm-Uf-Cm-Cf-Cm-Af-Gm-Uf-Um-Uf-Gm-Cf 133 / 37 Ams-Afs-Am-Cf-Um-Gf-Gm-Gf-Am-Gf-Gm-Uf-Gm-Cf-Am-Uf-Um-Uf-Gms-Ufs-Gm 181 / 85 A1748-AL Gfs-Cms-Gf-Gm-Gf-Am-Cf-Um-Af-Cm-Uf-Gm-Uf-Um-Cf-Cm-Af-Am-Af 134 / 38 Ums-Ufs-Um-Gf-Gm-Af-Am-Cf-Am-Gf-Um-Af-Gm-Uf-Cm-Cf-Cms-Gfs-Cm 182 / 86 A1812-AL Cfs-Cms-Uf-Um-Uf-Um-Cf-Am-Af-Gm-Uf-Um-Gf-Am-Gf-Am-Af-Cm-Af-Am-Af-Am-Af-Um-Uf 135 / 39 Ams-Afs-Um-Uf-Um-Uf-Um-Gf-Um-Uf-Cm-Uf-Cm-Af-Am-Cf-Um-Uf-Gm-Af-Am-Af-Am-Gf-Gms-Gfs-Am 183 / 87 A1876-AL Gfs-Gms-Uf-Um-Uf-Gm-Uf-Am-Uf-Um-Uf-Am-Gf-Um-Gf-Um-Cf-Um-Uf 136 / 40 Ams-Afs-Gm-Af-Cm-Af-Cm-Uf-Am-Af-Am-Uf-Am-Cf-Am-Af-Ams-Cfs-Cm 184 / 88 A1912-AL Cfs-Cms-Gf-Um-Gf-Um-Af-Gm-Uf-Gm-Uf-Cm-Uf-Gm-Uf-Am-Af-Um-Af-Cm-Cf 137 / 41 Ums-Afs-Um-Uf-Am-Cf-Am-Gf-Am-Cf-Am-Cf-Um-Af-Cm-Af-Cm-Gf-Gms-Afs-Gm 185 / 89 A1934AL Cfs-Ums-Uf-Am-Gf-Um-Uf-Um-Uf-Um-Uf-Cm-Cf-Am-Cf-Am-Gf-Am-Uf-Gm-Cf-Um-Uf-Gm-Uf 138 / 42 Ams-Cfs-Am-Af-Gm-Cf-f-Am-Uf-Cm-Uf-Gm-Uf-Gm-Gf-Am-Af-Am-Af-Am-Af-Cm-Uf-Am-Af-Gms-Gfs-Um 186 / 90 A1980-AL Afs-Gms-Af-Um-Gf-Cm-Af-Am-Gf-Cm-Af-Cm-Cf-Um-Gf-Am-Af-Um-Uf-Um-Cf-Um-Gf-Um-Uf 139 / 43 Ams-Afs-Cm-Af-Gm-Af-f-Am-Af-Um-Uf-Cm-Af-Gm-Gf-Um-Gf-Cm-Uf-Um-Gf-Cm-Af-Um-Cf-Ums-Ufs-Um 187 / 91 A2010-AL Gfs-Cms-Gf-Gm-Af-Am-Cf-Cm-Af-Um-Af-Gm-Cf-Um-Gf-Gm-Uf-Um-Af 140 / 44 Ums-Afs-Am-Cf-Cm-Af-Gm-Cf-Um-Af-Um-Gf-f-Gm-Uf-Um-Cf-Cms-Gfs-Cm 188 / 92 A2034-AL Cfs-Cms-Cf-Um-Uf-Gm-Uf-Gm-Uf-Um-Af-Gm-Uf-Am-Af-Um-Af-Am-Af 141 / 45 Ums-Ufs-Um-Af-Um-Uf-Am-Cf-Um-Af-Am-Cf-f-Am-Cf-Am-Af-Gms-Gfs-Gm 189 / 93 A2059-AL Gfs-Cms-Cf-Am-Cf-Am-Af-Um-Af-Am-Gf-Cm-Cf-Um-Cf-Cm-Af-Am-Af 142 / 46 Ums-Ufs-Um-Gf-Gm-Af-Gm-Gf-Cm-Uf-Um-Af-f-Um-Uf-Gm-Uf-Gms-Gfs-Cm 190 / 94 APC-AL Gfs-Ums-Cf-Am-Uf-Cm-Cf-Am-Cf-Am-Af-Um-Gf-Am-Gf-Am-Gf-Um-Af-Cm-Af 143 / 47 Ums-Gfs-Um-Af-Cm-Uf-Cm-Uf-Cm-Af-Um-Uf-Gm-Uf-Gm-Gf-Am-Uf-Gm-Af-Cms-Gfs-Am 191 / 95 ANC-AL Ufs-Ams-Af-Cm-Af-Um-Cf-Um-Cf-Gm-Af-Cm-Gf-Um-Af-Gm-Af-Cm-Af-Um-Cf 144 / 48 Gms-Afs-Um-Gf-Um-Cf-Um-Af-Cm-Gf-Um-Cf-Gm-Af-Gm-Af-Um-Gf-Um-Uf-Ams-Cfs-Um 192 / 96

[0157] Note: Unmodified sequences are numbered. Alternately modified sequences have "A" added before the number and "-AL" added after the number. For example, the unmodified sequence 1583 is numbered A1583-AL after the alternative modification.

[0158] The nucleotide abbreviations herein are as follows:

[0159] A = Adenosine-3'-phosphate

[0160] Am=2'-methoxyadenosine-3'-phosphate

[0161] Ams = 2'-methoxyadenosine-3'-phosphorothioate

[0162] Af = 2'-fluoroadenosine-3'-phosphate

[0163] Afs = 2'-fluoroadenosine-3'-phosphorothioate

[0164] G = Guanosine-3'-phosphate

[0165] Gm = 2'-methoxyguanosine-3'-phosphate

[0166] Gms = 2'-methoxyguanosine-3'-phosphorothioate

[0167] Gf = 2'-fluoroguanosine-3'-phosphate

[0168] Gfs = 2'-fluoroguanosine-3'-phosphorothioate

[0169] C = Cytidine-3'-phosphate

[0170] Cm = 2'-methoxycytidine-3'-phosphate

[0171] Cms = 2'-methoxycytidine-3'-phosphorothioate

[0172] Cf = 2'-fluorocytidine-3'-phosphate

[0173] Cfs = 2'-fluorocytidine-3'-phosphorothioate

[0174] U = Uridine-3'-phosphate

[0175] Um = 2'-methoxyuridine-3'-phosphate

[0176] Ums = 2'-methoxyuridine-3'-phosphorothioate

[0177] Uf = 2'-fluorouridine-3'-phosphate

[0178] Ufs = 2'-fluorouridine-3'-phosphorothioate

[0179] The P value of the experimental data used for comparison in the following examples of the present invention is <0.05, and the difference is statistically significant.

[0180] Example 1: Synthesis of oligonucleotides

[0181] Synthesized by chemical method The unmodified oligonucleotide sequences are SEQ ID NOs. 1-48, 49-96, and The modified oligonucleotide sequences are SEQ ID NOs. 97-144, 145-192.

[0182] 1. Synthesis of Modified Oligonucleotides

[0183] 1.1 Synthesis of modified oligonucleotide sequences (taking A1583-AL as an example)

[0184] The sequence corresponding to the modified oligonucleotide sequence A1583-AL is:

[0185] 5'-Cfs-Ums-Uf-Cm-Uf-Am-Af-Um-Gf-Am-Gf-Um-Cf-Gm-Af-Cm-Uf-Um-Uf-Gm-Af-3' (SEQ ID NO. 130)

[0186] The antisense strand sequence is:

[0187] 5'-Ams-Afs-Am-Gf-Um-Cf-Gm-Af-Cm-Uf-Cm-Af-Um-Uf-Am-Gf-Am-Af-Gms-Afs-Am-3' (SEQ ID NO. 178)

[0188] The odd-numbered sites of the sense strand are all modified with 2'-fluoro (2'-F) and the even-numbered sites are all modified with 2'-methoxy (2'-OMe); the odd-numbered sites of the antisense strand are all modified with 2'-methoxy (2'-OMe) and the even-numbered sites are all modified with 2'-fluoro (2'-F). There are two phosphorothioate diester bonds at the 5' end of the sense strand and the 5' / 3' end of the antisense strand.

[0189] Instruments and reagents: OligoPilot 400 synthesizer from GE, USA. The solid phase carrier is a universal carrier of cross-linked polystyrene beads, model Primer support 5G Unylinker350 (manufactured by Cytiva).

[0190] Preparation method:

[0191] According to the monomer concentration of 0.15 M, prepare the following nucleotide monomer solutions with acetonitrile:

[0192] DMT-A-OMe phosphoramidite monomer (Formula 1), DMT-C-OMe phosphoramidite monomer (Formula 2), DMT-G-OMe phosphoramidite monomer (Formula 3), DMT-U-OMe phosphoramidite monomer (Formula 4), DMT-AF phosphoramidite monomer (Formula 5), ​​DMT-CF phosphoramidite monomer (Formula 6), DMT-GF phosphoramidite monomer (Formula 7), DMT-UF phosphoramidite monomer (Formula 8) and DMT-dT phosphoramidite monomer (Formula 9).

[0193]

[0194]

[0195]

[0196] Prepared by the following steps:

[0197] 1) Deprotection

[0198] A 3% dichloroacetic acid solution in toluene was used as a deprotection agent to remove the DMT protecting group, followed by washing with acetonitrile.

[0199] 2) Coupling

[0200] Each nucleotide monomer was coupled in acetonitrile using 0.25 M 5-ethylthiotetrazolyl as an activating agent, followed by washing with acetonitrile.

[0201] (3) Oxidation / sulfurization

[0202] Oxidation: Oxidation was carried out using a 0.05 M iodine solution in pyridine / water (90 / 10) as an oxidant, followed by washing with acetonitrile.

[0203] Sulfurization: Use 3% pyridine solution of hydrogenated xanthan gum as the sulfurizing agent for sulfurization, and then use acetonitrile for washing.

[0204] 4) Hydroxyl protection

[0205] Hydroxyl protection was performed using 10% acetic anhydride tetrahydrofuran solution (CAP A) and tetrahydrofuran / pyridine / nitromethylimidazole 74 / 10 / 16 (v / v / v) (CAP B) as hydroxyl protecting reagents, followed by rinsing with acetonitrile.

[0206] Repeat the above steps and cycle according to the set sequence to obtain a fully protected product.

[0207] 5) Deprotection

[0208] A 3% dichloroacetic acid solution in toluene was used as a deprotection agent to remove the DMT protecting group of the last nucleotide, followed by washing with acetonitrile.

[0209] 6) Aminolysis and purification

[0210] The solid phase carrier is transferred to the reactor, concentrated ammonia water (25-28%) is added, and after maintaining the aminolysis at 60°C for 12 hours, the system is cooled to room temperature and the mixture is transferred to a filter press, eluted with a mixed solution of purified water and ethanol, the filtrate is combined, passed through a chromatography column, concentrated, and freeze-dried to obtain the product.

[0211] 7) Annealing

[0212] The purified sense strand and antisense strand were mixed in a 1:1 ratio, heated to 95°C for 3 minutes, and then slowly cooled to room temperature to form a double strand.

[0213] 1.2 Synthesis of other modified sequences and positive controls

[0214] According to the above synthesis method, Other modified oligonucleotides and modified positive control sequences, where for the antisense strand of the siRNA sequence, odd-numbered positions (i.e., positions 1, 3, 5, 7...21, 23) are modified with 2'-methoxy, and even-numbered positions (i.e., positions 2, 4, 6, 8...20, 22) are modified with 2'-fluoro. For the sense strand complementary to the antisense strand, the complementary pairing position on the sense strand is modified with 2'-methoxy at the position where the antisense strand is modified, and the complementary pairing position on the sense strand is modified with 2'-fluoro; the complementary pairing position on the antisense strand is modified with 2'-methoxy at the position where the antisense strand is modified with 2'-fluoro.

[0215] 2. Synthesis of unmodified oligonucleotides

[0216] The sequence of the small interfering RNA with sequence number 1583 is:

[0217] Sense strand: 5'- CUUCUAAUGAGUCGACUUUGA -3' (SEQ ID NO. 34)

[0218] Antisense strand: 5'-AAAGUCGACUCAUUAGAAGAA -3' (SEQ ID NO. 82)

[0219] Instruments and reagents: Qingke 192 P model DNA / RNA automatic synthesizer, whose solid phase carrier is a universal carrier of cross-linked polystyrene beads, model Primer support 5G Unylinker 350 (cytiva manufacturer).

[0220] Preparation method:

[0221] According to the monomer concentration of 0.15 M, the following nucleotide monomer solutions were prepared with acetonitrile: DMT-A-2'-O-TBDMS phosphoramidite monomer (Formula 10), DMT-C-2'-O-TBDMS phosphoramidite monomer (Formula 11), DMT-G-2'-O-TBDMS phosphoramidite monomer (Formula 12) and DMT-U-2'-O-TBDMS phosphoramidite monomer (Formula 13).

[0222] Formula 10 Formula 11

[0223] Formula 12 Formula 13

[0224] Prepared by the following steps:

[0225] The solid phase carrier is loaded into the designated position of the synthesizer, and the corresponding fully protected product is obtained after several synthesis cycles. The synthesis cycle includes (1) deprotection, (2) coupling, (3) oxidation / sulfurization and (4) hydroxyl protection. The cycle process and the reagents used are described as follows:

[0226] (1) Deprotection

[0227] 3% dichloroacetic acid toluene solution was used as a deprotection agent to remove the DMT protecting group, followed by washing with acetonitrile.

[0228] (2) Coupling

[0229] Each nucleotide monomer was coupled in acetonitrile using 0.25 M 5-ethylthiotetrazolyl as an activating agent, followed by washing with acetonitrile.

[0230] (3) Oxidation / sulfurization

[0231] Oxidation: Oxidation was performed using a 0.05 M iodine solution in pyridine / water (90 / 10) as the oxidant, followed by rinsing with acetonitrile.

[0232] Sulfurization: Use 3% hydrogenated xanthan gum in pyridine as the sulfurizing agent for sulfurization, and then use acetonitrile for washing.

[0233] (4) Hydroxyl protection

[0234] Hydroxyl protection was performed using 10% acetic anhydride tetrahydrofuran solution (CAP A) and tetrahydrofuran / pyridine / nitromethylimidazole 74 / 10 / 16 (v / v / v) (CAP B) as hydroxyl protecting reagents, followed by rinsing with acetonitrile.

[0235] Repeat the above steps and cycle according to the set sequence to obtain a fully protected product.

[0236] (5) Use 3% dichloroacetic acid toluene solution as a deprotection reagent to remove the DMT protecting group of the last nucleotide, and then use acetonitrile for washing.

[0237] (6) Aminolysis and purification

[0238] The solid phase carrier after the reaction is transferred to a reactor, and concentrated ammonia water (25-28%) is added. After maintaining the aminolysis at 60°C for 12 hours, the system is cooled to room temperature and the mixture is transferred to a filter press. It is eluted with a mixed solution of purified water and ethanol, and the filtrate is combined, passed through a chromatography column, concentrated, and freeze-dried to obtain a 2'-O-TBDMS protected product.

[0239] (7) Remove TBDMS

[0240] Add DMSO and triethylamine hydrofluoric acid to the obtained product, react at 60°C for 2h, then add ammonium acetate aqueous solution to the reaction solution, shake and mix, add anhydrous ethanol, shake and mix, and crystallize at -20°C for 8-12h. After centrifugation, pour off the supernatant, and rinse the precipitate with anhydrous ethanol to obtain a single-chain product without modification.

[0241] (8) Annealing

[0242] The unmodified sense strand and antisense strand were mixed in a 1:1 ratio, heated to 95°C and maintained for 3 min, and then slowly cooled to room temperature to form an unmodified double-stranded strand.

[0243] 3. Synthesis of other sequences

[0244] Synthesized according to the above method Other sequences in .

[0245] Example 2: Inhibitory effect of unmodified oligonucleotides on the AGT gene

[0246] The inhibitory activity of the 48 unmodified oligonucleotide sequences synthesized in Example 1 on the AGT gene was tested. The results showed that the unmodified sequences 1583, 1812, 1063 and 740 had a significant inhibitory effect on the expression of AGT mRNA in HepG2 cells. Among them, 1583 had the highest inhibition rate, reaching 64.50%, which was higher than the positive control; the inhibition rates of 1812, 1063 and 740 were also above 50%.

[0247] 1. Experimental Materials

[0248] Unmodified oligonucleotides: The unmodified oligonucleotide sequences listed in Example 1 were synthesized

[0249] Cell type: HepG2 cells (Saiye, H1-1701)

[0250] Positive control: APC (Zilebesiran drug sequence from Alnylam) sense strand and antisense strand ( 47 and 95), synthesized in Example 1

[0251] Drug solvent: sterile enzyme-free water, Gibco Opti-MEM

[0252] 2. Experimental methods

[0253] qRT-PCR was used to detect the inhibitory effect of the samples on the expression of AGT gene mRNA in HepG2 cell line.

[0254] 2.1 Cell culture

[0255] Take the subcultured HepG2 cell line, and culture the logarithmically growing cells with 10% fetal bovine serum DMEM medium (supplemented with 100× penicillin-streptomycin 10 μL / mL, Gibco, 15070063), place them in a cell culture incubator at 37°C with 5% CO2, and change the medium once a day. Digest and subculture with 0.25% trypsin, centrifuge at 800 r / min for 3 min, discard the supernatant, and add fresh culture medium for subculture.

[0256] 2.2 Cell transfection

[0257] Preparation of transfection mixture: Mix Lipofectamine RNAiMAX (Thermo Fisher Scientific) and Opti-MEM in a volume ratio of 2:98 and vortex to mix.

[0258] Preparation of transfection reagent: Add 60 μL of siRNA solution diluted in Opti-MEM to 60 μL of transfection mixture in a volume ratio of 1: 1, vortex and let stand at room temperature for 15 min to obtain lipid nanoparticles (LNP). Take 12.5 μL for encapsulation efficiency detection. The encapsulation efficiency meets the transfection requirements.

[0259] Transfection reagent for blank control group: Add 60 μL of prepared transfection mixture to 60 μL of Opti-MEM. Vortex to mix well and let stand at room temperature for 15 min.

[0260] Add the prepared transfection reagent to a 24-well cell culture plate (100 μL per well) to make the final siRNA concentration in each well 0.07 nM. Add 500 μL of cell suspension (1.5×10 5 After mixing using the cross method, the cells were placed in a 37°C, 5% CO2 cell culture incubator for 40 h.

[0261] 2.3 AGT mRNA detection

[0262] 1) RNA extraction

[0263] a. Aspirate the culture medium in the 24-well plate, add 0.5 mL 1 × PBS to each well to wash the cells, and aspirate the PBS. Add 0.5 mL TRIzol reagent to the wells, blow the cells with the pipette tip to fully lyse, transfer to a 1.5 mL RNase-free EP tube, and let stand at room temperature for 5 min.

[0264] b. Add 0.1 mL of chloroform to each tube, shake vigorously for 15 seconds, and let stand at room temperature for 5 minutes. Centrifuge at 4°C, 12,000 × g for 15 minutes, and take 200 μL of the supernatant into a new EP tube.

[0265] c. Add an equal volume of isopropanol, gently mix the liquid in the tube by inverting it upside down, let it stand at -20℃ for 10 min, centrifuge at 4℃, 12,000 × g for 15 min, and discard the supernatant.

[0266] d. Add 0.5 mL of 75% ethanol, gently wash the RNA precipitate, centrifuge at 4°C 12,000 × g for 5 min, and remove the supernatant. Repeat the rinse once, centrifuge at 4°C 12,000 × g for 1 min, and remove the residual ethanol with a micropipette tip.

[0267] e. Dry the residual ethanol at room temperature for 2-3 min, and add 40 μL RNase-free ddH2O to dissolve.

[0268] 2) RNA concentration detection

[0269] The RNA concentration was tested using nanodrop. 2 μL RNase-free ddH2O was used as a blank control, and 2 μL RNA sample was used for each test. The sample concentration was recorded.

[0270] 3) AGT mRNA reverse transcription

[0271] Reverse transcription reagent (Takara, RR036A), RNA solution and water were mixed in a volume ratio of 2:5:3, reacted at 37°C for 15 min, 85°C for 5 s, and finally maintained at 4°C. The cDNA obtained after the reaction was diluted 5 times with sterile enzyme-free water.

[0272] 4) Quantitative detection of AGT mRNA

[0273] In a 15 mL centrifuge tube, qPCR reagent (Takara, RR82WR), upstream primers (GAPDH-F: 5'-AGTATGACAACAGCCTCAAG-3' (SEQ ID NO: 193), AGT-F: 5'-ACTATCTCCCCGGACCATCC-3' (SEQ ID NO: 195)) and downstream primers (GAPDH-R: 5'-TCATGAGTCCTTCCACGATA-3' (SEQ ID NO: 194), AGT-R: 5'-CCTGATGCGGTCATTGCTCA-3' (SEQID NO: 196)) were added in a volume ratio of 5:0.1:0.1 and mixed, and marked as solution A.

[0274] Label a 1.5 mL EP tube, add diluted cDNA and water at a volume ratio of 1:3.8, mix well, and label it as solution B.

[0275] Add 5.2 μL of solution A and 4.8 μL of solution B to each well of a 96-well PCR plate. Cover with a sealing film, centrifuge at 3000 rpm for 1 min, and test on an analyzer.

[0276] *This step is performed on ice to maintain low temperature conditions.

[0277] Place the plate into the qPCR instrument and run the following program:

[0278] Pre-denaturation: 95°C, 30 sec;

[0279] Cyclic reaction: 95°C, 5 sec; 60°C, 34 sec; 40 cycles;

[0280] Melting curve: 95℃, 15 sec; 60℃, 60 sec; 95℃, 15 sec.

[0281] The running time is about 2 h. Analyze the experimental results and calculate 2 -ΔΔCt .

[0282] 2.4 Data Processing

[0283] The calculation formula of AGT mRNA expression rate (%) is:

[0284] Expression rate = (AGT mRNA expression level / AGT mRNA expression level in blank control group) × 100%;

[0285] The calculation formula of AGT gene expression inhibition rate (%) is:

[0286] AGT gene expression inhibition rate = 1-expression rate (%).

[0287] 3. Experimental results

[0288] Specific data on the inhibitory effect of synthetic unmodified oligonucleotides on AGT gene expression are listed in and Figure 1 .

[0289] 1) Some unmodified sequences had significant inhibitory effects on AGT gene expression, including 1583, 1812, 1063 and 740. The strongest inhibitory effects were found in the 1583 and 1812 groups, with inhibition rates of 64.50% and 61.04%, respectively.

[0290] surface Inhibition rate of AGT gene expression by unmodified sequence

[0291] Sequence Name Inhibition Rate 1583 64.50% APC 60.65% 1812 61.04% 1063 55.34% 740 50.45%

[0292] from It can be seen that the unmodified sequences 1583, 1812, 1063 and 740 have a significant inhibitory effect on the expression of AGT mRNA in HepG2 cells. The strongest inhibitory effect is in the 1583 and 1812 groups, with inhibition rates of 64.50% and 61.04%, respectively. Among them, the inhibition rate of 1583 is 64.50%, which is higher than the 60.65% of Yangshen APC; the inhibition rates of other groups are also above 50%.

[0293] The above compounds have a significant inhibitory effect on AGT gene expression, with inhibition rates all above 50%.

[0294] 2) Some unmodified sequences had an inhibitory effect on AGT gene expression between 0–50%, including 1615, 2034, 1267, 1384, 1221, 904, 1030, 1748, 1155, 760, 1876, 1296, 673, 994, 1642, 1912, 720, 830, 2010, 50, 422, 546, 622, 1323, 1096, 150, 1980, 128, 1494, 1934, 167 and other double-stranded siRNAs.

[0295] 4) Some sequences had no inhibitory effect on AGT gene expression, including double-stranded siRNAs such as 478, 289, 226, 490, 2059, 262, 1530, 198, 11, 341 and 1461. The inhibition rate of 1461 was less than -20%. These double-stranded siRNAs had no inhibitory effect on AGT gene expression.

[0296] Note: The inhibition rate of NC on AGT gene expression was 0.73%.

[0297] The unmodified sequences 1583, 1812, 1063, 740, 1615, 2034, 1267, 1384 and 1221 designed in the present invention can significantly inhibit the expression of the AGT gene (inhibition rate is greater than 30%), thereby reducing the concentration of angiotensinogen in the blood, thereby lowering blood pressure and achieving the treatment of hypertension.

[0298] Example 3: Effect of Alternating Modification Strategy on Oligonucleotide Inhibition of AGT Gene

[0299] The present disclosure adopts a 2′-F and 2′-OMe alternating modification scheme for the unmodified oligonucleotide sequences SEQ ID NO. 1-98 designed in the present disclosure to examine the effect of such modification on the activity of the unmodified sequences.

[0300] Activity test results showed that the double-stranded siRNA using 2'-OMe and 2'-F alternating modified sequences A1583-AL, A1812-AL and A1063-AL had an inhibition rate of more than 60% on the AGT gene; the inhibition rates of A740-AL and A1615-AL were also high, reaching more than 50%.

[0301] At the same time, it was found that the alternating modification of 2'-F and 2'-OMe had different effects on the activity of different sequences. Some sequences could significantly increase their inhibition rate, some sequences had reduced inhibition rate after modification, and some sequences had little effect on inhibition rate. Therefore, it can be seen that the alternating modification scheme of 2'-OMe and 2'-F has inconsistent effects on different sequences, and not all sequences can improve inhibition after the same modification.

[0302] 1. Experimental Materials

[0303] Alternating modified oligonucleotides: The modified oligonucleotides listed in Table 3 were modified with 2'-OMe and 2'-F alternatingly, wherein the odd-numbered positions of the sense strand and the even-numbered positions of the antisense strand were all modified with 2'-F, and the even-numbered positions of the sense strand and the odd-numbered positions of the antisense strand were all modified with 2'-OMe, and were synthesized in Example 1.

[0304] Cell type: HepG2 cells (Saiye, H1-1701)

[0305] Positive control drug: alternatively modified APC, wherein the odd-numbered positions of the sense strand and the even-numbered positions of the antisense strand are both modified with 2'-F, and the even-numbered positions of the sense strand and the odd-numbered positions of the antisense strand are both modified with 2'-OMe, synthesized in Example 1.

[0306] Drug solvent: sterile enzyme-free water, Gibco DMEM.

[0307] 2. Experimental Methods

[0308] The experimental method is the same as that in Example 2.

[0309] 3. Experimental Results

[0310] The specific data of the inhibitory effect of alternatively modified oligonucleotides on AGT gene expression are shown in Tables 4 and Figure 2 .

[0311] 1) Except for Yangshen, the other five alternatively modified sequences, including A1583-AL, A1812-AL, A1063-AL and A740-AL, had a significant inhibitory effect on AGT gene expression. Among them, the inhibition rates of A1583-AL, A1812-AL and A1063-AL all reached 60%. Compared with the unmodified sequence, the inhibitory effect of the alternatively modified sequence was improved.

[0312] Table 4 Inhibition rate of AGT gene expression by alternating modified sequences

[0313] Unmodified Serial Number Sequence Number Inhibition Rate Inhibition Rate of Unmodified Sequence Modified to Improve Inhibition Rate 1583 A1583-AL 70.00% 64.50% 5.50% APC APC-AL 69.00% 60.65% 8.35% 1812 A1812-AL 67.10% 61.04% 6.06% 1063 A1063-AL 65.10% 55.34% 9.76% 740 A740-AL 57.70% 50.45% 7.25%

[0314] As can be seen from Table 4, the use of 2'-OMe and 2'-F alternating modification sequences A1583-AL, A1812-AL, A1063-AL and A740-AL can significantly inhibit the expression of the AGT gene, and the inhibition rate is more than 50%. Among them, the inhibition rates of A1583-AL, A1812-AL and A1063-AL all reached 60%.

[0315] It can be seen that the alternating modified sequences A1583-AL, A1812-AL, A1063-AL and A740-AL can inhibit the expression of the AGT gene, thereby inhibiting the concentration of angiotensinogen in the blood, and can be used to treat hypertension.

[0316] Moreover, the unmodified sequences corresponding to the above-mentioned alternating modified sequences, namely 1583, 1812, 1063 and 740, also have a significant inhibitory effect on the expression of the AGT gene, with the inhibition rate being above 50%. This indicates that the sequences designed in the present disclosure, whether unmodified or modified with 2'-OMe and 2'-F alternatingly, can inhibit the expression of the AGT gene.

[0317] By comparing the inhibition rate with that of the unmodified sequence, it can be seen that the alternating modification has different effects on the activity of different sequences, and the increased inhibition rate after modification is between 5.01%–9.76%.

[0318] 2) The inhibition rate of AGT gene expression by some alternative modified sequences was between 0-50%, including A1615-AL, A2034-AL, A1267-AL, A1384-AL, A1221-AL, A904-AL, A1030-AL, A1748-AL, A1155-AL, A760-AL, A1876-AL, A1296-AL, A673-AL, A994-AL L, A1642-AL, A1912-AL, A720-AL, A830-AL, A2010-AL, A50-AL, A422-AL, A546-AL, A622-AL, A1323-AL, A1096-AL, A150-AL, A1980-AL, A128-AL, A1494-AL, A1934AL and A1675-AL. Compared with the unmodified sequence, it can be seen that the alternating modification of 2'-OMe and 2'-F has different effects on the inhibition rate of different sequences, and the inhibition rate increased by alternating modification is between 2.54% and 6.48%.

[0319] 3) Some alternating modified sequences had no inhibitory effect on AGT gene expression, including double-stranded siRNAs such as A478-AL, A289-AL, A226-AL, A490-AL, A2059-AL, A262-AL, A1530-AL, A198-AL, A11-AL, A341-AL, and A1461-AL. For example, the inhibition rate of A1461-AL on AGT was -26.60%. By comparing with the unmodified sequence, it can be seen that the alternating modification of 2'-OMe and 2'-F has different effects on the activity of different sequences, and the inhibition rate after alternating modification is increased between -5.99% and 2.20%.

[0320] Note: The inhibition rate of NC on AGT gene expression is -1.5%.

[0321] It can be seen that the oligonucleotide sequences designed for AGT mRNA disclosed in the present invention, after being modified alternately with 2'-OMe and 2'-F, have a significant inhibitory effect on AGT gene expression, including A1583-AL, A1812-AL, A1063-AL, A740-AL, A1615-AL, A2034-AL, A1267-AL, A1384-AL and A1030-AL. Among them, A1583-AL, A1812-AL and A1063-AL have the highest inhibition rates, all reaching 60%, and can be used to develop drugs for treating AGT gene-related diseases.

[0322] Moreover, the alternating modification of 2'-OMe and 2'-F has different effects on different unmodified oligonucleotide sequences designed in the present invention. The activities of some sequences are improved, some sequences are reduced, and some sequences have no change in activity. Not all sequences can improve their inhibitory effects after alternating modification, and there will be certain differences between different sequences.

[0323] Example 4: Comparison of inhibition rates between the designed sequences disclosed herein and similar sequences disclosed in the prior art

[0324] The 10 sequences disclosed in the present invention with higher inhibitory effects on AGT gene expression were compared with similar sequences disclosed in the prior art. The results showed that the unmodified sequence 1812 disclosed in the present invention had no similar disclosed sequences, and sequences 1583, 1063, 740, 1615, 2034, 1267, 1384, 1030 and 994 were superior to similar sequences in disclosed patents in terms of inhibitory effects on AGT mRNA expression in HepG2 cells at the same concentration. For example, the inhibition rate of the disclosed sequence 1583 was 13.57% higher than that of the similar sequence 1583P; the inhibition rate of the disclosed sequence 1063 was 28.14% higher than that of the similar sequence 1063P; and the inhibition rate of the disclosed sequence 740 was 12.51% higher than that of the similar sequence 740P.

[0325] 1. Experimental Materials

[0326] The sequences 1583, 1063, 740, 1615, 2034, 1267, 1384, 1030 and 994 in the present disclosure, as well as the sequences disclosed in the prior art close to these sequences, include sequences 1583P, 1063P, 740P, 1615P, 2034P, 1267P, 1384P, 1030P and 994P, as shown in Table 5.

[0327] Table 5 Comparison of the sequences in this disclosure with the similar sequences disclosed in the prior art

[0328] Source Sequence number The number in this patent Sense strand sequence 5'–3' SEQ ID NO. Antisense strand sequence 5'–3' SEQ ID NO. The Disclosure 1583 1583 <![CDATA[ CUUCUAAUGAGUCGACUUUG A]]> 34 <![CDATA[ AAAGUCGACUCAUUAGAAGAA ]]> 83 WO2023014765A1 AD-1633958 1583P <![CDATA[ CUUCUAAUGAGUCGACUUUG In]]> 197 <![CDATA[AC AAAGUCGACUCAUUAGAAGAA ]]> 206 The Disclosure 1063 1063 <![CDATA[ CAAGGUGGAGGGUCUCACUUU ]]> 23 <![CDATA[ AGUGAGACCCUCCACCUUGUC ]]> 72 CN106574268B AD-60792 1063P <![CDATA[ CAAGGUGGAGGGUCUCACUUU ]]> 198 <![CDATA[AA AGUGAGACCCUCCACCUUGUC ]]> 207 The Disclosure 740 740 <![CDATA[ GCUGCUGAGAAGAUUGACAG G]]> 17 <![CDATA[ UGUCAAUCUUCUCAGCAGCAA ]]> 66 WO2023014765A1 AD-1633321 740P <![CDATA[ GCUGCUGAGAAGAUUGACAG In]]> 199 <![CDATA[AC UGUCAAUCUUCUCAGCAGCAA ]]> 208 The Disclosure 1615 1615 <![CDATA[ GCCGUUUCUCCUUGGUCUAAG ]]> 35 <![CDATA[ UAGACCAAGGAGAAACGGC AND]]> 84 CN114763547A 1615P <![CDATA[ GCCGUUUCUCCUUGGUCUAAG ]]> 200 <![CDATA[CU UAGACCAAGGAGAAACGGC ]]> 209 The Disclosure 2034 2034 <![CDATA[ CCCUUGUGUUAGUAAUAAA ]]> 46 <![CDATA[ UUUAUUACUAACACAAGGG ]]> 95 CN113862268A 2034P <![CDATA[ CCCUUGUGUUAGUAAUAAA CG]]> 201 <![CDATA[ UUUAUUACUAACACAAGGG AT]]> 210 The Disclosure 1267 1267 <![CDATA[GGA GGUGCUGAACAGCAUUUU ]]> 27 <![CDATA[ AAUGCUGUUCAGCACCUCC CC]]> 76 WO2023014765A1 AD-1658955 1267P <![CDATA[A GGUGCUGAACAGCAUUUU UU]]> 202 <![CDATA[AAAA AAUGCUGUUCAGCACCUCC ]]> 211 The Disclosure 1384 1384 <![CDATA[ GUUUGCUGUGUAUGAUCAA AT]]> 30 <![CDATA[ UUGAUCAUACACAGCAAACAG ]]> 79 WO2023088227A1 AD00255 1384P <![CDATA[CU GUUUGCUGUGUAUGAUCAA ]]> 203 <![CDATA[ UUGAUCAUACACAGCAAACAG ]]> 212 The Disclosure 1030 1030 <![CDATA[ GCUGAUCCAGCCUCACUAUG C]]> 22 <![CDATA[ AUAGUGAGGCUGGAUCAGCAG ]]> 71 WO2023014765A1 AD-1633587 1030P <![CDATA[ GCUGAUCCAGCCUCACUAUG In]]> 204 <![CDATA[AC AUAGUGAGGCUGGAUCAGCAG ]]> 213 The Disclosure 994 994 <![CDATA[ GACUCAAGUGCCCUUCACUG A]]> 21 <![CDATA[ AGUGAAGGGCACUUGAGUCAC ]]> 70 WO2023014765A1 AD-1633551 994P <![CDATA[ GACUCAAGUGCCCUUCACUG In]]> 205 <![CDATA[AC AGUGAAGGGCACUUGAGUCAC ]]> 214

[0329] The sequences in Table 5 were synthesized using the same method as in Example 1.

[0330] 2. Experimental methods

[0331] The inhibition rate of the oligonucleotides listed in Table 5 on the AGT gene was detected, and the specific experimental method was the same as that in Example 2.

[0332] 3. Experimental results

[0333] The inhibitory activity of the sequences in the present disclosure and the sequences similar to those disclosed in the patents on AGT gene expression is shown in Table 6.

[0334] Table 6 Comparison of the activity of the designed sequences disclosed in this invention and similar sequences disclosed in the prior art

[0335] The serial number of this publication Inhibition rate (%) Similar sequence number Inhibition rate (%) improve(%) 1583 64.50 1583P 50.93 13.57 1063 55.34 1063P 27.20 28.14 740 50.45 740P 37.94 12.51 1615 43.42 1615P 38.13 5.29 2034 34.05 2034P 24.98 9.07 1267 33.79 1267P 31.10 2.69 1384 33.62 1384P 28.39 5.23 1030 27.84 1030P 25.81 2.03 994 21.21 994P 20.89 0.32

[0336] As can be seen from Table 6, the unmodified sequences 1583, 1063, 740, 1615, 2034, 1267, 1384, 1030 and 994 screened in the present disclosure have better inhibitory effects on AGT gene expression than similar sequences in the disclosed patents at the same concentration. For example, the inhibition rate of the disclosed sequence 1583 is 64.50%, while the inhibition rate of the similar sequence 1583P disclosed in WO2023014765A1 is only 50.93%, and the inhibition rate is increased by 13.57%; the inhibition rate of the disclosed sequence 1063 is 55.34%, which is 28.14% higher than the similar sequence 1063P disclosed in CN106574268B; the inhibition rate of the disclosed sequence 740 is 50.45%, which is 12.51% higher than the similar sequence 740P disclosed in WO2023014765A1.

[0337] It can be seen from this that the inhibition rates of AGT gene expression by oligonucleotides with similar sequences are not necessarily close, but they are likely to be very different. For example, compared with the disclosed sequence 1583P, the 3' end of the sense strand of the disclosed sequence 1583 is different by 1 nucleotide, and the 5' end of the antisense strand is 2 nucleotides less (AC), but the inhibition rate is increased by 13.57%; compared with the disclosed sequence 1063P, the sense strand of the disclosed sequence 1063 is the same, and the 5' end of the antisense strand is 2 bases less (AA), but the inhibition rate is increased by 28.14%; compared with the disclosed sequence 740P, the 3' end of the sense strand of the disclosed sequence 740 is different by 1 base, and the 5' end of the antisense strand is 2 bases less (AC), but the inhibition rate is increased by 12.51%. Although these sequences in the disclosure are very different from the disclosed sequences in the prior art, the inhibition rate of AGT gene expression is significantly improved.

[0338] The present invention designs 46 small interfering RNA (siRNA) sequences for AGT mRNA sequences, including 46 sense strands and 46 antisense strands, and performs 2'-OMe and 2'-F alternating modifications on these sequences. By testing the inhibitory activity of the unmodified sequences and the alternating modified sequences on AGT gene expression, some target sequences with significant inhibitory effects on AGT gene expression were screened out.

[0339] 1. Among the 46 unmodified oligonucleotide sequences designed, different sequences had very different inhibitory activities on AGT mRNA expression. Some of these sequences, including 1583, 1812, 1063 and 740, had significant inhibitory effects on AGT gene expression. Among them, the inhibition rate of 1583 reached 64.50%, which was higher than the positive control; the inhibition rate of 1812 also reached 61.04%, and the inhibition rates of 1063 and 740 were also above 50%. Some sequences had higher activity, such as 1615, 2034 and 1267, which were between 30–50%. Some sequences had lower activity, and some sequences had no inhibitory effect.

[0340] It can be seen from this that not all siRNA sequences designed for AGT mRNA sequences have inhibitory activity on AGT gene expression. Different sequences can have very large differences. It takes a lot of creative work to screen out siRNA sequences that have obvious inhibitory effects on AGT gene expression.

[0341] 2. The 46 designed siRNA sequences were modified with 2'-F and 2'-Me alternately. The activity test results showed that the inhibitory activity of AGT gene expression was very different after the same alternating modification was applied to different sequences. Among them, the alternating modified sequences A1583-AL, A1812-AL, A1063-AL and A740-AL had a significant inhibitory effect on AGT gene expression, with an inhibitory activity of more than 50%. The activity of other sequences was below 50%.

[0342] It can be seen from this that not all basic sequences have strong inhibitory activity on AGT gene expression after alternating modification with 2'-F and 2'-Me. Different sequences will have very large differences. It takes a lot of creative work to screen out siRNA basic sequences that can enhance or retain significant inhibitory effects on AGT gene expression through alternating modification with 2'-F and 2'-Me.

[0343] 3. The 46 designed siRNA sequences had different effects on the activities of different sequences after alternating 2'-F and 2'-Me modifications.

[0344] 4. The unmodified sequences 1583, 1063, 740, 1615, 2034, 1267, 1384, 1030 and 994 screened in the present disclosure have better inhibitory effects on AGT gene expression than similar sequences in the disclosed patents at the same concentration. For example, the inhibition rate of the sequence 1583 disclosed in the present disclosure is 64.50%, while the inhibition rate of the similar sequence 1583P disclosed in WO2023014765A1 is only 50.93%, which is 13.57% higher; the inhibition rate of the sequence 1063 disclosed in the present disclosure is 55.34%, which is 28.14% higher than the similar sequence 1063P disclosed in CN106574268B; the inhibition rate of the sequence 740 disclosed in the present disclosure is 50.45%, which is 12.51% higher than the similar sequence 740P disclosed in WO2023014765A1.

[0345] The results show that the inhibition rates of AGT gene expression by oligonucleotides with similar sequences are not necessarily similar, but may be very different. Although the sequences disclosed in the present disclosure are slightly different from the sequences disclosed in the prior art, the inhibition rates of AGT gene expression are significantly improved.

Claims

1. A siRNA, comprising a sense strand and an antisense strand, characterized in that: The siRNA comprises any of the following oligonucleotide duplexes: 1) the sequence of the sense strand is shown in SEQ ID NO: 34 and the sequence of the antisense strand is shown in SEQ ID NO: 82; or, the sequence of the sense strand is shown in SEQ ID NO: 130 and the sequence of the antisense strand is shown in SEQ ID NO: 178; 2) the sequence of the sense strand is shown in SEQ ID NO: 39 and the sequence of the antisense strand is shown in SEQ ID NO: 87; or, the sequence of the sense strand is shown in SEQ ID NO: 135 and the sequence of the antisense strand is shown in SEQ ID NO: 183; 3) the sequence of the sense strand is shown in SEQ ID NO: 23 and the sequence of the antisense strand is shown in SEQ ID NO: 71; or, the sequence of the sense strand is shown in SEQ ID NO: 119 and the sequence of the antisense strand is shown in SEQ ID NO: 167; 4) the sequence of the sense strand is shown in SEQ ID NO: 17 and the sequence of the antisense strand is shown in SEQ ID NO: 65; or, the sequence of the sense strand is shown in SEQ ID NO: 113 and the sequence of the antisense strand is shown in SEQ ID NO: 161; 5) the sequence of the sense strand is shown in SEQ ID NO: 35 and the sequence of the antisense strand is shown in SEQ ID NO: 83; or, the sequence of the sense strand is shown in SEQ ID NO: 131 and the sequence of the antisense strand is shown in SEQ ID NO: 179; 6) the sequence of the sense strand is shown in SEQ ID NO: 45 and the sequence of the antisense strand is shown in SEQ ID NO: 93; or, the sequence of the sense strand is shown in SEQ ID NO: 141 and the sequence of the antisense strand is shown in SEQ ID NO: 189; 7) the sequence of the sense strand is shown in SEQ ID NO: 27 and the sequence of the antisense strand is shown in SEQ ID NO: 75; or, the sequence of the sense strand is shown in SEQ ID NO: 123 and the sequence of the antisense strand is shown in SEQ ID NO: 171; 8) the sequence of the sense strand is shown in SEQ ID NO: 30 and the sequence of the antisense strand is shown in SEQ ID NO: 78; or, the sequence of the sense strand is shown in SEQ ID NO: 126 and the sequence of the antisense strand is shown in SEQ ID NO: 174; 9) The sequence of the sense strand is shown in SEQ ID NO: 22 and the sequence of the antisense strand is shown in SEQ ID NO: 70; or, the sequence of the sense strand is shown in SEQ ID NO: 118 and the sequence of the antisense strand is shown in SEQ ID NO:

166.

2. The siRNA according to claim 1, wherein At least one nucleotide of the siRNA is conjugated to one or more targeting ligands.

3. The siRNA according to claim 2, characterized in that The targeting ligand comprises a carbohydrate, a polypeptide or a lipid.

4. The siRNA according to claim 3, characterized in that The targeting ligand comprises an amino sugar or cholesterol.

5. The siRNA according to claim 4, characterized in that The targeting ligand comprises GalNAc.

6. The siRNA according to claim 5, characterized in that The GalNac is monovalent GalNAc, divalent GalNAc, trivalent GalNAc or tetravalent GalNAc.

7. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the siRNA according to any one of claims 1 to 6 and a pharmaceutically acceptable carrier.

8. The pharmaceutical composition according to claim 7, characterized in that The pharmaceutically acceptable carrier is LNP.

9. The pharmaceutical composition according to claim 8, characterized in that The LNP is Lipofectamine ® RNAiMAX, containing 2,3-dioleyl-N-[2(argininecarboxamido)ethyl]-N,N-dimethyl-1-perfluorooctyl trifluoroacetate and dioleoylphosphatidylethanolamine.

10. The pharmaceutical composition according to claim 7, characterized in that The pharmaceutical composition also includes one or two of other AGT gene inhibitors and AGT protein inhibitors, wherein the AGT protein inhibitor includes an antibody targeting the AGT protein, and the AGT gene inhibitor includes one or more of a clip editor targeting the AGT gene, an antisense oligonucleotide targeting the mRNA transcribed from the AGT gene, and a microRNA.

11. The pharmaceutical composition according to claim 7, characterized in that The pharmaceutical composition also includes one or more of a diuretic, angiotensin converting enzyme inhibitor, angiotensin II receptor blocker, a calcium channel blocker and a beta receptor blocker.

12. A medicine kit, characterized in that: The kit comprises one or both of the siRNA according to any one of claims 1 to 6 or the pharmaceutical composition according to any one of claims 7 to 11.

13. A method for reducing AGT gene expression or inhibiting AGT replication for non-therapeutic purposes, characterized in that: The method comprises administering to the sample one or more of the siRNA of any one of claims 1 to 6, the pharmaceutical composition of any one of claims 7 to 11, and the kit of parts of claim 12.

Images