Application of SNARE protein in regulating and controlling replication level of oncolytic Newcastle disease virus

Abstract

The invention belongs to the technical field of biology, provides an application of SNARE protein in regulation and control of the replication level of oncolytic Newcastle disease virus, and proves that NDV infected A549 and Hela cells can significantly up-regulate the expression of a large amount of SANRE genes; representative SANRE protein YKT6 is selected as a research object, it is proved that overexpression of a functional mutant of the YKT6 protein and knock-down of the YKT6 protein both lead to decrease of the NDV replication level, and overexpression of the YKT6 protein can significantly enhance virus replication. The YKT6 protein enhances the assembly of virions and virus replication by promoting the membrane transport of the NDV F protein. The invention provides a new effect of the YKT6 protein in enhancing replication of NDV in tumor cells, and the YKT6 protein can be used as a new target for promoting oncolytic activity of NDV, and has a potential application prospect in the aspect of treatment of human and animal tumors.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and in particular relates to the application of SNARE protein in regulating the replication level of oncolytic Newcastle disease virus. Background Art

[0002] Newcastle disease virus (NDV) is a single-stranded, negative-strand, non-segmented RNA virus and the only member of the Paramyxoviridae family and the genus Avian Paramyxovirus. NDV is a pathogen of great significance to the poultry industry and is also a potent oncolytic virus. NDV can infect a variety of tumor cells, directly induce tumor cell death, and regulate the tumor microenvironment and immune microenvironment to promote the body's anti-tumor response.

[0003] The oncolytic activity of NDV has been verified in a variety of tumor cells, tumor animal models, and human clinical treatment trials. However, studies have shown that certain types of tumor cells can produce a strong antiviral response, inhibiting the replication of NDV and weakening the oncolytic activity of the virus. At present, the existing technology mainly enhances the oncolytic activity of NDV through the following three pathways: (1) Changing the cleavage site of the NDV fusion protein (F) to enhance the fusion activity of the virus. (2) Expressing immune regulatory cytokines in the NDV gene. (3) Expressing immune checkpoint inhibitors in the NDV genome. However, changing the cleavage site of the NDV F protein leads to increased virulence of the virus, increasing the environmental release of the virus and the risk of pathogenicity to birds; expressing cellular genes or immune checkpoint inhibitors in the NDV genome mainly enhances the oncolytic activity of the virus through the regulation of tumor immunity, but does not enhance the replication ability of the virus itself.

[0004] After NDV enters the host cell, the viral genome is transcribed in the host cell, and the translated viral proteins are eventually transported to the cell membrane, assembled into virus particles and released by budding. The newly synthesized viral proteins must hijack the host cell's material transport system and be transported to the cell membrane budding site. Vesicle transport is the main route for the transport of macromolecular substances in cells, and membrane fusion is the final stage of vesicle transport and a key step in unloading cargo to the destination. Soluble N-ethylmaleimide-sensitive factor connexin receptor (SNARE) is the smallest core machine that mediates membrane fusion. SNARE plays an important regulatory role in the intracellular transport, assembly and replication of proteins of various viruses. Therefore, SNARE proteins may play an important role in the replication process of NDV, and SNARE proteins are potential targets for enhancing NDV assembly and replication. Summary of the invention

[0005] In view of the shortcomings and defects of the prior art in enhancing the replication ability of oncolytic NDV, the present invention provides the application of SNARE protein in regulating the replication level of oncolytic Newcastle disease virus. Taking the interaction between NDV and SNARE protein as the starting point, the SNARE protein genes whose expression was significantly changed in NDV-infected human non-small cell lung cancer cells (A549) and human cervical cancer epithelial cells (Hela) were first screened; then different strategies were used to evaluate the effect of SNARE protein on the replication level of NDV in Hela cells; finally, the effect of SNARE family member YKT6 protein on NDV F protein transport and virus particle assembly was evaluated. The present invention proves that NDV infection of A549 and Hela cells can significantly upregulate the expression of a large number of SANRE genes; the representative SANRE protein YKT6 is selected as the research object, and it is proved that the overexpression of YKT6 protein functional mutants and the knockdown of YKT6 protein both lead to a decrease in the replication level of NDV, and the overexpression of YKT6 protein can significantly enhance viral replication. YKT6 protein enhances the assembly of virus particles and viral replication by promoting the membrane transport of NDV F protein. The present invention provides a new role of YKT6 protein in enhancing the replication of NDV in tumor cells, and YKT6 protein can be used as a new target for promoting the oncolytic activity of NDV, and has potential application prospects in the treatment of human and animal tumors.

[0006] To achieve the above object, the technical solution adopted by the present invention is as follows: The use of SNARE protein in regulating the replication level of oncolytic Newcastle disease virus, the sequence of the SNARE protein is one of the sequences shown in Genebank Accession NO. NM_001297438.2, NM_001145149.3, NM_001286210.1, NM_018467.3, NM_003764.4, NM_017919.3, NM_001318203.2, and the SNARE protein does not contain a transmembrane region.

[0007] Furthermore, the SNARE protein is YKT6 protein, and the sequence of the YKT6 protein is shown in Genebank Accession NO. NM_006555.4.

[0008] Furthermore, the application includes reducing the expression of oncolytic Newcastle disease virus envelope glycoprotein in the cytoplasm, and reducing the expression of viral NP, M, and F proteins in the cytoplasm.

[0009] Furthermore, the YKT6 protein was knocked down to reduce the expression level of the YKT6 protein.

[0010] Furthermore, the siRNA sequences targeting YKT6 are shown in SEQ ID NO. 95 and SEQ ID NO. 96.

[0011] Furthermore, the fluorescent quantitative PCR used for measuring YKT6 gene expression is shown in primers SEQ ID NO. 1 and SEQ ID NO. 2.

[0012] Furthermore, the sequences of fluorescent quantitative PCR primers used for determining the YKT6 gene interference efficiency are shown in SEQ ID NO. 97 and SEQ ID NO. 98.

[0013] Furthermore, the cysteine ​​site at position 194 or 195 of the YKT6 protein was mutated to serine, and the functional mutant was constructed using pCDNA3.1 as a vector.

[0014] Furthermore, the cysteine ​​site at position 194 of the YKT6 protein was mutated into serine to construct the YKT6-C194S mutant, and the primers for constructing the YKT6-C194S mutant are shown in SEQ ID NO.89 and SEQ ID NO.90; the cysteine ​​site at position 195 of the YKT6 protein was mutated into serine to construct the YKT6-C195S mutant, and the primers for constructing the YKT6-C195S mutant are shown in SEQ ID NO.91 and SEQ ID NO.92.

[0015] The present invention also provides a method for reducing the replication level of oncolytic Newcastle disease virus, knocking down YKT6 protein to reduce the expression level of YKT6 protein, and the sequence of the YKT6 protein is shown in Genebank Accession NO. NM_006555.4.

[0016] The present invention designs primers for 36 human SANARE genes and β-actin, and the sequences are shown in SEQ ID NO. 1 to SEQ ID NO. 74. The transcription level of SNARE genes in A549 or Hela cells infected with different NDV strains (Herts / 33, F48E8, La Sota) was determined by fluorescent quantitative PCR technology.

[0017] Furthermore, the SNARE family member YKT6 protein was selected as a representative, and the expression level of YKT6 protein in Hela cells infected with NDVF48E8 and La Sota was determined by Western blot method.

[0018] Furthermore, the transmembrane regions of VAMP1, VAMP7, STX6, USE1, STX11, STX17 and VTI1A proteins were deleted, and functional mutants of the above proteins were constructed using the pEGFP-C3 vector, and the primer sequences used were shown in SEQ ID NO. 75 to SEQ ID NO. 88; the cysteine ​​sites at positions 194 and 195 of the YKT6 protein were mutated into serine, and its functional mutants were constructed using the pCDNA3.1 vector, and the primer sequences used were shown in SEQ ID NO.89 to SEQ ID NO.92.

[0019] Furthermore, functional mutants of VAMP1, VAMP7, STX6, USE1, STX11, STX17, VTI1A and YKT6 proteins were overexpressed in Hela cells, which were then infected with NDV to measure the viral replication level.

[0020] Furthermore, small interfering RNA (siRNA) targeting YKT6 protein was synthesized, and the sequences are shown in SEQ ID NO. 95 and SEQ ID NO. 96. The siRNA was transfected into cells, and the effect of siRNA on the transcription level of YKT6 gene was verified by fluorescence quantitative PCR method, and the primer sequences of the fluorescence quantitative PCR used were shown in SEQ ID NO. 97 and SEQ ID NO. 98; the effect of siRNA on the expression of YKT6 protein was verified by Western blot method. YKT6-siRNA transfected Hela cells were infected with NDV to evaluate the level of viral replication.

[0021] Furthermore, a YKT6 expression plasmid was constructed, and the recognition site of siRNA therein was mutated by the overlap PCR method to make it resistant to siRNA, and the mutant primer sequences used were shown in SEQ ID NO. 99, SEQ ID NO. 100, SEQ ID NO. 101, and SEQ ID NO. 102. After YKT6 knockdown, YKT6 protein was complemented, and then NDV infection was performed to measure the viral replication level.

[0022] Furthermore, Hela cells were first transfected with YKT6-siRNA, and then co-transfected with plasmids expressing NDV matrix protein (M), nucleocapsid protein (NP), F protein and hemagglutinin-neuraminidase (HN). The culture supernatant was collected and the virus-like particles in the supernatant were purified by ultracentrifugation; the assembly efficiency of NDV virus-like particles (VLPs) was determined by Western blot.

[0023] Furthermore, NDV M, NP, F and HN expression plasmids were co-transfected into YKT6-siRNA-transfected Hela cells, cell membrane and cytoplasmic proteins were separated, and the efficiency of viral protein transport to the cell membrane was determined by Western blot.

[0024] Furthermore, an expression plasmid for expressing the YKT6 protein was constructed, and the primer sequences used were shown in SEQ ID NO. 99 and SEQ ID NO. 102. The YKT6 protein was overexpressed in Hela cells by plasmid transfection, and then infected with NDV to measure the viral replication level. Beneficial Effects

[0025] The present invention provides a new application of the SNARE family member YKT6 protein in promoting the assembly and replication of oncolytic NDV, and YKT6 protein as a new target in promoting the oncolytic activity of NDV, providing a new strategy and new target for the treatment of human and animal tumors using oncolytic NDV. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is a graph showing the results of SNARE gene expression measurement in A549 cells infected with NDV Herts / 33 strain.

[0027] Figure 2 This is a graph showing the results of SNARE gene expression measurement in Hela cells infected with NDV F48E8 strain.

[0028] Figure 3 This is a graph showing the results of SNARE gene expression measurement in Hela cells infected with NDV LaSota strain.

[0029] Figure 4 The results of the YKT6 protein expression assay in Hela cells infected with NDV F48E8 and LaSota strains are shown in Figure A. Figure A shows the detection of YKT6 protein in F48E8 infected cells; Figure B shows the quantitative analysis of YKT6 protein in F48E8 infected cells; Figure C shows the detection of YKT6 protein in LaSota infected cells; and Figure D shows the quantitative analysis of YKT6 protein in LaSota infected cells.

[0030] Figure 5 This is a diagram showing the identification results of SNARE protein mutant expression.

[0031] Figure 6The results of the determination of NDV titer in Hela cells expressing SNARE protein mutants are shown in Figure A. Figure A shows the NDV titer in Hela cells overexpressing VAMP1, VAMP7, STX6, USE1, STX11, STX17, and VTI1A protein mutants; Figure B shows the NDV titer in Hela cells overexpressing YKT6 protein mutants.

[0032] Figure 7 The results of the interference efficiency test of siRNA on YKT6 transcription and protein expression in Hela cells are shown in Figure A, where Figure A shows the transcription level of YKT6 gene in Hela cells transfected with siRNA; and Figure B shows the expression level of YKT6 protein in Hela cells transfected with siRNA.

[0033] Figure 8 The results of the determination of NDV replication level in YKT6 knockdown Hela cells are shown in Figure A. Figure A shows the replication kinetics of NDV in siRNA transfected Hela cells; Figure B shows the expression of F protein in siRNA transfected Hela cells.

[0034] Fig. 9 The results of the determination of NDV replication level in Hela cells after YKT6 knockdown and complementation are shown in Figure A. Figure A shows the expression identification of the YKT6 protein complementation plasmid; Figure B shows the NDV protein expression and virus titer in Hela cells after YKT6 knockdown and complementation.

[0035] Fig.10 This is a graph showing the results of the assay of NDV virus assembly in YKT6 knockdown Hela cells.

[0036] Fig.11 This is a graph showing the results of measuring the membrane transport of NDV structural proteins in YKT6 knockdown Hela cells.

[0037] Fig.12 This is a graph showing the results of measuring the NDV replication level in Hela cells overexpressing YKT6 protein. DETAILED DESCRIPTION

[0038] Example 1 Regulation of NDV infection on SNARE gene and protein expression in tumor cells 1. Changes in SNARE gene expression in tumor cells following NDV infection (1) Virus inoculation A549 or Hela cells were plated in six-well cell culture plates, with 8×10 cells per well. 5cells and cultured overnight; when the cell confluence reached about 90%, NDV Herts / 33, F48E8 or La Sota strains were inoculated with an MOI of 0.01 and adsorbed at 37°C for 1 h; the virus solution was discarded, the cells were washed three times with PBS, 2 mL of DMEM maintenance solution containing 2% FBS was added, and the cells were collected 6, 12, and 24 h after infection.

[0039] (2) Extraction and reverse transcription of total cell RNA Total RNA was extracted from cells using a tissue cell RNA extraction kit. The specific steps are as follows: ① Add 350 μL of cell lysis buffer RLT Plus to a 6-well cell culture plate, place it horizontally for a while, and then use a pipette to repeatedly blow and vortex until no obvious cell clumps are seen to lyse the cells.

[0040] ② Add an equal volume of 70% ethanol and mix by pipetting; transfer the mixture into a centrifuge tube with an adsorption column RA, centrifuge at 13,000 rpm for 30 s, and discard the waste liquid.

[0041] ③ Add 700 μL of deproteinized solution RW1, let stand at room temperature for 1 min, centrifuge at 12,000 rpm for 30 s, and discard the waste liquid; add 500 μL of rinse solution RW, centrifuge at 12,000 rpm for 30 s, discard the waste liquid, and repeat the previous step.

[0042] ④ Place the adsorption column RA back into the collection tube and centrifuge at 13,000 rpm for 2 min.

[0043] ⑤ Take out the adsorption column RA and put it into a new RNase-free centrifuge tube. Add 30-50 μL RNase-free H2O to the middle part of the adsorption film and let it stand at room temperature for 1 min. Centrifuge at 12000 rpm for 1 min to elute RNA. Use Nanodrop to measure the RNA concentration.

[0044] ⑥ Perform reverse transcription according to the instructions of HiScript II 1st Strand cDNA Synthesis Kit (+gDNA wiper). First, remove genomic DNA: add 1 μg template and 4 μL 4×gDNA wiper Mix to a 1.5 mL centrifuge tube, and add RNase Free H2O to 16 μL; react at 42°C for 2 min and place on ice. Then, perform reverse transcription: add 4 μL 5×qRT SuperMix Ⅱ to the reaction tube in the previous step, mix by pipetting, react at 50°C for 15 min, and react at 85°C for 2 min.

[0045] (3) Fluorescence quantitative PCR ① According to the gene sequence published by NCBI, design fluorescent quantitative PCR primers for SNARE genes and internal reference genes. The Genebank accession numbers of the SNARE genes to be tested are shown in Table 1. The primer sequences are shown in SEQ ID NO.1 to SEQ ID NO.74.

[0046] Table 1 Genebank accession numbers of human SANRE and internal reference genes

[0047] ② The fluorescence quantitative PCR reaction system is as follows:

[0048] ③ The fluorescence quantitative PCR reaction procedure is as follows:

[0049] ④ Use 2 -ΔΔCT Methods The expression values ​​of SNARE genes relative to β-actin were calculated.

[0050] like Figure 1 As shown in Figure 2, A549 cells were infected with NDV Herts / 33 strain. At 12 and 24 h after infection, NDV induced a significant upregulation of all SNARE gene expressions compared with the control group, among which VAMP1, STX1B and STX11 genes were upregulated to a greater extent, with the upregulation times reaching hundreds of times. Figure 2 As shown in Figure 2, Hela cells were infected with NDV F48E8 strain. At 12 and 24 h after infection, the expression of many SNARE genes was significantly upregulated, among which VAMP1, VTI1A, STX5 and GOSR1 were upregulated to a greater extent. Figure 3 As shown, infection with the weak NDV strain La Sota can also induce a significant upregulation of SNARE gene expression in Hela cells. The experimental results show that different NDV strains infecting different tumor cells can all cause a significant upregulation of SNARE gene expression levels.

[0051] 2. Changes in the expression of SNARE proteins in tumor cells following NDV infection (1) Extraction of total cell protein Hela cells were inoculated with NDV F48E8 strain, and 200 μL RIPA lysis buffer was added at 0, 6, 12, and 24 h after infection. The cells were placed on ice for 10 min and the cell lysate was collected and centrifuged at 13,000 rpm for 10 min. The supernatant was collected as the total cell protein.

[0052] (2) Protein concentration determination The total cell protein concentration was determined according to the instructions of the BCA protein concentration assay kit.

[0053] (3) Immunoblotting Add 5×SDS Loading Buffer to the protein sample and heat at 100℃ for 10 min; add the protein sample to the gel well and perform electrophoresis at 120 V for 2 h; activate the PVDF membrane with methanol for 15 s and then immerse it in the transfer solution; make a transfer sandwich and put it into the transfer tank at a constant current of 200 mA for 2 h; after the transfer, block with 5% skim milk (TBST configuration) at room temperature for 2 h; after blocking, discard the blocking solution and wash with TBST 3 times; after washing, add the primary antibody and incubate at 4℃ overnight; wash the membrane with TBST 5 times, 5 min each time; add the secondary antibody and incubate at room temperature for 1 h; wash the membrane with TBST 5 times, 5 min each time; add ECL substrate for color development and take pictures using a chemical imaging system.

[0054] like Figure 4 As shown in the figure, at 4 and 12 h after F48E8 infection of Hela cells, NDV induced a significant upregulation of YKT6 protein expression compared with the control group; at 12 h after La Sota infection, NDV induced a significant upregulation of YKT6 protein expression compared with the control group. These results indicate that NDV infection can significantly upregulate the expression level of SNARE proteins.

[0055] Example 2 Effect of SNARE functional mutants on NDV replication in Hela cells 1. Construction of SNARE functional mutant expression plasmid (1) Construction of expression plasmids containing transmembrane SNARE protein mutants Most SNARE proteins are anchored to the plasma membrane through their transmembrane regions and perform membrane fusion functions. For SNARE proteins containing transmembrane regions, functional mutants lacking the transmembrane region were constructed. In addition, studies have reported that STX17 lacking the transmembrane region did not have membrane fusion dysfunction, while overexpression of STX17 lacking the N-terminal domain effectively blocked membrane fusion. Therefore, a functional mutant of STX17 lacking the N-terminal domain was also constructed.

[0056] 1) Extract total RNA from Hela cells and prepare cDNA as described above.

[0057] 2) Based on the gene sequences published by NCBI, primers for functional mutants of VAMP1 (Accession NO. NM_001297438.2), VAMP7 (Accession NO. NM_001145149.3), STX6 (Accession NO. NM_001286210.1), USE1 (Accession NO. NM_018467.3), STX11 (Accession NO. NM_003764.4), STX17 (Accession NO. NM_017919.3) and VTI1A (Accession NO. NM_001318203.2) were designed and constructed. The primer sequences are shown in SEQ ID NO.75 to SEQ ID NO.88.

[0058] 3) The PCR reaction system was as follows: 25 μL 2× Phanta Flash Master Mix (Dye Plus), 2 μL each of upstream and downstream primers, 2 μL cDNA, and 11 μL H2O.

[0059] 4) The PCR reaction program was as follows: pre-denaturation at 98°C for 30 s; denaturation at 98°C for 15 s, annealing at 60°C for 5 s, and extension at 72°C for 10 s, for a total of 30 cycles; and complete extension at 72°C for 5 min.

[0060] 5) The PCR product was purified by gel recovery and connected to the linearized pEGFP-C3 vector, transformed using DH5α competent cells, and the plasmid was extracted and sequenced after enzyme digestion and verification.

[0061] (2) Construction of expression plasmid for SNARE protein (YKT6) mutant without transmembrane region The YKT6 protein has no transmembrane region and is mainly anchored to the membrane through the prenylation modification of its C-terminal Cys194 and Cys195. Therefore, the cysteine ​​sites 194 and 195 of the YKT6 protein were mutated to serine, and the functional mutant was constructed using pCDNA3.1 as a vector. The construction process is shown in the above method, and the primer sequences used are shown in SEQ ID NO.89 to SEQ ID NO.92. The amino acid sequence of the YKT6 protein containing the C194S mutation is shown in SEQ ID NO.93, and the amino acid sequence of the YKT6 protein containing the C195S mutation is shown in SEQ ID NO.94.

[0062] (3) Identification of expression plasmids for SNARE protein functional mutants ① Hela cells were evenly plated in a 24-well cell culture plate, with 1×10 5Cells were cultured overnight.

[0063] ② When the cell density reaches about 70%, transfection is performed with 0.5 μg of plasmid per well.

[0064] ③ After 64 h, cells were lysed to extract proteins, and the eukaryotic expression plasmid of SNARE protein functional mutant was verified by Western blot.

[0065] like Figure 5 As shown, after Hela cells were transfected with the expression plasmids of VAMP1, VAMP7, STX6, USE1, STX11, STX17, and VTI1A mutants, the target proteins were detected by Western blot, and the molecular weights were consistent with expectations. After Hela cells were transfected with the expression plasmids of YKT6 protein mutants, the expression of the target proteins was detected by Western blot, and the molecular weights were consistent with expectations.

[0066] 2. Effects of SNARE protein functional mutants on viral replication ① Hela cells were evenly plated in a 24-well plate, with 1×10 5 cells.

[0067] ② When the cell density reaches about 70%, transfect 0.5 μg of plasmid.

[0068] ③ After 64 h, the F48E8 strain was inoculated into cells at an MOI of 0.01, and the cell culture supernatant was collected 24 h after infection to extract cell proteins.

[0069] ④ Dilute the collected supernatant 10-fold with M199 medium containing 1% FBS. -1 -10 -7 Hela cells were inoculated with 100 μL of each dilution in 4 wells. After 72 h of culture, TCID 50 .

[0070] ⑤ Use Western blot to detect the expression level of NP protein in cell proteins.

[0071] like Figure 6As shown in the results, overexpression of VAMP1, VTI1A and STX17 functional mutants can lead to a significant decrease in viral titer in the cell supernatant, while overexpression of VAMP7, STX6 and USE1 mutants has no significant effect on viral titer. After transfection of VAMP1, VTI1A and STX6 functional mutant plasmids, the expression of intracellular viral NP protein was significantly decreased. In addition, overexpression of YKT6-C194S and YKT6-C195S functional mutants can lead to a significant decrease in viral titer. Therefore, overexpression of SNARE protein mutants can inhibit the replication of NDV in Hela cells.

[0072] Example 3 Effect of YKT6 protein knockdown on NDV replication in Hela cells 1. Synthesis of siRNA targeting YKT6 protein and verification of its interference efficiency 1) A pair of siRNAs targeting YKT6 were synthesized, and the sequences are shown in SEQ ID NO. 95 and SEQ ID NO. 96.

[0073] 2) Hela cells were evenly plated in a 24-well plate, with 1×10 cells per well. 5 When the cell density reached about 70%, 50 pmol siRNA was transfected with TransIntro EL transfection reagent. After 64 h, the cells were collected. The specific steps of RNA extraction, reverse transcription and fluorescence quantitative PCR were described above. The fluorescence quantitative PCR primer sequences used for determining the interference efficiency of the YKT6 gene are shown in SEQ ID NO. 97 and SEQ ID NO. 98.

[0074] 3) 64 h after transfection, cells were lysed using RIPA lysis buffer, protein samples were collected, and the expression level of YKT6 protein in cell proteins was detected by Western blot.

[0075] like Figure 7 As shown, siRNA transfection caused the transcription level of the YKT6 gene in Hela cells to decrease by about 70%, and the YKT6 protein was almost completely knocked out. The results showed that siRNA targeting the YKT6 protein can effectively knock down the cell YKT6 protein.

[0076] 2. Effect of YKT6 knockdown on NDV replication ① Hela cells were evenly plated in a 24-well plate, with 1×10 5 When the cell confluence reached about 70%, 50 pmol siRNA was transfected.

[0077] ② 64 h after transfection, the NDV F48E8 strain was inoculated into the cells at an MOI of 0.01. After adsorption for 1 h, the cells were washed three times with PBS and 500 μL of DMEM medium containing 10% FBS was added.

[0078] ③ At 24, 30, 36, and 42 h after infection, the cell culture supernatant was collected and the cell protein was extracted. The TCID 50 The effect of knocking down YKT6 expression on NDV virus replication was determined by measuring the expression level of YKT6 and F protein.

[0079] like Figure 8 As shown in the figure, knocking down the YKT6 protein in Hela cells can lead to a significant decrease in the virus titer in the cell supernatant. At the same time, at 24 h and 30 h after infection, knocking down the YKT6 expression in Hela cells can cause a significant decrease in the expression of intracellular viral F protein compared with the control group. The results show that YKT6 knockdown significantly inhibits the replication of NDV in Hela cells.

[0080] 3. Effects of YKT6 knockdown and complementation on NDV replication (1) Construction of YKT6 complementing plasmid Construct a YKT6 protein eukaryotic expression plasmid and introduce a nonsense mutation at the siRNA target site in the YKT6 gene to make it resistant to siYKT6. The specific steps are as follows: 1) Based on the YKT6 gene sequence, two pairs of primers were designed. The sequences are shown in SEQ ID NO.99 to SEQ ID NO.102.

[0081] 2) Using Hela cell cDNA as a template, overlap PCR was used to amplify the target fragment. Two fragments of YKT6 were amplified using primers 1 and 2 and primers 3 and 4, respectively. PCR reaction system: 2×Phanta Flash Master Mix (DyePlus) 25 μL, 2 μL of upstream and downstream primers, 2 μL of cDNA, and 11 μL of ddH2O. PCR reaction program: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 15 s, 60℃ annealing for 5 s, 72℃ extension for 10 s, for a total of 30 cycles; 72℃ thorough extension for 1 min.

[0082] 3) Recover the two target fragments as templates for the second round of PCR. Using the products recovered from the first round of PCR gel as templates, YKT6-F1 / R2 performed the second round of PCR. PCR reaction system: 2×Phanta Flash Master Mix (Dye Plus) 25 μL, 2 μL of upstream and downstream primers, 2 μL of cDNA, and 11 μL of ddH2O. Reaction procedure: 98℃ pre-denaturation for 30 s; 98℃ denaturation for 15 s, 60℃ overlap for 30 s, 72℃ extension for 10 s, for a total of 30 cycles; 72℃ thorough extension for 1 min.

[0083] 4) After gel recovery and purification, the PCR product was ligated to the pCDNA3.1 linearized vector and transformed into DH5α competent cells. The plasmid was extracted and sequenced after enzyme digestion and verification.

[0084] (2) Effect of YKT6 knockdown on NDV replication during complementation ① Hela cells were evenly plated in a 24-well plate, with 1×10 5 Each well was transfected with 50 pmol siRNA.

[0085] ② 36 h after transfection, 0.5 μg of complement plasmid was transfected again. 36 h later, F48E8 was inoculated into cells at an MOI of 0.01.

[0086] ③ 24 h after infection, the cell culture supernatant was collected and the cell protein was extracted, and the TCID in the cell culture supernatant was determined. 50 and F protein expression levels.

[0087] like Fig. 9 As shown in the figure, compared with the control group, the virus titer and viral protein expression in the cell culture supernatant decreased significantly after YKT6 knockdown; and the virus titer and NP protein increased significantly after YKT6 protein was supplemented on the basis of YKT6 knockdown, and there was no significant difference compared with the virus infection group. The results show that YKT6 knockdown can significantly reduce the replication performance of NDV in cells, and supplementing YKT6 protein can reverse this effect, indicating that the effect of YKT6 on NDV is specific.

[0088] Example 4 Effect of YKT6 protein knockdown on NDV assembly 1. Effect of YKT6 protein knockdown on NDV virus-like particle assembly ① Hela cells were evenly plated in a 6-well plate, with 8×10 cells per well. 5 Cells were cultured overnight.

[0089] ② When the cell confluence reached about 70%, siRNA was transfected. 48 hours later, the eukaryotic expression plasmids of the main structural proteins NP, F, HN and M of NDV were co-transfected, with 0.5 μg of each plasmid transfected.

[0090] ③ 60 h after plasmid transfection, collect the supernatant and extract cell protein.

[0091] ④ Centrifuge the cell culture supernatant at 15,000 g at 4°C for 5 min to remove cell debris and place on ice for later use; add 2.5 ml of 30% sucrose to the bottom of the ultracentrifuge tube, overlay the cell culture supernatant on the top, balance, and centrifuge at 10,0000 g at 4°C for 2 h; after centrifugation, discard the supernatant and add PBS to resuspend the precipitate; after strict balancing, centrifuge at 10,0000 g at 4°C for 2 h, discard the supernatant, and add 40 μL PBS to resuspend the virus-like particles at the bottom of the centrifuge tube.

[0092] ⑤ Add 5× SDS Loading Buffer and heat at 100℃ for 10 min. Use Western blot to detect the expression level of NDV structural proteins in cell supernatant and protein lysate.

[0093] like Fig.10 As shown in the figure, compared with the control group, after YKT6 knockdown, the expression of M, F, and HN proteins in the cells decreased, while the expression of NP protein increased. The expression of F, HN, and NP proteins in VLPs decreased significantly, while the expression of M protein did not change significantly. The results show that YKT6 protein is necessary for the assembly of NDV virus particles.

[0094] 2. Effect of YKT6 protein knockdown on membrane transport of NDV structural proteins 1) Hela cells were plated in 6-well plates, 8×10 cells per well. 5 When the cell confluence reached about 70%, siRNA was transfected.

[0095] 2) 48 h after transfection, co-transfect the NDV NP, F, HN and M protein eukaryotic expression plasmids.

[0096] 3) 60 h after plasmid transfection, collect cells and wash twice with pre-cooled PBS, add 250 μL membrane protein extraction reagent A, gently resuspend cells, place on ice for 15 min, then freeze and thaw repeatedly 3 times; centrifuge at 4°C, 700 g for 10 min, collect supernatant; centrifuge at 4°C, 14,000 g for 30 min, the collected supernatant is cytoplasmic protein; the remaining precipitate is centrifuged at 4°C, 14,000 g for 10 s, aspirate supernatant, add 50 μL membrane protein extraction reagent B, vortex for 5 s to resuspend the precipitate, place on ice for 10 min, repeat the above steps twice; centrifuge at 4°C, 14,000 g for 5 min, collect supernatant as cell membrane protein.

[0097] 4) Western blot was used to detect the expression levels of NDV structural proteins in the cell membrane and cytoplasm.

[0098] like Fig.11 As shown in the figure, after YKT6 knockdown, the content of M and F proteins in the cell membrane decreased, while there was no significant change in NP protein, and the expression of NP, M, and F proteins in the cytoplasm decreased. Therefore, YKT6 knockdown leads to a decrease in the expression of NDV envelope glycoprotein in the cytoplasm, which in turn causes a decrease in envelope protein transported to the cell membrane and defects in virus assembly.

[0099] Example 5 Effect of YKT6 protein overexpression on NDV replication 1) Amplify the YKT6 gene with a pair of primers (sequences are shown in SEQ ID NO.99 and SEQ ID NO.102), connect it to the pCDNA3.1 vector, and use it for transfection after sequencing is correct.

[0100] 2) Hela cells were evenly plated in a 24-well plate, with 1×105 cells per well, and transfected with 0.5 μg of YKT6 expression plasmid.

[0101] 3) After 36 h, cells were inoculated with F48E8 at an MOI of 0.01.

[0102] 4) The cell culture supernatant was collected at 24 h and 32 h after infection, and the TCID50 in the cell culture supernatant was measured to determine the effect of YKT6 overexpression on NDV replication.

[0103] The results showed that when YKT6 protein was overexpressed in Hela cells and then infected with NDV, the virus titer increased significantly 32 hours after infection, indicating that YKT6 protein can significantly promote the replication of NDV ( Fig.12 ).

[0104] SEQ ID NO.1 (Fluorescence quantitative PCR upstream primer for YKT6 gene expression determination) 5′-CAGCGTCCTCTACAAAGGCG-3′; SEQ ID NO.2 (Fluorescence quantitative PCR downstream primer for YKT6 gene expression determination) ACAATCAGTTGACTCGTGAAGG; SEQ ID NO.3 (Fluorescence quantitative PCR upstream primer for VAMP8 gene expression determination) TGTGCGGAACCTGCAAAGT; SEQ ID NO.4 (Fluorescence quantitative PCR downstream primer for VAMP8 gene expression determination) CTTCTGCGATGTCTTGAA; SEQ ID NO.5 (Fluorescence quantitative PCR upstream primer for VAMP7 gene expression determination) GAGGTTCCAGACTACTTACGGT; SEQ ID NO.6 (Fluorescence quantitative PCR downstream primer for VAMP7 gene expression determination) GACACTTGAGAACTCGCTATTCA; SEQ ID NO.7 (Fluorescence quantitative PCR upstream primer for VAMP5 gene expression determination) ATGGCAGGAATAGAGTTGGAGC; SEQ ID NO.8 (Fluorescence quantitative PCR downstream primer for VAMP5 gene expression determination) TGCCGAAGTTGTTACGCATAAT; SEQ ID NO.9 (Fluorescence quantitative PCR upstream primer for VAMP4 gene expression determination) GGTGGCGTGGATGCAAAATAA; SEQ ID NO.10 (Fluorescence quantitative PCR downstream primer for VAMP4 gene expression determination) GCAAAAGGATAGCAGCAACCAA; SEQ ID NO.11 (Fluorescence quantitative PCR upstream primer for VAMP3 gene expression determination) GTGGTGGACATAATGCGAGTT; SEQ ID NO.12 (Fluorescence quantitative PCR downstream primer for VAMP3 gene expression determination) CGTCTGCACGGTCGTCTAAC; SEQ ID NO.13 (Fluorescence quantitative PCR upstream primer for VAMP2 gene expression determination) CTCAAGGCGCAAATACTGGTGG; SEQ ID NO.14 (Fluorescence quantitative PCR downstream primer for VAMP2 gene expression determination) TGATGGCGCAAATCACTCCC; SEQ ID NO.15 (Fluorescence quantitative PCR upstream primer for VAMP1 gene expression determination) ACATGACCAGTAACAGACGACT; SEQ ID NO.16 (Fluorescence quantitative PCR downstream primer for VAMP1 gene expression determination) ACGTTCACACGTATGATGTCC; SEQ ID NO.17 (Fluorescence quantitative PCR upstream primer for SEC22B gene expression determination) CCGGGACCTTCAACAATATCAG; SEQ ID NO.18 (Fluorescence quantitative PCR downstream primer for SEC22B gene expression determination) GCAAAAGCCAACTTCTTAGGGA; SEQ ID NO.19 (Fluorescence quantitative PCR upstream primer for STX1A gene expression determination) CGAGACCGCTTCATGGATGAG; SEQ ID NO.20 (Fluorescence quantitative PCR downstream primer for STX1A gene expression determination) ACTTGGAACGAACTTTGTTTGC; SEQ ID NO.21 (Fluorescence quantitative PCR upstream primer for STX1B gene expression determination) ACGTGGATCGGGACCACTT; SEQ ID NO.22 (Fluorescence quantitative PCR downstream primer for STX1B gene expression determination) ACATCCTCCGACAGTTTCTCAA; SEQ ID NO.23 (Fluorescence quantitative PCR upstream primer for STX2 gene expression determination) TGAGAGTGGGAACCGGACTT; SEQ ID NO.24 (Fluorescence quantitative PCR downstream primer for STX2 gene expression determination) TTCTAGCTCGTCGTCTGTGGT; SEQ ID NO.25 (Fluorescence quantitative PCR upstream primer for STX3 gene expression determination) CGGCTTTTATGGACGAGTTCT; SEQ ID NO.26 (Fluorescence quantitative PCR downstream primer for STX3 gene expression determination) CTGCCGATGACCTGACCTC; SEQ ID NO.27 (Fluorescence quantitative PCR upstream primer for STX4 gene expression determination) CGGACAATTCGGCAGACTATT; SEQ ID NO.28 (Fluorescence quantitative PCR downstream primer for STX4 gene expression determination) TTCTGGGGCTCTATGGCCTT; SEQ ID NO.29 (Fluorescence quantitative PCR upstream primer for STX5 gene expression determination) AAACGCTACGGGTCTAAGAACA; SEQ ID NO.30 (Fluorescence quantitative PCR downstream primer for STX5 gene expression determination) GCACGCAAAGCTGGCTTATT; SEQ ID NO.31 (Fluorescence quantitative PCR upstream primer for STX7 gene expression determination) GGCCCAGAGGATCTCTTCTAA; SEQ ID NO.32 (Fluorescence quantitative PCR downstream primer for STX7 gene expression determination) ACTGTTGCCTCAATTCAGGTG; SEQ ID NO.33 (Fluorescence quantitative PCR upstream primer for STX11 gene expression determination) ACTTGTCCAAGCAATATGACCAG; SEQ ID NO.34 (Fluorescence quantitative PCR downstream primer for STX11 gene expression determination) CGTCTCGAACACGATGTCCTC; SEQ ID NO.35 (Fluorescence quantitative PCR upstream primer for STX12 gene expression determination) CATCCAGCGGATCAGCCAAG; SEQ ID NO.36 (Fluorescence quantitative PCR downstream primer for STX12 gene expression determination) GGAGTGTTGTAACTGTTGCAGAT; SEQ ID NO.37 (Fluorescence quantitative PCR upstream primer for STX16 gene expression determination) TCAGGCATCAGCTTAGATCCA; SEQ ID NO.38 (Fluorescence quantitative PCR downstream primer for STX16 gene expression determination) GCTTAATCCGGCCAACATCATA; SEQ ID NO.39 (Fluorescence quantitative PCR upstream primer for STX17 gene expression determination) GTGAAATTACGCCGTCTTGAAC; SEQ ID NO.40 (Fluorescence quantitative PCR downstream primer for STX17 gene expression determination) GATATTGGATCGGAGTTGCTGAA; SEQ ID NO.41 (fluorescence quantitative PCR upstream primer for STX18 gene expression determination) ATCACGCTGCTATTCCGGG; SEQ ID NO.42 (Fluorescence quantitative PCR downstream primer for STX18 gene expression determination) TCCTCCCATATTCAGACATGGT; SEQ ID NO.43 (Fluorescence quantitative PCR upstream primer for STX19 gene expression determination) GCTGCAATGTTCCGCCATTTTT; SEQ ID NO.44 (Fluorescence quantitative PCR downstream primer for STX19 gene expression determination) TTTGAGCTACAGCATGGACAG; SEQ ID NO.45 (fluorescence quantitative PCR upstream primer for TSNARE1 gene expression determination) CCCCTAGAGTGCGCTAGATGT; SEQ ID NO.46 (Fluorescence quantitative PCR downstream primer for TSNARE1 gene expression determination) GCCCTTGGGACAATAGGCG; SEQ ID NO.47 (Fluorescence quantitative PCR upstream primer for GOSR1 gene expression determination) GCAAGGCTTACAGGGGTAAAT; SEQ ID NO.48 (Fluorescence quantitative PCR downstream primer for GOSR1 gene expression determination) CAGGGCTGCATTCAAGGAGG; SEQ ID NO.49 (Fluorescence quantitative PCR upstream primer for GOSR2 gene expression determination) GTTCCAGCAAACGCACAAGC; SEQ ID NO.50 (Fluorescence quantitative PCR downstream primer for GOSR2 gene expression determination) TAACTGGTCAACCCGAAGTCT; SEQ ID NO.51 (Fluorescence quantitative PCR upstream primer for VTI1A gene expression determination) CCAGCAAGATTGCGAGGGT; SEQ ID NO.52 (Fluorescence quantitative PCR downstream primer for VTI1A gene expression determination) GCAGTTCTTTCGCTTCTTCAAG; SEQ ID NO.53 (Fluorescence quantitative PCR upstream primer for VTI1B gene expression determination) CGGGGACCGAAGAAAAGAAGA; SEQ ID NO.54 (Fluorescence quantitative PCR downstream primer for VTI1B gene expression determination) GGGGTGCATAACGTAGCTCC; SEQ ID NO.55 (Fluorescence quantitative PCR upstream primer for BET1 gene expression determination) AGTACCTCCTGGCAACTATGG; SEQ ID NO.56 (Fluorescence quantitative PCR downstream primer for BET1 gene expression determination) TCTTCACAGGCACTATACCCAC; SEQ ID NO.57 (Fluorescence quantitative PCR upstream primer for BET1L gene expression determination) CTCGGATTTCACAAGCATGACC; SEQ ID NO.58 (Fluorescence quantitative PCR downstream primer for BET1L gene expression determination) GAAGGCCACAATTAGACCCAC; SEQ ID NO.59 (Fluorescence quantitative PCR upstream primer for STX6 gene expression determination) CACCAACGAGCTGAGAAATAACC; SEQ ID NO.60 (Fluorescence quantitative PCR downstream primer for STX6 gene expression determination) CCCTGACAACTTGCCGAGT; SEQ ID NO.61 (Fluorescence quantitative PCR upstream primer for STX10 gene expression determination) GAGACCATCGGTATAGTGGAAGC; SEQ ID NO.62 (Fluorescence quantitative PCR downstream primer for STX10 gene expression determination) CAAAAATGCTACGGCTGTTGG; SEQ ID NO.63 (Fluorescence quantitative PCR upstream primer for USE1 gene expression determination) GAGATGCGGAGTGAGCTACTA; SEQ ID NO.64 (Fluorescence quantitative PCR downstream primer for USE1 gene expression determination) CCAGGGTATTGGTCTTGAGGC; SEQ ID NO.65 (Fluorescence quantitative PCR upstream primer for SNAP23 gene expression determination) ATGAGTCTCTGGAAAGTACGAGG; SEQ ID NO.66 (Fluorescence quantitative PCR downstream primer for SNAP23 gene expression determination) CCACAGCATTTGTTGAGTTCTG; SEQ ID NO.67 (Fluorescence quantitative PCR upstream primer for SNAP25 gene expression determination) ACCAGTTGGCTGATGAGTCG; SEQ ID NO.68 (Fluorescence quantitative PCR downstream primer for SNAP25 gene expression determination) CAAAGTCCTGATACCAGCATCTT; SEQ ID NO.69 (Fluorescence quantitative PCR upstream primer for SNAP29 gene expression determination) AAAAGCTACAATCCGTTCGACG; SEQ ID NO.70 (Fluorescence quantitative PCR downstream primer for SNAP29 gene expression determination) TCTCGGACTCGTACATGAGGG; SEQ ID NO.71 (Fluorescence quantitative PCR upstream primer for SNAP47 gene expression determination) GAGGCGATGGGTTACTGGAC; SEQ ID NO.72 (Fluorescence quantitative PCR downstream primer for SNAP47 gene expression determination) GCTGAAGACCACATTTCGACTT; SEQ ID NO.73 (Fluorescence quantitative PCR upstream primer for β-actin gene expression determination) CTCCATCCTGGCCTCGCTGT; SEQ ID NO.74 (Fluorescence quantitative PCR downstream primer for β-actin gene expression determination) GCTGTCACCTTCACCGTTCC; SEQ ID NO.75 (upstream primer for constructing VAMP1 transmembrane region deletion mutant) ATCTCGAGCTCAAGCTTCGAATTCTGATGTCTGCTCCAGCTCAGCC; SEQ ID NO.76 (downstream primer for constructing VAMP1 transmembrane region deletion mutant) TCAGTTATCTAGATCCGGTGGATCCTCACTTGCAGTTTTTCCACCAATACTTCC; SEQ ID NO.77 (upstream primer for constructing VAMP7 transmembrane region deletion mutant) GTGAACCGTCAGATCCGCTAGCGCTAATGAAGCTGTACAGCCTCAG; SEQ ID NO.78 (downstream primer for constructing VAMP7 transmembrane region deletion mutant) ATCAGTTATCTAGATCCGGTGGATCCTCACATGATGGCACAGTATGAG; SEQ ID NO.79 (upstream primer for constructing STX6 transmembrane region deletion mutant) ATCTCGAGCTCAAGCTTCGAATTCTGATGTCCATGGAGGACCCCT; SEQ ID NO.80 (downstream primer for constructing STX6 transmembrane region deletion mutant) TCAGTTATCTAGATCCGGTGGATCCTCATTGGCGCCGATCACTGGTCA; SEQ ID NO.81 (upstream primer for constructing USE1 transmembrane region deletion mutant) ATCTCGAGCTCAAGCTTCGAATTCTGATGGCGGCGTCGAGGCTGGA; SEQ ID NO.82 (downstream primer for constructing USE1 transmembrane region deletion mutant) TCAGTTATCTAGATCCGGTGGATCCTCAGTTGACTGACTTCTGCGTGTGCTG; SEQ ID NO.83 (upstream primer for constructing STX11 transmembrane region deletion mutant) ATCTCGAGCTCAAGCTTCGAATTCTGATGAAAGACCGGCTAGCAGAA; SEQ ID NO.84 (downstream primer for constructing STX11 transmembrane region deletion mutant) TCAGTTATCTAGATCCGGTGGATCCTCACACGGCCTTCCGCACCT; SEQ ID NO.85 (upstream primer for constructing STX17 transmembrane region deletion mutant) ATCTCGAGCTCAAGCTTCGAATTCTGATGTCTGAAGATGAAGAAAAAGTGAAATTACG; SEQ ID NO.86 (downstream primer for constructing STX17 transmembrane region deletion mutant) TCAGTTATCTAGATCCGGTGGATCCTCATTTGAAGCCTGCAAGGAGGC; SEQ ID NO.87 (upstream primer for constructing VTI1A transmembrane region deletion mutant) ATCTCGAGCTCAAGCTTCGAATTCTGATGTCGTCCGACTTCGAAGG; SEQ ID NO.88 (downstream primer for constructing VTI1A transmembrane region deletion mutant) TCAGTTATCTAGATCCGGTGGATCCTCAGCGGTTCTGGATGATTCTTCGC; SEQ ID NO.89 (upstream primer for constructing YKT6-C194S mutant) TACCGGTCGCCACCATGAAGCTGTACAGCCTCAGC; SEQ ID NO.90 (downstream primer for constructing YKT6-C194S mutant) TATCTAGATCACATGATGGCACACGATGAGT; SEQ ID NO.91 (upstream primer for constructing YKT6-C195S mutant) TACCGGTCGCCACCATGAAGCTGTACAGCCTCAGC; SEQ ID NO.92 (downstream primer for constructing YKT6-C195S mutant) TATCTAGATCACATGATGGCTGAGCATGAGT; SEQ ID NO.93 (amino acid sequence of YKT6-C194S mutant; underline indicates mutation site) MKLYSLSVLYKGEAKVVLLKAAYDVSSFSFFQRSSVQEFMTFTSQLIVERSSKGTRASVKEQDYLCHVYVRNDSLAGVVIADNEYPSRVAFTLLEKVLDEFSKQVDRIDWPVGSPATIHYPALDGHLSRYQNPREADPMTKVQAELDETKIILHNTMESLLERGEKLDDLVSKSEVLGTQSKAFYKTARKQNS S CAIM; SEQ ID NO.94 (YKT6-C195S mutant sequence; underline indicates mutation site) MKLYSLSVLYKGEAKVVLLKAAYDVSSFSFFQRSSVQEFMTFTSQLIVERSSKGTRASVKEQDYLCHVYVRNDSLAGVVIADNEYPSRVAFTLLEKVLDEFSKQVDRIDWPVGSPATIHYPALDGHLSRYQNPREADPMTKVQAELDETKIILHNTMESLLERGEKLDDLVSKSEVLGTQSKAFYKTARKQNSC S AIM; SEQ ID NO.95 (sense sequence of siRNA targeting YKT6) GGUGUGGUCAUUGCUGACAAUGAAU; SEQ ID NO.96 (siRNA antisense sequence targeting YKT6) AUUCAUUGUCAGCAAUGACCACACC; SEQ ID NO. 97 (Fluorescence quantitative PCR upstream primer for verifying the efficiency of YKT6 siRNA) GGCTGGGTAATGGATTGTAGC; SEQ ID NO. 98 (Fluorescence quantitative PCR downstream primer for verifying the efficiency of YKT6 siRNA) CGCTCATCGAAAGGCACTAGA; SEQ ID NO. 99 (Primer No. 1 for constructing YKT6 complementing plasmid) GCTGGCTAGCGTTTAAACTTAAGCTTATGAAGCTGTACAGCCTCAGCG; SEQ ID NO. 100 (Primer No. 2 for constructing YKT6 complementing plasmid) ATCTGCGATTACTACGCCTGCAAGACTATCATTCCGGACG; SEQ ID NO. 101 (Primer No. 3 for constructing YKT6 complementing plasmid) GGCGTAGTAATCGCAGATAACGAGTACCCATCCCGGGTGGCC; SEQ ID NO. 102 (Primer No. 4 for constructing YKT6 complementing plasmid) GCTGATCAGCGGGTTTAAACGGGCCCTCACATGATGGCTGAGCATGAGT.

Claims

1. Application of SNARE protein in regulating the replication level of oncolytic Newcastle disease virus, characterized in that: The sequence of the SNARE protein is one of the sequences shown in Genebank Accession NO. NM_001297438.2, NM_001145149.3, NM_001286210.1, NM_018467.3, NM_003764.4, NM_017919.3, and NM_001318203.2, and the SNARE protein does not contain a transmembrane region.

2. The use according to claim 1, characterized in that: The SNARE protein is YKT6 protein, and the sequence of the YKT6 protein is shown in Genebank Accession NO. NM_006555.

4.

3. The use according to claim 1, characterized in that: The application includes reducing the expression of oncolytic Newcastle disease virus envelope glycoprotein in the cytoplasm, and reducing the expression of virus NP, M, and F proteins in the cytoplasm.

4. The use according to claim 2, characterized in that: Knocking down the YKT6 protein reduced the expression level of the YKT6 protein.

5. The use according to claim 4, characterized in that The siRNA sequences targeting YKT6 are shown in SEQ ID NO. 95 and SEQ ID NO.

96.

6. The use according to claim 4, characterized in that: The fluorescent quantitative PCR used for determining the expression of the YKT6 gene is shown in primers SEQ ID NO. 1 and SEQ ID NO.

2.

7. The use according to claim 4, characterized in that: The sequences of fluorescent quantitative PCR primers used for determining the YKT6 gene interference efficiency are shown in SEQ ID NO. 97 and SEQ ID NO.

98.

8. The use according to claim 2, characterized in that: The cysteine ​​site at position 194 or 195 of the YKT6 protein was mutated to serine, and the functional mutant was constructed using pCDNA3.1 as a vector.

9. The use according to claim 8, characterized in that The cysteine ​​site at position 194 of the YKT6 protein was mutated into serine to construct a YKT6-C194S mutant, and the primers for constructing the YKT6-C194S mutant are shown in SEQ ID NO.89 and SEQ ID NO.90; the cysteine ​​site at position 195 of the YKT6 protein was mutated into serine to construct a YKT6-C195S mutant, and the primers for constructing the YKT6-C195S mutant are shown in SEQ ID NO.91 and SEQ ID NO.

92.

10. A method for reducing the level of oncolytic Newcastle disease virus replication, characterized in that: Knocking down the YKT6 protein reduces the expression level of the YKT6 protein. The sequence of the YKT6 protein is shown in Genebank Accession NO. NM_006555.4.

Images