Modified xanthan gum lyase with improved thermal stability and application thereof

Abstract

The invention relates to xanthan gum lyase with improved thermal stability after modification. The xanthan gum lyase is xanthan lyase [Bacillus sp.GL1]. The invention also relates to a preparation method of the xanthan gum lyase. After the xanthan gum lyase gene is subjected to site-directed mutagenesis, the thermal stability of the xanthan gum lyase gene is improved.

Description

Technical Field

[0001] The invention relates to xanthan gum lyase with improved thermal stability after enzyme engineering transformation, and belongs to the field of biotechnology. Background Art

[0002] Xanthan gum, also known as yellow gum or xanthan gum, is a water-soluble polysaccharide secreted by a pure culture of wild Xanthomonas campestris after degrading the substrate. Xanthan gum can be dissolved in cold or hot water, has high viscosity, acid and alkali resistance, salt resistance and thermal stability, and is widely used in food, cosmetics, daily chemical industry and other industries. Xanthan gum oligosaccharides after xanthan gum degradation have recently been found to have good free radical scavenging activity and good antibacterial activity, and are used in food, agriculture and other fields.

[0003] At present, the degradation of xanthan gum is divided into physical method, chemical method and biological method. Among them, the physical method requires more instruments and equipment. Although the chemical method of xanthan gum degradation is simple to operate, it is easy to generate monosaccharides and it is difficult to obtain products with high added value. Biological method of xanthan gum degradation is an environmentally friendly green degradation method.

[0004] Xanthan gum has a dense structure and is a polysaccharide connected by pentasaccharide units. The side chain is composed of trisaccharide units composed of mannose, glucose, and mannose, and the terminal mannose is usually modified with different chemical groups. The xanthan gum molecules form a double helix secondary stereoscopic structure by hydrogen bonding, which has good stability. Due to the dense structure of xanthan gum, the accessibility of enzymes is reduced and enzyme reactions are not easy to occur. The molecular structure of xanthan gum becomes loose at high temperatures, and enzyme molecules are more likely to react with xanthan gum. Xanthan gum lyase is the first enzyme to act on xanthan gum modification. By cleaving the side chains of xanthan gum, the structure of xanthan gum becomes loose, which has a favorable effect on the subsequent degradation of xanthan gum. However, the wild-type xanthan gum lyase has poor thermal stability and cannot react with xanthan gum under high temperature conditions. A xanthan gum lyase with better thermal stability is needed to meet the needs of industry and the petroleum industry. Summary of the invention

[0005] In order to improve the efficiency of xanthan gum enzymatic reaction at higher temperatures, the present invention utilizes an enzyme engineering method to transform xanthan gum lyase to improve its thermal stability. At higher temperatures, the structure of xanthan gum becomes loose, making it easier for enzyme reaction to occur. At the same time, high temperature conditions are also beneficial to industrial production applications and the purification and transportation of petroleum.

[0006] Specifically, it is a xanthan gum lyase with improved thermal stability after modification, wherein the xanthan gum lyase is xanthan lyase [Bacillus sp. GL1], having an amino acid sequence shown in SEQ ID NO.3-12.

[0007] Application of xanthan gum lyase for lysing xanthan gum at a higher temperature;

[0008] Xanthan gum lyase working conditions are:

[0009] The usable temperature is 30-55°C, preferably 45-55°C, more preferably 50°C:

[0010] The xanthan gum lyase has an enzyme concentration of 0.01-1 mg / ml in the buffer, preferably 0.01-0.5 mg / ml, more preferably 0.01-0.1 mg / ml;

[0011] The concentration of xanthan gum dissolved in the buffer is 1-5 mg / ml, preferably 2-4 mg / ml, and more preferably 2-3.5 mg / ml. The buffer is sodium acetate buffer solution (pH=5.2 50mM CH3COONa, pH adjusted with CH3COOH), BindingBuffer (formula: 500mM NaCl, 50mM NaH2PO4·2H2O in water, pH adjusted to 8), Wash Buffer (formula: 500mM NaCl, 50mM NaH2PO4·2H2O, 30mM imidazole in water), Elution Buffer (formula: 500mM NaCl, 50mM NaH2PO4·2H2O, 250mM imidazole in water); the modified xanthan gum lyase can react with xanthan gum at a higher temperature.

[0012] After molecular dynamics simulation, potential mutation sites were found, and after screening mutants, the mutation sites were introduced into the wild-type xanthan gum lyase gene, and then constructed into the E. coli expression vector, and its optimal temperature and thermal stability were determined by fermentation. Among them, S75P, N194L, E354L, E291L, D304M, N424F, E713T, T262V, T89D, V351W and wild-type xanthan gum lyase xly had significantly improved enzyme activity at 50°C. After incubation at 50°C for 30 minutes, the xanthan gum lyase mutants still maintained high enzyme activity compared with wild-type xanthan gum lyase xly. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 It is the SDS-PAGE electrophoresis diagram of the xanthan gum lyase xly of the present invention, wherein lane 1 is empty, lane 2 is crude enzyme solution, lane 3 is purified xly, and m is Marker protein.

[0014] Figure 2 This is the pET28a-xanthan lyase xly plasmid map.

[0015] Figure 3It is a bar graph of the enzyme activities of wild-type xanthan gum lyase xly and its mutants at 50°C, where WT represents the enzyme activity of wild-type xanthan gum lyase xly.

[0016] Figure 4 It is a bar graph of the thermal stability of wild-type xanthan gum lyase xly and its mutants at 50°C, where WT represents the enzyme activity of wild-type xanthan gum lyase xly.

[0017] Figure 5 This is the RMSF curve derived from the dynamics simulation.

[0018] Figure 6 is the B factor value calculated based on RMSF.

[0019] Figure 7 This is the spatial structure diagram of the wild-type xanthan gum lyase. The mutant has the same structure as the wild-type xanthan gum lyase xly. The gray ball represents the Ca bound by the wild-type xanthan gum lyase. 2+ , the rod-shaped compound is polyethylene glycol (PEG). DETAILED DESCRIPTION

[0020] The following non-limiting embodiments may enable a person skilled in the art to more fully understand the present invention, but are not intended to limit the present invention in any way.

[0021] Example

[0022] A method for improving the thermal stability of xanthan gum lyase by computer program assistance and enzyme engineering technology transformation comprises the following steps:

[0023] (1) The crystal structure and sequence used for mutation site prediction were obtained from the literature (Hashimoto, W. (2003). Crystal Structure of Bacillus sp. GL1 Xanthan Lyase, Which Acts on the SideChains of Xanthan [J]. Journal of Biological Chemistry, 278 (9), 7663–7673.). Its nucleic acid sequence and protein sequence were downloaded from the NCBI database, and its crystal structure was downloaded from the RSCB database (PDB: 2E24). The molecular dynamics simulation program GROMACS (http: / / www.mdtutorials.com / gmx / lysozyme / 02_topology.html) was used to perform molecular dynamics simulations of xanthan lyase at 343K, 353K, and 363K. The water molecule type was set to SPC / E, the temperature and pressure equilibrium time was set to 1 ns, and the added ion was set to Na+ and Cl - For the overall charge balance of xanthan gum lyase, the energy minimization process is set to be completed within 50,000 steps, and the final molecular dynamics simulation time is set to 50 ns. After the above program settings are completed, the molecular dynamics simulation is started. According to the simulation results, the root mean square fluctuation (RMSF) of the entire protein structure is calculated using the expansion package in GROMACS, and the B factor value is calculated based on the RMSF value, such as Figure 5 As shown in the figure, after completing the molecular dynamics simulation, the RMSF curve is derived. Figure 6 is the B factor value calculated based on the RMSF value. The root mean square fluctuation reflects the fluctuation of a single amino acid during the molecular dynamics simulation. The higher the RMSF value, the more unstable the amino acid is during the molecular dynamics simulation. The B factor value is also called the temperature factor, which can reflect the activity and flexibility of certain parts of the protein. The higher the B factor value, the more unstable the amino acid is. The potential mutation sites were preliminarily identified by the RMSF value and the B factor value: S75P (representing the change of S at position 75 to P, the same meaning below), N194L, E354L, E291L, D304M, N424F, E713T, T262V, T89D, V351W, N553V, Q596I, S468I, E571L, N553V, A399L.

[0024] (2) The I-Mutant 2.0 online program (URL: https: / / folding.biofold.org / i-mutant / i-mutant2.0.html) was used to calculate the energy change before and after the mutation of the potential mutation site. The parameters set during the operation of the webpage were: pH = 5.2, temperature set to 50°C, and the PDB number of the wild-type xanthan gum lyase xly was set to 2E24. After setting the above parameters, the verification was started. A positive value means that the mutation site has a positive effect on the thermal stability of the enzyme and can be used for the next step of verification; a negative value means that the mutation site has a negative effect on the thermal stability of the enzyme and is not considered for the next step of verification. Use the program FoldX (URL: https: / / foldxsuite.crg.eu / documentation#manual) to rescreen mutants. After running the RepairPDB command according to the suggestions on the official website, the next command is PositionScan. Edit the mutation sites obtained above into the config.txt document. After the code is run, FoldX can calculate the change in protein folding free energy before and after the mutation. Negative values ​​represent that the site mutation has a positive effect on the stability of the enzyme, which can be experimentally verified; positive values ​​represent that the site mutation has a negative effect on the stability of the enzyme, which is not considered for experimental verification. The required operation code is available on the FoldX official website. The energy change values ​​obtained after these two steps of verification are shown in Table 1. After verification, the mutation sites obtained are: S75P, N194L, E354L, E291L, D304M, N424F, E713T, T262V, T89D, V351W.

[0025] Table 1 Energy changes of each mutant after verification by I-Mutant and FoldX

[0026]

[0027] (3) After obtaining the gene sequence of xanthan gum lyase from the NCBI database, the xanthan gum lyase xly gene was synthesized by Jilin Kumei Biotechnology Co., Ltd. into the middle of the two restriction sites of NdeⅠ and NotⅠ of the E. coli expression vector pET28a(+). The primers required for constructing the xanthan gum lyase mutant were synthesized by Jilin Kumei Biotechnology Co., Ltd. The required mutation sites were introduced by PCR amplification using primers with mutation sites in Table 1, and the expression vector of xanthan gum lyase xly with mutation sites was introduced into E. coli.

[0028] Table 2 Primer sequences used in the present invention

[0029] Mutant name <![CDATA[Primer sequence (5 ’ to 3 ’ )]]> S75P gacttgtccccgtcgcgcacgtac N194L ctcacgggcgcgCTGcgggcgtggc E354L gcgcgtgattcagttggatacgtt E291L gtggatctactttgcctatcggcc D304M gcgcgatgatgatgatggtgcg N424F tacgaatcgatcTTCagcgagaacg E713T cgcctcgaggcgCGTgtccgcgatct T262V gtgctggaaacggttgccaac T89D gcaacggcgattcggacaatgtaaacg V351W Ttgcgaagcgctggattcaggaag R gtttcacgcgtcgttccagctgggc

[0030] (4) Add 3 μl of kanamycin with a final concentration of 30 μg / ml to 10 ml of LB liquid medium (mass concentration in water: 1% peptone, 1% NaCl, 0.5% yeast extract powder) and culture in a shaker at 200 rpm and 37°C for 12 h. Cultivate Escherichia coli containing the xanthan lyase xly gene and culture the mutant under the same culture conditions:

[0031] S75P, N194L, E354L, E291L, D304M, N424F, E713T, T262V, T89D, V351W. (5) After centrifuging the E. coli liquid obtained in step (4), the supernatant was discarded, and the bacterial cells were retained. The bacterial cells were washed once with deionized water and buffer solution passed through a membrane in sequence. Finally, the E. coli cells were resuspended in the buffer solution, and the bacterial cells were disrupted using an ultrasonic cell disruptor. After the disruption was completed, the supernatant was taken and the precipitate was discarded. The obtained supernatant was the crude enzyme solution.

[0032] (6) The crude enzyme solution obtained in step (5) is bound and purified using a Ni column (6 mL of Ni-NTA 6FF agarose purification resin filler produced by Sangon Biotech (Shanghai) Co., Ltd.) to obtain purified xanthan gum lyase xly.

[0033] (7) The purified enzyme obtained in step (6) is dialyzed into a buffer solution.

[0034] (8) The purified and dialyzed pure enzyme obtained in step (7) is applied to a xanthan gum substrate, boiled and centrifuged, and the supernatant is collected to detect the enzymatic activity of the xanthan gum lyase at 50°C.

[0035] (9) The purified and dialyzed pure enzyme obtained in step (7) is applied to a xanthan gum substrate, boiled, and centrifuged to obtain the supernatant, thereby detecting the thermal stability of the xanthan gum lyase.

[0036] Further, in the above technical solution, the molecular dynamics simulation method comprises the following steps: a. Download and install GROMACS from the official website to the local computer, and run the program using the command line. Referring to the tutorial in the GROMACS official website (URL: http: / / www.mdtutorials.com / gmx / lysozyme / 02_topology.html), in the present invention, the molecular dynamics simulation standpoint is selected as the Charmm36 force field file, which is also downloaded from its official website and can be used in a folder.

[0037] b. The GROMACS official website provides the files and command lines required for molecular dynamics simulation. During the molecular dynamics simulation, set the water molecule type to SPC / E, set the temperature and pressure equilibrium time to 1ns, and set the added ion to Na +and Cl - For the overall charge balance of xanthan gum lyase, set the energy minimization process to be completed within 50,000 steps, and set the final molecular dynamics simulation time to 50ns. After the above program settings are completed, you can start running the molecular dynamics simulation of xanthan gum lyase xly at 343K, 353K, and 363K. Finally, export the RMSD and RMSF data through the analysis command. The relevant files, commands, and steps are available on the GROMACS official website.

[0038] Furthermore, the protein sequence of the wild-type xanthan gum lyase xly obtained in step (1) (Sequence Table 1) is SEQ ID NO.1, as follows:

[0039]

[0040] The catalytic domain sequence after removing the signal peptide and carbohydrate binding module of wild-type xanthan lyase.

[0041] (a) Sequence characteristics:

[0042] Length: 753

[0043] Type: Amino acid sequence

[0044] Chain type: Single chain

[0045] Topology: Linear

[0046] (b) Molecule type: protein

[0047] (c) Assumption: No

[0048] (d) Antonym: No

[0049] (e) Original source: Bacillus sp.GL1

[0050] The nucleic acid sequence of the wild-type xanthan gum lyase obtained from the NCBI database (Sequence Table 2) is SEQ ID NO. 2, as follows:

[0051]

[0052] (a) Sequence characteristics:

[0053] Length: 2259 bp

[0054] Type: Nucleotide sequence

[0055] Chain type: Single chain

[0056] Topology: Linear

[0057] (b) Molecular type: Nucleotide

[0058] (c) Assumption: No

[0059] (d) Antonym: No

[0060] (e) Original source: Bacillus sp.GL1

[0061] The protein sequence of the xanthan lyase mutant is as follows SEQ ID NO.3-12:

[0062] SEQ ID NO.3:

[0063] S75P (representing the mutation of the S at position 75 of the wild-type xanthan lyase to P, the same meaning below):

[0064]

[0065]

[0066]

[0067]

[0068] The catalytic domain sequence after removing the signal peptide and carbohydrate binding module of the wild-type xanthan gum lyase. The position of the mutant is calculated according to the full-length sequence of the wild-type xanthan gum lyase given in NCBI, where the position of each amino acid after mutation is highlighted in red.

[0069] (a) Sequence characteristics of SEQ ID NO.3-12:

[0070] Length: 753

[0071] Type: Amino acid sequence

[0072] Chain type: Single chain

[0073] Topology: Linear

[0074] (b) Molecule type: protein

[0075] (c) Assumption: No

[0076] (d) Antonym: No

[0077] (e) Original source: Bacillus sp.GL1

[0078] Furthermore, the method for verifying the mutant in step (2) comprises the following steps:

[0079] a. Use the I-Mutant 2.0 online program to predict the possible mutation sites of each amino acid, and take the positive value as the mutation site for the next step of verification. The relevant files and steps can be obtained from the I-Mutant 2.0 official website.

[0080] b. Use the FoldX program to calculate the folding free energy of xanthan gum lyase and each of its mutants. The relevant files and command lines can be obtained from the FoldX official website.

[0081] Furthermore, the method for constructing a mutant in step (3) comprises the following steps:

[0082] The mutant was constructed using the RF cloning method. The template plasmid was the pET28a-xly plasmid with the wild-type xanthan lyase xly gene synthesized by Jilin Kumei Biological Co., Ltd. The amount of each component in the 100 μl system was: 4 μl of the upstream primer and downstream primer R with the mutation site (the primer sequences are given in Table 1), 150 ng of the template plasmid, 8 μL of dNTP (from Takara Biotech Dalian Co., Ltd.), Max DNA Polymerase (from Takara Biotech Dalian Co., Ltd., R045Q) 1 μl, suitable for 20 μl of 5×PS Buffer of Max DNA Polymerase (from Takara Biotech Dalian Co., Ltd.) was added, and the remaining system was made up with sterile water, and then dispensed into 25 μl of each PCR centrifuge tube for PCR. The primers for the xanthan lyase mutant used are shown in Table 2.

[0083] a. Set the PCR program of RFⅠ: 98℃3min, 98℃30s, 58℃30s, 72℃2min, 72℃5min. b. Perform agarose gel electrophoresis on the product after PCR: 1) Weigh 0.25g of agarose (from Thermo Fisher Scientific, 16500500), dissolve in 25ml of 0.5×TBE (the formula is weighing 108g of Tris-base, 55g of boric acid, 7.44g of EDTA, dilute to 0.5× after deionized water to 1L) buffer solution, and heat in a microwave oven until the solution boils; 2) Add 2μl of Green Plus (from Sangon Biotech (Shanghai) Co., Ltd., A6166964S) nucleic acid dye to the dissolved agarose solution, shake well, pour into the gel tank and let it cool naturally to 60℃; 3) Add 5μl of 6×Loading Buffer (the formula is weighing EDTA 4.4g, 250mg bromophenol blue, and 250mg xylene cyanol were added to a 500mL beaker, and 200ml deionized water was added, heated to 70°C and stirred to fully dissolve; ② 180ml glycerol was added, and pH was adjusted to 7.0 with 2mol / L NaOH; ③ the volume was made up to 500ml with deionized water, and the solution was frozen at -25°C after being divided and stored at room temperature after being taken out), and the solution was mixed by blowing with a pipette; 4) the cooled nucleic acid gel was taken out and placed in an agarose gel electrophoresis device, and the sample was added to the gel well with a pipette, and then 1kb DNA Ladder (from Bao Bio Dalian Co., Ltd., 3426A, 500μl) was added to the gel well; 5) the voltage was set to 110V, the current to 70mA, and the electrophoresis time to 25min, and the gel was run; 6) after the gel run, the agarose gel at the target band position was cut according to the size of the target band and the band of the DNA Ladder, and the gel was recovered.

[0084] c. Gel recovery: 1) Place the cut gel block in a small centrifuge tube, add 700μl of Buffer B2 (from Gel Recovery Kit of Sangon Biotech (Shanghai) Co., Ltd., B518131-0100, 100PREPS), and warm at 50℃ until the gel block is completely dissolved; 2) Use a pipette to draw 700μl of the solution after the gel is dissolved, add it to the gel recovery adsorption column (from Gel Recovery Kit of Sangon Biotech (Shanghai) Co., Ltd., B518131-0100, 100PREPS), centrifuge at 8000G for 30s, and pour out the liquid in the collection tube; 3) Use a pipette to draw 500μl of Wash Solution (from Gel Recovery Kit of Sangon Biotech (Shanghai) Co., Ltd., B518131-0100, 100PREPS), centrifuge at 9000G for 30s, and pour out the liquid in the collection tube; 4) Use a pipette to draw 500μl Wash Solution (from Bio-Tech Biotech (Shanghai) Co., Ltd. Gel Recovery Kit, B518131-0100, 100PREPS), centrifuge at 9000G for 30s, and pour out the liquid in the collection tube; 5) Empty adsorption column (from Bio-Tech Biotech (Shanghai) Co., Ltd. Gel Recovery Kit, B518131-0100, 100PREPS, specification 750μl, silica gel filler, maximum membrane size 50μl) centrifuge at 9000G for 1min; 6) Take a clean 1.5ml centrifuge tube, open the cover of the adsorption column, and place it at room temperature for 10min to allow the ethanol in the adsorption column to evaporate completely; 7) Take 30μl Elution Buffer (from Gel Recovery Kit of Sangon Biotechnology (Shanghai) Co., Ltd., B518131-0100, 100PREPS) was added to the membrane in the middle of the adsorption column (from Gel Recovery Kit of Sangon Biotechnology (Shanghai) Co., Ltd., B518131-0100, 100PREPS, silica gel filler, the maximum membrane capacity is 50μl), incubated at 50℃ for 1min, centrifuged at 10000rpm for 1min, and the recovered DNA fragments were in the centrifuge tube.

[0085] d. Perform RFⅡ to introduce the mutation site into the gene of xanthan gum lyase xly: the amount of template plasmid is 150ng, the gel recovery product obtained in step a is 300ng, dNTP 2μl (from Takara Biotech Dalian Co., Ltd.), Max DNA Polymerase (from Takara Biotech Dalian Co., Ltd., R045Q) 0.25 μl, suitable for 5 μl of 5×PS Buffer of MaxDNA Polymerase (from Takara Biotech Dalian Co., Ltd.) was added, and then 14.75 μl of sterile deionized water was added.

[0086] e. Set the PCR program as follows: 98°C for 30 s, 58°C for 15 s, and 72°C for 5 min.

[0087] f. Digestion: Take the product after RFⅡ, add 1μl of restriction endonuclease DpnⅠ (from Baobo Bio Dalian Co., Ltd., 1609), 1μl of 10×Q.Cut Buffer adapted to the endonuclease (from Baobo Bio Dalian Co., Ltd., SD3711), add 8μl of RFⅡ product, digest for 4h, and then transform into competent E. coli.

[0088] Furthermore, the step of introducing the xanthan gum lyase gene into Escherichia coli in step (3) is as follows: a. Streak the glycerol bacteria obtained by full gene synthesis (synthesized by Jilin Kumei Biological Co., Ltd.) on an LB solid culture medium plate containing 30 μg / ml kanamycin resistance, place it in a 37°C bacterial incubator, and culture it for 12 hours.

[0089] b. First, add 3 μl of kanamycin with a final concentration of 30 μg / ml to 10 ml of LB liquid culture medium (mass concentration in water is: 1% peptone, 1% NaCl, 0.5% yeast extract powder), pick a single colony on the cultured LB solid plate and transfer it to the liquid culture medium, and culture it in a shaker at 200 rpm and 37°C for 12 h.

[0090] c. Plasmid extraction: 1) Take 4 mL of overnight cultured bacterial solution and centrifuge at 8000g for 2 min at room temperature, discard the supernatant and retain the bacterial cells; 2) Add 250 μL Buffer P1 (from the plasmid extraction kit of Sangon Biotech (Shanghai) Co., Ltd., B518191, 100 times) to the precipitate and resuspend the bacterial cells thoroughly; 3) Add 250 μL Buffer P2 (from the plasmid extraction kit of Sangon Biotech (Shanghai) Co., Ltd., B518191, 100 times), immediately gently invert the centrifuge tube to mix, and let stand at room temperature for 3 min to completely lyse the cells; 4) Add 350 μL Buffer P3 (Plasmid Extraction Kit from Sangon Biotech (Shanghai) Co., Ltd., B518191, 100 times), gently invert up and down to mix, the liquid appears white flocculent, 12000g, 10min centrifugation; 5) The supernatant was aspirated into the plasmid extraction adsorption column (Plasmid Extraction Kit from Sangon Biotech (Shanghai) Co., Ltd., B518191, 100 times) with a pipette, 8000g, centrifugation for 30s, and the liquid in the collection tube was discarded; 6) 500μL Wash buffer (Plasmid Extraction Kit from Sangon Biotech (Shanghai) Co., Ltd., B518191, 100 times) was added to the plasmid extraction column, 9000g, centrifugation for 30s, and the liquid in the collection tube was discarded; 7) 500μL Wash buffer was added to the plasmid extraction column again, 9000g, centrifugation for 30s, and the liquid in the collection tube was discarded; Buffer, 9000g, centrifuge for 30s, and pour out the liquid in the collection tube; 8) transfer the plasmid extraction column of step 7) to a clean 1.5mL centrifuge tube, centrifuge for 1min at 9000g; 9) open the lid of the centrifuge tube at room temperature and let it stand for 10min to allow the ethanol on the adsorption column to fully evaporate; 10) evenly add 50μL Elution Buffer (from the plasmid extraction kit of Sangon Biotechnology (Shanghai) Co., Ltd., B518191, 100 times) on the adsorption column membrane, warm at 55℃ for 2min, centrifuge at 12000g for 2min, and collect the liquid plasmid.

[0091] d. Add the plasmid extracted in step c to the heat-transferred E. coli BL21 (DE3) competent cells, place them on ice for 30 minutes, place them in a 42°C water bath for 60 seconds, and quickly transfer them to ice for 5 minutes. After the heat transfer is completed, add 1 mL of LB liquid culture medium (the mass concentration in water is: 1% peptone, 1% NaCl, 0.5% yeast extract powder), and culture them in a shaking table at 37°C and 200rpm for 1 hour. Take 80 μL of the conversion solution and spread it on the LB solid culture surface containing a final concentration of 30 μg / mL kanamycin resistance. After culturing in a 37°C incubator for 12 hours, pick a single colony and add it to 10 mL of LB liquid culture medium, and culture it at 37°C and 200rpm for 12 hours. Take 700 μL of the bacterial solution and add 300 μL of 60% (volume concentration, 40 ml of deionized water and 60 ml of glycerol) glycerol to make glycerol bacteria to preserve the strains.

[0092] Furthermore, in the above technical solution, the method for culturing the Escherichia coli containing the xanthan gum lyase xly gene obtained in step (3) in step (4) comprises the following steps:

[0093] a. Streak the glycerol bacteria containing the xanthan lyase xly gene stored in a -80°C refrigerator on a solid medium containing LB (the mass concentration in water is: 1% peptone, 1% NaCl, 0.5% yeast extract powder) with a final concentration of 30 μg / ml kanamycin resistance, and culture it in a 37°C bacterial incubator for 12 hours;

[0094] b. First, add 3 μl of kanamycin with a final concentration of 30 μg / ml to 10 ml of LB liquid medium (mass concentration in water is: 1% peptone, 1% NaCl, 0.5% yeast extract powder), pick a single colony from the cultured LB solid plate and transfer it to the liquid medium, and culture it in a shaker at 200 rpm and 37°C for 12 hours to obtain a bacterial solution;

[0095] c. Escherichia coli culture (OD 600 =0.8) was expanded into 500 ml of LLB (mass concentration in water: 0.5% NaCl, 1% peptone, 0.5% yeast extract powder) liquid culture medium at a volume ratio of 1:50, and cultured in a shaking incubator at 200 rpm and 37°C. The absorbance at 600 nm was measured by a UV spectrophotometer until OD 600 =0.6.

[0096] d. After the expansion culture was completed, 250 μl of isopropyl-β-D-thiogalactoside (IPTG) inducer with a final concentration of 1 M was added to 500 ml of LLB medium and induced at 200 rpm and 16°C for 8 h.

[0097] Furthermore, in the above technical solution, the method for collecting and crushing the Escherichia coli containing xanthan gum lyase XLY obtained in step (4) to obtain a crude enzyme comprises the following steps:

[0098] a. Install the rotor of the TGL-21 large refrigerated centrifuge and pre-cool it at 4°C. Transfer the induced bacterial solution to a clean 250ml centrifuge cup. The volume of the bacterial solution should not exceed 2 / 3 of the volume of the centrifuge cup. Use a balance to balance it.

[0099] b. Centrifuge at 8000g for 5 min at 4°C. After centrifugation, discard the culture medium and retain the bacterial pellet.

[0100] c. Resuspend the cells with deionized water filtered through a 0.22 μm filter membrane, wash the cells once, and centrifuge at 8000 g for 5 min. After centrifugation, discard the supernatant and retain the cell pellet.

[0101] d. Resuspend with Binding Buffer (pH 8) (formula: 500 mM NaCl, 50 mM NaH2PO4·2H2O in water), wash the cells once, centrifuge at 8000 g for 5 min, discard the supernatant after centrifugation, and retain the cell pellet.

[0102] e. After thoroughly resuspending the cells with 50 ml of Binding Buffer, the cells were broken using an ultrasonic cell disruptor with a power setting of 500 W, with ultrasound on for 5 seconds and ultrasound off for 3 seconds, alternating under these conditions for 30 minutes. f. After the breaking, use a TGL-21 centrifuge and centrifuge at 10,000 rpm for 20 minutes at 4°C. After the centrifugation is complete, the precipitate is discarded and the supernatant is the crude enzyme solution.

[0103] Furthermore, in the above technical solution, the method of Ni column binding purification of the crude enzyme solution obtained in step (5) in step (6) comprises the following steps:

[0104] a. First, pass the crude enzyme solution through a 0.45 μm filter membrane, filter out impurities, and retain the crude enzyme solution that has passed through the membrane (permeable solution). b. Cycle the crude enzyme solution. Connect the Ni column (6 mL Ni-NTA 6FF agarose purification resin filler from Sangon Biotech (Shanghai) Co., Ltd.) to the pump, adjust the flow rate to 0.8 ml / min, and cycle the sample three times to allow the protein and the filler in the Ni column to fully combine.

[0105] c. After the protein is fully combined with the Ni column, the Ni column is connected to the AKTA protein purification instrument to purify the crude enzyme solution;

[0106] d. First, wash the protein with pH=8 Binding Buffer (formula: 500mM NaCl, 50mM NaH2PO4·2H2O in water) at a flow rate of 2mL / min. When a peak appears on the display, flush the baseline and flush again for 20min after the baseline is stable.

[0107] e. Wash the protein with pH 8 Wash Buffer (formula: 500 mM NaCl, 50 mM NaH2PO4·2H2O, 30 mM imidazole in water) at a flow rate of 2 mL / min. After the peak appears, flush the baseline and wait until the baseline is stable before flushing for another 20 min.

[0108] f. Finally, rinse with pH=8 Elution Buffer (formula: 500mM NaCl, 50mM NaH2PO4·2H2O, 250mM imidazole in water) at a flow rate of 2mL / min. When a peak appears on the display, collect the entire peak. The peak is the target protein. Place the target protein on ice and rinse for 20min after the baseline is stable.

[0109] The obtained target protein was detected by SDS-PAGE electrophoresis. Figure 1 As shown, lane m is the protein marker, lane 1 is empty, lane 2 is the crude enzyme, and lane 3 is the purified protein, the size of the protein is about 80KDa;

[0110] g. After purification, rinse the Ni column with deionized water that has passed through a 0.22 μm filter membrane at a flow rate of 2 mL / min. After the baseline is flushed, continue flushing for 20 minutes.

[0111] h. After flushing the membrane water, rinse the Ni column with 20% anhydrous ethanol that has passed through a 0.22μm filter membrane for 20 minutes at a flow rate of 2mL / min. The Ni column should be stored in 20% anhydrous ethanol that has passed through a 0.22μm filter membrane, and the purification is completed.

[0112] Furthermore, in the above technical solution, the method of dialyzing the pure enzyme obtained in step (6) into a buffer solution in step (7) comprises the following steps:

[0113] a. Use a dialysis bag with a pore size of 3500D for dialysis

[0114] b. Place the collected target protein (the protein obtained in step (6)) into a dialysis bag, which is placed in a buffer solution (pH = 5.2 50 mM CH3COONa, pH adjusted with CH3COOH), with a volume ratio of protein to dialysate of 1:100.

[0115] c. Place the dialysate in a 4°C refrigerator for dialysis.

[0116] d. Replace the dialysate every 2, 4, and 8 hours, transfer the dialysis bag to new dialysate (the same volume of the above buffer solution), and continue dialysis at 4°C.

[0117] Furthermore, in the above technical solution, the method for detecting the enzyme activity of the purified dialyzed protein obtained in step (7) at 50° C. in step (8) comprises the following steps:

[0118] Enzyme activity definition: the amount of enzyme required to increase the absorbance at 235nm by 1.0

[0119] a. Weigh 0.06 g of xanthan gum and dissolve it in 30 ml of buffer (pH = 5.2 50 mM CH3COONa, adjust pH with CH3COOH) to obtain a 2 mg / ml xanthan gum substrate solution.

[0120] b. Dilute the dialyzed protein obtained in step (7) to 0.01 mg / ml. Divide the diluted protein into two parts, one for the experimental group and the other for the control group. Place the protein in the experimental group on ice for later use. The xanthan gum substrate used in the experimental group and the control group is the xanthan gum substrate prepared in step (7) a.

[0121] c. Take 500 μl of the protein from the experimental group and 500 μl of the xanthan gum substrate described in step (7) a, mix thoroughly, and place in a 50°C water bath for reaction for 20 min. After the reaction is completed, boil in a boiling water bath for 5 min to stop the reaction, then centrifuge at 10,000 rpm for 10 min, and take the supernatant for later use.

[0122] d. The control group was set as the zero-time control. First, the centrifuge tube was precooled on ice, and then the xanthan gum substrate was dispensed, 500 μl per centrifuge tube. The protein on ice was added to the xanthan gum substrate, and immediately inactivated in a boiling water bath for 10 minutes. Then, the protein was centrifuged at 10,000 rpm for 10 minutes, and the precipitate was discarded and the supernatant was used for later use. Three parallel samples were set for each of the control group and the experimental group (the results of the three parallel samples were taken as the mathematical average).

[0123] e. After the control group and the experimental group are centrifuged, dilute the samples of the experimental group and the control group by 10 times (100 μl supernatant + 900 μl buffer). Turn on the UV spectrophotometer, set the measurement wavelength to 235 nm after the instrument is preheated, and use a quartz cuvette to measure the absorbance of each sample.

[0124] Enzyme activity calculation formula: (mean absorbance of experimental group - mean absorbance of control group) / reaction time (min) × protein concentration. Mean absorbance of experimental group: After measuring the absorbance of each sample in the experimental group, calculate the average value;

[0125] Mean absorbance of the control group: After measuring the absorbance of each sample in the control group, calculate the average value;

[0126] Reaction time: the time of enzyme activity reaction, in min

[0127] Protein concentration: protein concentration after dilution, in mg / ml

[0128] The results of enzyme activity assay were as follows Figure 3 As shown, compared with the wild-type xanthan gum lyase xly, the enzyme activity of the xanthan gum lyase mutant at 50°C is improved, and the enzyme activities of the mutants S75P, N194L, E354L, E291L, D304M, N424F, E713T, T262V, T89D, and V351W are increased by 22.54%, 7.77%, 21.58%, 30.66%, 32.57%, 10.21%, 44.31%, 44.78%, 30.58%, and 43.87%, respectively. The enzyme activity of the xanthan gum lyase mutant at 50°C is significantly improved. All mutants are constructed, transformed, expressed, purified, and the enzyme activity at 50°C is determined according to the technical methods in steps (3)-(8).

[0129] Furthermore, in the above technical solution, in step (9), the pure enzyme purified and dialyzed in step (7) is acted on a xanthan gum substrate to determine its thermal stability, which comprises the following steps:

[0130] a. Obtain the purified and dialyzed pure enzyme in step (7).

[0131] b. Dilute the protein to 0.01 mg / ml in advance, divide the protein into two parts, one as the experimental group and the other as the control group, and place them on ice for later use. The control group is set as the control at time zero. Add 500 μl of 2 mg / ml xanthan gum substrate in a 2 ml centrifuge tube in advance. After sufficient precooling, add the same volume of diluted protein solution, boil in a water bath for 5 minutes, centrifuge at 10,000 rpm for 10 minutes, discard the precipitate, and take the supernatant for later use.

[0132] c. Add 500μl of the experimental group protein to a 2ml centrifuge tube, and then incubate in a 50℃ water bath for 30min. After the incubation, take out the centrifuge tube with the enzyme, add 500μl of 2mg / ml xanthan gum substrate to each centrifuge tube, and place it in a 45℃ water bath for enzyme reaction for 20min. Set up three parallel samples for each experimental group and control group (the results of the three parallel samples are taken as the mathematical average).

[0133] d. After the incubation period, take out the experimental group, boil in water for 5 minutes to terminate the reaction, centrifuge at 10000 rpm for 10 minutes, discard the precipitate, and take the supernatant for later use. Dilute the samples of the experimental group and the control group 10 times (100 μl sample + 900 μl buffer).

[0134] e. Turn on the UV spectrophotometer. After the instrument is preheated, set the measurement wavelength to 235 nm and use a quartz cuvette to measure the absorbance of each sample.

[0135] The results are as follows Figure 4 As shown, compared with the wild-type xanthan gum lyase xly, the enzyme activity of the xanthan gum lyase mutants was significantly improved after incubation at 50℃ for 30min, and the enzyme activities of mutants S75P, N194L, E354L, E291L, D304M, N424F, E713T, T262V, T89D, and V351W were increased by 74.25%, 26.59%, 56.93%, 42.09%, 10.08%, 15.52%, 19.77%, 53.81%, 40.23%, and 22.73%, respectively. The wild-type xanthan gum lyase xly was transformed by site-directed mutagenesis, and its thermal stability was successfully improved, so that the xanthan gum lyase could cleave xanthan gum at high temperature. All mutants were constructed, transformed, expressed, purified and the thermal stability of the enzyme at 50°C was determined according to the technical methods in steps (3)-(7) and step (9).

[0136] In summary, the thermostability of xanthan gum lyase was successfully improved after enzyme engineering of wild-type xanthan gum lyase xly by molecular dynamics simulation and computer program prediction of mutation sites. Compared with wild-type xanthan gum lyase xly, the enzyme activities of xanthan gum lyase mutants S75P, N194L, E354L, E291L, D304M, N424F, E713T, T262V, T89D, and V351W at 50°C were increased by 22.54%, 7.77%, 21.58%, 30.66%, 32.57%, 10.21%, 44.31%, 44.78%, 30.58%, and 43.87%, respectively. The enzyme activities of wild-type xanthan gum lyase xly and xanthan gum lyase mutant were measured again after incubation at 50℃ for 30min. Compared with wild-type xanthan gum lyase xly, the enzyme activities of xanthan gum lyase mutant increased by 74.25%, 26.59%, 56.93%, 42.09%, 10.08%, 15.52%, 19.77%, 53.81%, 40.23%, and 22.73%, respectively. The thermal stability of xanthan gum lyase mutant was significantly improved compared with wild-type xanthan gum lyase xly. The modified xanthan gum lyase mutant can cleave xanthan gum at high temperature and is more suitable for application in industry and petroleum industry.

Claims

1. A modified xanthan gum lyase with improved thermal stability, Features: The xanthan lyase is xanthan lyase [Bacillus sp. GL1], having an amino acid sequence shown in SEQ ID NO. 3-12.

2. An application of the modified xanthan gum lyase with improved thermal stability according to claim 1, Features: For cracking xanthan gum at higher temperatures; The working conditions of xanthan gum lyase are: the usable temperature is 30-55°C, preferably 45-55°C, more preferably 50°C.

3. The use according to claim 2, Features: The xanthan gum lyase has an enzyme concentration of 0.01-1 mg / mL in the buffer, preferably 0.01-0.5 mg / mL, more preferably 0.01-0.1 mg / mL; The concentration of xanthan gum dissolved in the buffer solution is 1-5 mg / mL, preferably 2-4 mg / mL, and more preferably 2-3.5 mg / mL.

4. The use according to claim 3, Features: The buffer solution is sodium acetate buffer solution, Binding Buffer, Wash Buffer and Elution Buffer; the modified xanthan gum lyase can react with xanthan gum at a higher temperature.

Images