Artemisia annua U6 promoter and application

Abstract

The invention provides an artemisia annua U6 promoter and application, and relates to the technical field of gene engineering. Eight endogenous U6 promoters are screened and cloned from an artemisia annua genome, and sequence contrastive analysis finds that each of the eight promoters contains two conservative cis-acting elements USE and TATA-box which influence the transcriptional activity of the promoters. A fusion expression vector expressed by a firefly luciferase gene (LUC) driven by an Artemisia annua U6 promoter is constructed through experiments, Bensi tobacco leaves are transiently transformed, and the transcriptional activity of each promoter is detected and compared through in-vivo imaging and a dual-luciferase report system. Results show that the transcriptional activities of the promoters AaU6-3, AaU6-1 and AaU6-5 are all obviously higher than those of the promoters AtU6-26 of arabidopsis thaliana, and the AaU6-3 has the highest activity. In conclusion, three artemisia annua endogenous U6 promoters with high transcriptional activity are screened and identified in the research, efficient promoter elements are provided for artemisia annua gene editing, and the method has important significance on molecular breeding of artemisia annua and efficient raw material production of artemisinin.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to an Artemisia annua U6 promoter and its application. Background Art

[0002] The CRISPR / Cas9 system is an efficient genome editing tool that can achieve functions such as base knockout, replacement, and insertion at specific sites in the genome of the edited object. The transcription of sgRNA is often driven by the U6 promoter in dicotyledons. The U6 promoter has a clear transcription start site G, which can accurately transcribe sgRNA and reduce the occurrence of off-target effects. However, the U6 promoter is usually species-specific, and using the U6 promoter of the transformed species itself or a closely related species can achieve higher promoter efficiency.

[0003] Artemisia annua is an annual herb of the Asteraceae family. It has the effects of clearing away heat and relieving summer heat, removing steam, and stopping malaria. Its main active ingredient is artemisinin and its derivatives, which are the most effective drugs for treating cerebral malaria and chloroquine-resistant malignant malaria. Therefore, the market demand is increasing year by year. However, there is no report on the U6 promoter of Artemisia annua, which seriously restricts the development of efficient gene editing technology for Artemisia annua. Summary of the invention

[0004] 1. Technical issues to be solved

[0005] In view of the deficiencies in the prior art, the present invention provides an Artemisia annua U6 promoter and applications thereof, which solve the problems raised by the above-mentioned background technology.

[0006] (II) Technical solution

[0007] To achieve the above object, the present invention is implemented by the following technical scheme: Artemisia annua U6 promoter includes any one of the following sequences:

[0008] (1) AaU6-3 promoter sequence, the nucleotide sequence of which is: upstream primer: 5'-CCCAAATACAGAAAGAAATGC-3', downstream primer: 5'-GGGCCATGCTAATCTTCTC-3';

[0009] (2) AaU6-1 promoter sequence, the nucleotide sequence of which is: upstream primer: 5'-TGCACAAGGATTTCATCTTAA-3', downstream primer: 5'-GGGCCATGCTAATCTTCTC-3';

[0010] (3) AaU6-5 promoter sequence, the nucleotide sequence of which is: upstream primer: 5'-CGGTATTCAGATTAGTTCGC-3', downstream primer: 5'-GGGCCATGCTAATCTTCTC-3';

[0011] The Artemisia annua U6 promoter drives the efficient expression of guide RNA (sgRNA).

[0012] Preferably, the Artemisia annua U6 promoter is used in combination with the CRISPR / Cas9 gene editing system.

[0013] Preferably, the Artemisia annua U6 promoter is used in combination with genetic transformation of Artemisia annua.

[0014] An expression vector comprising the above-mentioned Artemisia annua U6 promoter is used to express sgRNA in Artemisia annua.

[0015] A method for screening and identifying an Artemisia annua U6 promoter comprises the following steps:

[0016] Step 1: Screen and clone the U6 promoter with high homology from the Artemisia annua genome;

[0017] Step 2: constructing a fusion expression vector containing the U6 promoter sequence;

[0018] Step 3: transiently transforming the fusion expression vector into Nicotiana benthamiana leaves;

[0019] Step 4: detecting the transcriptional activity of the U6 promoter by in vivo imaging and dual luciferase assay;

[0020] Step 5: Screen out the endogenous U6 promoter of Artemisia annua whose transcriptional activity is significantly higher than that of Arabidopsis thaliana AtU6-26.

[0021] Preferably, the method further comprises verifying the activity and gene editing efficiency of the endogenous AaU6 promoter of Artemisia annua by promoter truncation and genetic transformation of Artemisia annua.

[0022] Application of Artemisia annua U6 promoter or expression vector in gene editing of the medicinal plant Artemisia annua.

[0023] Application of Artemisia annua U6 promoter or expression vector in variety improvement of medicinal plant Artemisia annua.

[0024] Application of Artemisia annua U6 promoter or expression vector to express sgRNA in the medicinal plant Artemisia annua.

[0025] (III) Beneficial effects

[0026] The present invention provides an Artemisia annua U6 promoter and its application, which has the following beneficial effects:

[0027] 1. The present invention provides an Artemisia annua U6 promoter with high transcriptional activity, which can effectively increase the expression level of sgRNA, thereby improving gene editing efficiency.

[0028] 2. By using the Artemisia annua U6 promoter of the present invention, efficient gene editing of Artemisia annua and other plants can be achieved, providing a new technical means for plant variety improvement.

[0029] 3. The Artemisia annua U6 promoter of the present invention is species-specific, can reduce nonspecific editing, and improve the accuracy of gene editing.

[0030] In summary, the present invention provides a new tool for gene editing of Artemisia annua and other plants, which has important application value and broad market prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 This is a schematic diagram of PCR amplification of the Artemisia annua AaU6 promoter of the present invention;

[0032] Figure 2 It is a schematic diagram of the sequence comparison of the Artemisia annua AaU6 promoter and the Arabidopsis thaliana AtU6-26 promoter of the present invention;

[0033] Figure 3 This is a schematic diagram of the construction of the AaU6:LUC recombinant vector of the present invention;

[0034] Figure 4 Schematic diagram of transient expression of AaU6:LUC and AtU6-26:LUC in Nicotiana benthamiana leaves of the present invention;

[0035] Figure 5 It is a schematic diagram comparing the relative luciferase ratios of AaU6:LUC and AtU6-26:LUC of the present invention. DETAILED DESCRIPTION

[0036] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0037] Example:

[0038] The Artemisia annua variety CQ, vector plasmid pGreenII0800, Agrobacterium EHA105 and Nicotiana benthamiana seeds used in the embodiments of the present invention were all stored in the laboratory. HindⅢ and BamHI restriction endonucleases were purchased from ThermoScientific, the plant genomic DNA extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. (DP305), the gel recovery kit was purchased from Novigene Biopharmaceutical Technology Co., Ltd. (DC301-01), the dual luciferase reporter gene detection kit was purchased from Meilun Biotechnology Co., Ltd. (MA0518), DNA sequencing was completed by Nosai Gene, and primer synthesis was completed by Qingke Biotechnology Co., Ltd.

[0039] Sequence screening of AaU6 promoter

[0040] The snRNA sequence of Arabidopsis thaliana AtU6 (5'-GTCCCTTCGGGGACATCCGATAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGC GCAAGGATGACACGCATAAATCGAGAAATGGTCCAAATTTT-3') was searched and compared in the Artemisia annua genome, and the candidate AaU6 with higher homology was screened out from the results, and the upstream 600 bp or so was taken as the candidate promoter sequence.

[0041] Cloning and sequence analysis of AaU6 promoter

[0042] 50 mg of fresh Artemisia annua leaves were taken and ground with liquid nitrogen. The genomic DNA of Artemisia annua was extracted using a plant genome extraction kit, and the primers for PCR cloning of the U6 promoter of Artemisia annua were designed using Primer Premier 5.0 (Table 1). The PCR product was detected by 1% agarose gel electrophoresis, and the target DNA fragment was recovered and purified using a gel recovery kit. The purified PCR product was connected with the cloning vector p-Blunt (Beijing Quanshijin Biotechnology Co., Ltd., CB111-01) and transformed into Trans1-T1 competent cells (Beijing Quanshijin Biotechnology Co., Ltd., CD501-02), and then positive monoclones were screened by colony PCR. After the correct band position was detected by 1% agarose gel electrophoresis, it was sent to Nosai Gene Co., Ltd. for DNA sequencing to obtain the final sequence of the U6 promoter of Artemisia annua.

[0043] DNAMAN software was used to compare the sequences of Arabidopsis thaliana AtU6-26 promoter and cloned candidate U6 promoter of Artemisia annua to analyze their conserved structural elements.

[0044] Table 1. Primers for cloning the U6 promoter of Artemisia annua

[0045]

[0046]

[0047] Construction of AaU6-X:LUC dual luciferase vector

[0048] The p-Blunt vector and the plant expression vector pGreenII-0800-LUC connected with the Artemisia annua U6 promoter sequence were double-digested with HindⅢ and BamHⅠ, respectively, and the target fragments were recovered respectively. Then, they were ligated with T4 ligase and transformed into Trans1-T1 competent cells, and the recombinant plasmids were sequenced and identified to construct a fusion expression vector of the Artemisia annua U6 promoter driving the LUC reporter gene, which were named AaU6-X:LUC (X=1~8) and stored at -20℃ for future use.

[0049] Transient transformation of Nicotiana benthamiana leaves

[0050] Each constructed AaU6-X:LUC fusion expression vector, AtU6-26:LUC, and negative control pGreenII-0800-LUC were transformed into Agrobacterium competent cells EHA105, and the auxiliary plasmid psoup was added at 28°C in YEB solid medium (Kan 50 μg mL -1 , Rif50μg·mL -1 ) for 72 to 90 hours, then pick a single clone for PCR verification, and add 50% glycerol to the verified Agrobacterium culture and store it at -80°C.

[0051] The above Agrobacterium was cultured in YEB solid medium (Kan 50 μg mL -1 , Rif50μg·mL -1 ) and streak overnight culture. Take two match-head-sized bacteria and mix them in 20 ml YEB (Kan 50 μg mL -1 , Rif50μg·mL -1 ) liquid medium, culture overnight at 28°C and 200 rpm until the OD600 value reaches 2.0, transfer 2-4% of the bacterial solution to 20 ml YEB (Kan 50 μg mL -1 , Rif50μg·mL -1 ) liquid culture medium, culture at 28°C, 200rpm for 4-5h until the OD600 value reaches 0.6-1.0. Centrifuge at 4000rpm for 5min to collect the cells, discard the supernatant, and resuspend the cells in MMA resuspension buffer (MS, 200uMAS, 10mMMES, 10mMMgCl2) to OD 600 The value was 1.0, and then the mixture was allowed to stand at 28°C for 3 hours.

[0052] The bacterial solution was injected into the leaves of 3-4 week old tobacco seedlings, and the leaves were cultured in the dark for 24 hours before being moved to a greenhouse (23±2°C, 16 hours of light, 8 hours of darkness). The tobacco leaves were observed after 3 days of culture and samples were taken for testing.

[0053] Biochemiluminescence detection

[0054] Tobacco leaves were taken 3 days after transient transformation, 1x D-luciferin potassium salt was sprayed on the leaves, and after dark treatment for 10 minutes, the living fluorescence signal image was captured by a plant imaging system (Plant Phenotype Imaging System LB985, Berthold, Germany), and the transcriptional activity of different promoters was determined based on the intensity of the fluorescence signal.

[0055] Dual luciferase assay

[0056] The injected tobacco leaves were quantitatively removed, with 3 replicates per portion, placed in 1.5 mL centrifuge tubes, and analyzed using a dual luciferase assay kit (MA0518, Meilun Biotechnology Co., Ltd.). 150 ul of cell lysis solution and two steel beads were added to each tube, and the leaves were crushed and ground for 4 minutes after being frozen in liquid nitrogen. After being placed for 5 minutes to fully lyse the cells, they were briefly centrifuged at 4°C for 3-5 minutes. 40 μl of supernatant was taken into a 96-well plate, and 75 μl of firefly luciferase and sea cucumber luciferase assay reagents were added successively to detect the fluorescence values, and the ratio of firefly luciferase activity to sea renilla luciferase activity was calculated. The ratio of the control group was used as the benchmark 1 for normalization, and the transcriptional activity of different promoters was compared.

[0057] Genome-wide screening and cloning of the AaU6 promoter in Artemisia annua

[0058] Using the known Arabidopsis AtU6snRNA gene sequence, the AaU6 promoter sequence was screened at the genome level based on the published Artemisia annua genome LQ-9. The BLAST results showed that the homology was more than 99% and the E value was ≤6.08e -45 There were 17 homologous sequences in total. After redundancy removal and sorting analysis, 8 U6snRNA sequences of Artemisia annua were finally screened and obtained. They were located on chromosomes 2, 3, and 5 of Artemisia annua and were named AaU6-1 to AaU6-8 (Table 2).

[0059] In this experiment, 600 bp upstream of each AaU6snRNA was selected as the candidate sequence of the U6 promoter of Artemisia annua, and cloning primers (Table 1) were designed to amplify the promoter fragment from Artemisia annua. The results of agarose gel electrophoresis showed that the PCR amplification band was single and the size of the amplified fragment was consistent with the expected target fragment size ( Figure 1). The DNA sequencing results showed that the amplified bands were correct, and the nucleic acid lengths were 587bp, 558bp, 653bp, 557bp, 657bp, 634bp, 616bp and 586bp, respectively.

[0060] Table 2: Chromosome location of Artemisia annua AaU6snRNA

[0061]

[0062]

[0063] Note: Chromosome location* shows the start site of AaU6 transcription

[0064] Sequence Analysis of the Promoter Gene AaU6 of Artemisia annua

[0065] Sequence comparison and analysis were performed using DNAMAN software ( Figure 2 ), it was found that the 8 Artemisia annua AaU6 promoter sequences and the Arabidopsis thaliana AtU6-26 promoter transcription start site base were all "G", and all contained the necessary elements that affect the transcription activity of the U6 promoter, namely the TATA-box located at -30bp upstream of the transcription start site and the USE (upstream sequence element) element (5'-TCCCACATCGA-3') at -65bp, and the distance between the two elements was relatively conservative.

[0066] Analysis of transcriptional activity of AaU6 promoter in Artemisia annua

[0067] In this experiment, the fusion expression vectors of LUC reporter genes driven by Arabidopsis thaliana AtU6-26 and Artemisia annua AaU6 were constructed. Figure 3 ), and after transient transformation into Nicotiana benthamiana leaves, the transcriptional activity of the eight cloned AaU6 promoters of Artemisia annua was detected by in vivo imaging and dual luciferase assay. AtU6-26 was used as a positive control, and empty pGreenII-0800-LUC was used as a negative control.

[0068] In vivo imaging results showed that ( Figure 4 ), the transcriptional activities of the eight Artemisia annua U6 promoters in activating the LUC reporter gene were different, among which the fluorescence signal driven by AaU6-3 was the strongest, followed by AaU6-1, AaU6-5, and AaU6-6, while the fluorescence signals of AaU6-2, AaU6-4, AaU6-7, and AaU6-8 were extremely weak.

[0069] Furthermore, dual luciferase assay analysis revealed that ( Figure 5), the luciferase activity driven by the AaU6-3 promoter was the highest, and AaU6-1 and AaU6-5 also had high activity. Their luciferase activities were significantly higher than those of the other promoters and the negative control, while the luciferase expression levels of AaU6-2, AaU6-4, AaU6-7, and AaU6-8 were extremely low, with no significant difference from the positive control. This is consistent with the results observed by in vivo imaging. The transcriptional activity of AaU6-3, AaU6-1, and AaU6-5 in Artemisia annua was significantly increased compared with that of Arabidopsis thaliana AtU6-26. They were 4.59 times, 2.37 times, and 1.53 times that of AtU6-26, respectively. Therefore, this experiment successfully screened and obtained three endogenous AaU6 promoters (AaU6-3, AaU6-1, and AaU6-5) of Artemisia annua, laying the foundation for efficient gene editing and variety improvement research of the medicinal plant Artemisia annua.

[0070] The U6 promoter is an important element of the CRISPR / Cas9 gene editing technology system in dicotyledonous plants. It is a promoter recognized by RNA polymerase III, which can drive the efficient expression of sgRNA and reduce off-target effects. Therefore, many species use Arabidopsis U6 promoter and rice U6 promoter to heterologously express sgRNA. The U6 promoter is species-specific. At present, many species such as soybean and cotton have found that the endogenous U6 promoter can better drive the expression of sgRNA, thereby improving the efficiency of species gene editing. However, the endogenous U6 promoter of Artemisia annua has not been reported. The identification of the endogenous U6 promoter of Artemisia annua is of great significance for the functional gene research and gene editing breeding of Artemisia annua.

[0071] In this study, eight AaU6 promoters were screened and cloned from the whole genome of Artemisia annua. Sequence analysis showed that all eight AaU6 promoters contained conserved TATA boxes and USE elements, and the spacing between these two elements was conserved, which was consistent with AtU6 in Arabidopsis thaliana. In this study, a dual fluorescence reporter gene detection system was selected to detect promoter activity. This system expresses firefly luciferase and Renilla luciferase simultaneously, with firefly luciferase as the core reporter gene and Renilla luciferase as the internal reference, and is widely used for gene promoter activity analysis. The results of in vivo imaging and dual fluorescence enzyme activity detection showed that there were significant differences in the transcriptional activities of the eight cloned AaU6 promoters. Among them, the transcriptional activities of AaU6-3, AaU6-1 and AaU6-5 were strong, significantly higher than those of Arabidopsis thaliana AtU6-26 and the negative control, and can be used as candidate endogenous AaU6 promoters of Artemisia annua for gene editing and other technologies. AaU6-6 showed activity comparable to that of AtU6-26, while the transcriptional activities of AaU6-2, AaU6-4, AaU6-7, and AaU6-8 were very low.

[0072] In summary, this study cloned 8 endogenous U6 promoters of Artemisia annua through whole genome screening, and screened and identified 3 endogenous U6 promoters of Artemisia annua (AaU6-3, AaU6-1 and AaU6-5) with significantly higher transcriptional activity than AtU6-26 of Arabidopsis thaliana, providing necessary elements for optimizing gene editing efficiency of Artemisia annua. In the future, we will further verify the activity and gene editing efficiency of the endogenous AaU6 promoter of Artemisia annua through promoter truncation and genetic transformation of Artemisia annua, laying a foundation for efficient gene editing and high-quality variety improvement of Artemisia annua.

[0073] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Artemisia annua U6 promoter, characterized in that: Include any of the following sequences: (1) AaU6-3 promoter sequence, the nucleotide sequence of which is: upstream primer: 5'-CCCAAATACAGAAAGAAATGC-3', downstream primer: 5'-GGGCCATGCTAATCTTCTC-3'; (2) AaU6-1 promoter sequence, the nucleotide sequence of which is: upstream primer: 5'-TGCACAAGGATTTCATCTTAA-3', downstream primer: 5'-GGGCCATGCTAATCTTCTC-3'; (3) AaU6-5 promoter sequence, the nucleotide sequence of which is: upstream primer: 5'-CGGTATTCAGATTAGTTCGC-3', downstream primer: 5'-GGGCCATGCTAATCTTCTC-3'; The Artemisia annua U6 promoter drives the efficient expression of guide RNA (sgRNA).

2. The Artemisia annua U6 promoter according to claim 1, characterized in that: The Artemisia annua U6 promoter is used in combination with the CRISPR / Cas9 gene editing system.

3. The Artemisia annua U6 promoter according to claim 1 or 2, characterized in that: The Artemisia annua U6 promoter is used in combination with the genetic transformation of Artemisia annua.

4. An expression vector comprising the Artemisia annua U6 promoter according to claim 1, characterized in that: Used to express sgRNA in Artemisia annua.

5. A method for screening and identifying the U6 promoter of Artemisia annua, characterized in that: The following steps are involved: Step 1: Screen and clone the U6 promoter with high homology from the Artemisia annua genome; Step 2: constructing a fusion expression vector containing the U6 promoter sequence; Step 3: transiently transforming the fusion expression vector into Nicotiana benthamiana leaves; Step 4: detecting the transcriptional activity of the U6 promoter by in vivo imaging and dual luciferase assay; Step 5: Screen out the endogenous U6 promoter of Artemisia annua whose transcriptional activity is significantly higher than that of Arabidopsis thaliana AtU6-26.

6. The method for screening and identifying the Artemisia annua U6 promoter according to claim 5, characterized in that: It also includes further verification of the activity and gene editing efficiency of the endogenous AaU6 promoter of Artemisia annua through promoter truncation and genetic transformation of Artemisia annua.

7. Application of Artemisia annua U6 promoter or expression vector in gene editing of the medicinal plant Artemisia annua.

8. Application of Artemisia annua U6 promoter or expression vector in improving the variety of medicinal plant Artemisia annua.

9. Application of Artemisia annua U6 promoter or expression vector to express sgRNA in the medicinal plant Artemisia annua.

Images