Method for purifying lily positive seedlings

Abstract

The invention discloses a method for purifying lily positive seedlings, and belongs to the technical field of flower biology. According to the method, lily positive seedlings obtained through an agrobacterium-mediated genetic transformation system are purified. Aiming at the phenomena of lily conversion rate, high transgenic seedling chimera, transgenic seedling degeneration after being taken out of a bottle and the like, firstly, a method for optimizing a receptor material sampling part is utilized to ensure that scales induce undifferentiated buds and reduce chimera probability; meanwhile, after the tissue culture seedling is identified as a transgenic positive seedling, the positive seedling is further purified by utilizing a petiole embryogenic callus induction seedling way, so that the phenomenon that the transgenic seedling is degraded after being taken out of a bottle is avoided. The technical system can be applied to molecular breeding, germplasm resource creation and variety improvement of lilium brownii.

Description

Technical Field

[0001] The invention belongs to the field of flower biotechnology, and particularly relates to a method for purifying lily positive seedlings. Background Art

[0002] Lily is a perennial monocotyledonous bulbous flower with ornamental, nutritional and medicinal value. It is also one of the most widely cultivated cut flowers and potted flowers in the world. Conventional breeding methods can no longer meet the public's demand for lilies, and there is also interspecific incompatibility in lily hybrid breeding, which sets up obstacles for the selection and improvement of new lily varieties. The rapid development of genetic engineering breeding has made it possible to change the traits of lilies in a targeted manner, and it can also overcome the drawbacks of poor gene pools and interspecific hybridization incompatibility, which is conducive to the development of molecular breeding.

[0003] At present, Agrobacterium-mediated method is the most widely used and most efficient transgenic method in lily genetic transformation research. Among them, the genetic transformation system established with lily scales and callus as receptor materials is the most common. However, when using Agrobacterium-mediated method to carry out lily genetic transformation experiments, it was found that the positive strains obtained in the lily bottle seedling stage were taken out of the bottle for maintenance for a period of time, and the new leaves were re-identified after the old leaves fell off. It is very easy for the original positive seedlings to turn negative and degenerate. This problem of positive seedling degeneration results in the failure to obtain true transgenic lilies. In addition to the problem of positive seedling degeneration, the Agrobacterium-mediated method for transforming transgenic lilies is also prone to chimeras, resulting in low genetic transformation efficiency.

[0004] Since the growth cycle of lilies is long, it takes about 10 to 13 months from scale induction to bottle release. The chimera problem and the degeneration of positive seedlings will directly lead to more than a year of waste in transformation work. Therefore, how to ensure that positive seedlings do not degenerate and reduce the amount of chimeras is the key problem that needs to be solved in order to obtain transgenic lilies. Summary of the invention

[0005] In order to solve the problems existing in the prior art, the purpose of the present invention is to provide a method for purifying lily positive seedlings. The present invention utilizes a method for optimizing the sampling site of the receptor material to ensure that the scales induce undifferentiated buds and reduce the probability of chimeras. At the same time, after the tissue culture seedlings are identified as transgenic positive seedlings, the petiole embryonic callus is used to induce seedlings to further purify the positive seedlings, so as to solve the problem of positive seedling degeneration in the Agrobacterium-mediated lily genetic transformation system in the prior art.

[0006] To achieve the above object, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a method for purifying positive lily seedlings, comprising the following steps:

[0008] (1) taking the middle section of 1-2 layers of scales of lily bulb as a receptor material, infecting with Agrobacterium after pre-culturing, transforming with exogenous genes, and identifying positive seedlings after co-cultivation and screening culture to obtain primary lily positive seedlings;

[0009] (2) Taking petioles of primary lily positive seedlings, inoculating them into callus induction medium to induce callus tissue, and then continuing to differentiate and culture the callus tissue to obtain purified lily positive seedlings.

[0010] The lily bulbs are sterile cultured bulbs with a diameter of 0.5-1.5 cm.

[0011] The positive seedling identification is carried out when the leaves of the lily seedlings grow to 2-2.5 cm.

[0012] The culture conditions in the callus induction medium are: culture under natural light at 25±1°C for 20 to 30 days.

[0013] The method of continuing differentiation and culturing the callus tissue to obtain purified lily positive seedlings comprises the following steps:

[0014] (i) transferring the induced callus to a callus differentiation medium, and after adventitious buds are induced from the callus, transferring the callus to a bulblet induction medium, and culturing under normal light to obtain complete lily plants;

[0015] (ii) After the leaves are cut off from intact lily plants that have been subcultured 3 to 4 times, they are transferred to a bulb expansion and rooting medium. When a strong root system grows and the bulb diameter reaches 1.5 to 2 cm, the seedlings are hardened. After the hardening is completed, the lily bulbs are cleaned and soaked in a carbendazim solution, and then planted in peat soil for cultivation to obtain purified lily positive seedlings.

[0016] The culture conditions in the callus differentiation medium are: 25±1° C., a light cycle of 11-12 h / d, and a light intensity of 5300-8000 lux.

[0017] The immersion time in the carbendazim solution is 9-11 minutes.

[0018] The culture conditions in the peat soil are: 18-19° C., 15-16 h light management, and 65-70% humidity.

[0019] The second aspect of the present invention provides the use of the above method for purifying lily positive seedlings in the following (1) or (2):

[0020] (1) Reduce the amount of chimeras in lily genetic transformation;

[0021] (2) Reduce the probability of positive seedling degeneration during lily genetic transformation.

[0022] The lily is Siberian lily.

[0023] The beneficial effects produced by the present invention are:

[0024] The present invention uses the middle section of 1 / 3 of the scale as the receptor material, avoids the interference of differentiated buds, ensures the budding rate, and does not affect the subsequent transformation efficiency. The present invention immediately takes the petiole after the positive seedlings are identified and further purifies the positive seedlings through indirect regeneration, solves the problem of degeneration of the positive seedlings after being taken out of the bottle in the later stage, and further stabilizes the lily genetic transformation system. The method for purifying lily positive seedlings provided by the present invention provides a feasible solution for establishing a stable and efficient genetic transformation system, reducing the probability of chimeras, and preventing the degeneration of positive seedlings, and is of great significance for improving the genetic traits of lilies through genetic engineering technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the process of cultivating transgenic lily; Figure 1 -a is the receptor material of the middle part of the cut scale 1 / 3; Figure 1 -b is the petiole of the cut primary lily positive seedling induced and cultured in callus induction medium; Figure 1 -c is the induction of callus tissue into adventitious buds; Figure 1 -d is a positive lily seedling cultured by transferring adventitious buds.

[0026] Figure 2 It is the result of PCR identification of positive seedlings; among them, Figure 2 -a is the PCR test result using Hyg-F / R primers; Figure 2 -b is the PCR test result using Bar-F / R primers. DETAILED DESCRIPTION

[0027] It should be noted that the following detailed descriptions are illustrative and are intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present application belongs.

[0028] As mentioned above, with the development of modern molecular biology, the use of transgenic technology to overcome the self-incompatibility in traditional breeding and to modify the target traits has become a new means of lily breeding. There are many genetic transformation methods used for lilies. Agrobacterium-mediated method is the most widely used and most efficient transgenic method in the study of lily genetic transformation. In the prior art, when genetic transformation is carried out by Agrobacterium-mediated method, lily scales are used as receptor materials. Since the base of the intact scales contains differentiated buds, chimeras are easily produced after Agrobacterium infection, which affects the efficiency of genetic transformation. In addition, generally, after the positive seedlings are identified in the genetic transformation of lilies, they are directly taken out of the bottle for maintenance. After the positive seedlings are taken out of the bottle, they are free from the inhibition of the screening pressure, and the new leaves are easily lost when they grow positive performance, which greatly increases the research time.

[0029] Based on this, the present invention provides a method for purifying lily positive seedlings. The present invention optimizes the sampling site of the receptor material and selects the middle section of 1 / 3 of the lily scale as the receptor material for callus induction into seedlings, thereby avoiding interference from differentiated buds and ensuring the germination rate, and reducing the probability of chimeras. After the tissue culture seedlings are identified as transgenic positive seedlings, the present invention immediately takes their petioles through indirect regeneration, callus induction into seedlings, and further purifies the positive seedlings, thereby solving the problem of degeneration of the positive seedlings after being taken out of the bottle in the later stage, and providing an innovative idea for the genetic transformation of lilies.

[0030] The following detailed description is for illustrative purposes only and is intended to provide further explanation of the present application, rather than to limit the scope of the present invention.

[0031] The test materials used in the examples of the present invention are all conventional test materials in the art and can be purchased through commercial channels.

[0032] The lily species used in the embodiments of the present invention is Siberian lily;

[0033] The culture medium configuration method involved in the embodiment of the present invention is as follows:

[0034] Pre-culture medium: MS+6-BA 3mg / L+NAA 0.75mg / L+MES2.13g / L+sucrose 30g / L+agar 6g / L+AS200μmol / L;

[0035] Co-culture medium: MS + 3 mg / L 6-BA + 0.75 mg / L NAA + 30 g / L sucrose + 6 g / L agar + 2.13 g / LMES + 200 μmol / L AS, pH = 5.8;

[0036] Screening medium: MS + 6-BA 3 mg / L + NAA 0.75 mg / L + MES 2.13 g / L + sucrose 30 g / L + agar 6 g / L + Cef 300 mg / L + Bialaphos 4 mg / L, pH = 5.8.

[0037] Callus induction medium: MS + 2.0 mg / L PIC + 30 g / L sucrose + 6 g / L agar.

[0038] Callus differentiation medium: MS + 60g / L sucrose + 6g / L agar.

[0039] Bulblet induction medium: MS+6-BA 3mg / L+NAA 0.75mg / L+30g / L sucrose+6g / L agar.

[0040] Bulb enlargement and rooting medium: MS+90g / L sucrose+1mg / L IBA+6g / L agar.

[0041] Example 1: Transformation of 'Siberia' lily with gMS2 gene

[0042] (1) Preparation of receptor materials

[0043] Select the 'Siberia' bulbs with a diameter of 1 cm after sterile culture for 1.5 months, and peel off the middle 1 / 3 of the outer 1-2 layers of scales as the receptor material ( Figure 1 -a), make two cuts on the outer surface of the small scales to make wounds. Inoculate in the pre-culture medium and culture in the dark at 25℃ for 3 days.

[0044] (2) Agrobacterium infection and co-cultivation

[0045] The plasmid pCAMBIA1300 containing the ProMs2::gMS2 gene (NCBI No.: ANW82833.1) was constructed. The vector contained the Hyg and Basta selection genes. The expression vector containing the gMS2 gene was introduced into the Agrobacterium EHA105 bacterial solution. After the recipient material was pre-cultured for 3 days, it was placed in the Agrobacterium EHA105 bacterial solution containing the gMS2 gene (OD 600 =0.6) for 20 min, and after infection, the scales were taken out and the bacterial solution was dried on sterile filter paper. The scales were inoculated into the co-culture medium and co-cultured at 25°C in the dark for 3 days.

[0046] (3) Screening and culture

[0047] After the co-cultivation, the cells were transferred to the screening medium for screening, with subsequent subculture every 25 days.

[0048] (4) Identification of positive seedlings

[0049] The adventitious buds differentiated from different cells were separated and transferred in the screening culture medium until the lily leaves were about 2 cm long for PCR testing to identify positive seedlings.

[0050] The specific steps for positive seedling identification are as follows: design two pairs of primers for the target vector genes Hyg and Basta, respectively, and the primer nucleotide sequences are shown in SEQ ID NO.1-SEQ ID NO.4. Extract the genomic DNA of the leaves of the strains to be identified, numbered S-S1 to S-S39, use the 'Siberia' wild type as a negative control, and the plasmid as a positive control, and use the Hyg gene primers (Hyg-F, Hyg-R) ( Figure 2 -a) and Basta gene primers (Bar-F, Bar-R) ( Figure 2 -b) PCR amplification was performed, and samples with bands from both pairs of primers were positive, and primary lily positive seedlings were obtained ( Figure 2 ).

[0051] SEQ ID NO.1: GGAAGTGCTTGACATTGGGG(Hyg-F);

[0052] SEQ ID NO.2: GTCAGGACATTGTTGGAGCC (Hyg-R);

[0053] SEQ ID NO.3: TACATCGAGACAAGCACGGT(Bar-F);

[0054] SEQ ID NO. 4: CCAGAAACCCACGTCATGC(Bar-R).

[0055] (5) Purification of positive seedlings

[0056] The petiole of the primary lily positive seedlings was cut into small pieces of about 5 mm and inoculated into callus induction medium ( Figure 1 -b), cultured at 25°C in dark conditions, and callus was induced after 25 days.

[0057] The induced callus was transferred to the callus differentiation medium at 25°C, with a photoperiod of 12h / d and a light intensity of 7000lx. Figure 1 -c) Transfer to bulblet induction medium and culture under normal light ( Figure 1 -d).

[0058] After cutting off the leaves of the complete plants that have been subcultured three times, transfer them to the bulb expansion and rooting medium and culture them at 25℃ in shaded conditions. When the seedlings have strong root systems and the bulb diameter reaches 1-2cm, place the tissue culture seedlings in a 4℃ environment for 55 days to break the dormancy of the tissue culture seedlings. After the acclimatization is completed, wash the culture medium on the bulb with tap water, soak it in a carbendazim solution for about 10 minutes, dry it, and plant it in peat soil. The culture temperature is about 18℃, the light management is 16h, and the humidity is 70%, and purified lily positive seedlings are obtained.

[0059] Example 2: Detection of the degeneration rate of positive transgenic lily seedlings and the probability of chimeras

[0060] In order to verify whether the method for purifying lily positive seedlings provided by the present invention can reduce the positive seedling degeneration problem existing in transgenic lilies in the later stage and reduce the probability of chimeras, a comparative example 1 was set up. Compared with the operating steps of gMS2 gene transformation of 'Siberia' lily in Example 1, the only difference between Comparative Example 1 and Example 1 is that the positive seedling purification process is no longer performed after the primary lily positive seedlings are obtained.

[0061] (1) Detection of the degeneration rate of transgenic lily positive seedlings

[0062] Ten purified lily positive seedlings obtained in Example 1 and ten primary lily positive seedlings obtained in Comparative Example 1 were taken respectively and uniformly cultured under the maintenance conditions of a culture temperature of 25° C., a photoperiod of 12 h / d, and a light intensity of 7000 lx. When the old leaves of the purified lily positive seedlings and the primary lily positive seedlings fell off, the bulbs emerged, and the new leaves grew to 2 cm, the leaf genomic DNA was extracted respectively, and PCR detection was performed again. The positive degeneration rates of the transgenic lilies that had undergone the positive seedling purification step and those that had not undergone the positive seedling purification step were calculated according to the degeneration rate = number of degenerated lily positive seedlings / 10×100% (degenerated lily positive seedlings refer to lily plants that no longer contain the target gene gMS2 when PCR detection is performed again).

[0063] The test results showed that the transgenic lilies that had undergone the positive seedling purification step did not show any positive seedling degeneration phenomenon. When the transgenic lilies that had not undergone the positive seedling purification step were subjected to PCR testing again, 3 transgenic lilies that were initially identified as positive no longer contained the target gene gMS2, and the degeneration rate was 30%. The test results showed that after the genetic transformation of the transgenic lilies was identified as positive, the positive seedling purification step was not performed, and the conversion rate was directly taken out of the bottle for maintenance and then tested again, and the positive seedling degeneration phenomenon occurred. The method for purifying lily positive seedlings provided by the present invention can effectively solve the problem of positive degeneration of lily seedlings and stabilize the lily genetic transformation system.

[0064] (2) Probability detection of chimeras in transgenic lily positive seedlings

[0065] Take 10 purified lily positive seedlings obtained in Example 1 and 10 primary lily positive seedlings obtained in Comparative Example 1, and place them under the maintenance conditions of 25°C, 12h / d light cycle, and 7000lx light intensity for 30 days, remove the upper leaves of the lily plants, and place them on a high-concentration seedling medium (i.e., containing 8mg / L Bialaphos) for 60 days, and record the number of dead spheres. According to the chimera probability = number of dead spheres / 10×100%, the chimera probability of transgenic lilies that have undergone the positive seedling purification step and those that have not undergone the positive seedling purification step is calculated.

[0066] The test results show that after the positive seedling purification step, the transgenic lily was placed on a high-concentration seedling medium for 60 days, 1 plant died, 9 plants survived, and the chimera probability = 10%; the transgenic lily that did not undergo the positive seedling purification step was placed on a high-concentration seedling medium for 60 days, 5 plants died, 5 plants survived, and the chimera probability = 50%. The test results show that the method for purifying lily positive seedlings provided by the present invention can effectively reduce the chimera probability in the lily genetic transformation experiment, and has a positive effect on the lily genetic transformation work.

[0067] The above description is only the preferred embodiment of the present application and is not intended to limit the present application. For those skilled in the art, the present application may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A method for purifying lily positive seedlings, It is characterized in that The following steps are involved: (1) taking the middle section of 1 / 3 of the outer 1-2 layers of scales of lily bulb as a receptor material, infecting with Agrobacterium after pre-culturing, transforming with foreign genes, and identifying positive seedlings after co-cultivation and screening culture to obtain primary lily positive seedlings; (2) Taking petioles of primary lily positive seedlings, inoculating them into callus induction medium to induce callus tissue, and then continuing to differentiate and culture the callus tissue to obtain purified lily positive seedlings.

2. The method for purifying lily positive seedlings according to claim 1, It is characterized in that The lily bulb is a sterile cultured bulb with a diameter of 0.5-1.5 cm.

3. The method for purifying lily positive seedlings according to claim 1, It is characterized in that The positive seedling identification is carried out when the leaves of the lily seedlings grow to 2-2.5 cm.

4. The method for purifying lily positive seedlings according to claim 1, It is characterized in that The culture conditions in the callus induction medium are: culture under natural light at 25±1°C for 20 to 30 days.

5. The method for purifying lily positive seedlings according to claim 1, It is characterized in that The method of continuing differentiation and culturing the callus tissue to obtain purified lily positive seedlings comprises the following steps: (i) transferring the induced callus to a callus differentiation medium, and after adventitious buds are induced from the callus, transferring the callus to a bulblet induction medium, and culturing under normal light to obtain complete lily plants; (ii) After the leaves are cut off from intact lily plants that have been subcultured 3 to 4 times, they are transferred to a bulb expansion and rooting medium. When a strong root system grows and the bulb diameter reaches 1.5 to 2 cm, the seedlings are hardened. After the hardening is completed, the lily bulbs are cleaned and soaked in a carbendazim solution, and then planted in peat soil for cultivation to obtain purified lily positive seedlings.

6. The method for purifying lily positive seedlings according to claim 5, It is characterized in that The culture conditions in the callus differentiation medium are: 25±1° C., a light cycle of 11-12 h / d, and a light intensity of 5300-8000 lux.

7. The method for purifying lily positive seedlings according to claim 5, It is characterized in that The immersion time in the carbendazim solution is 9-11 minutes.

8. The method for purifying lily positive seedlings according to claim 5, It is characterized in that The culture conditions in the peat soil are: 18-19° C., 15-16 h light management, and 65-70% humidity.

9. Use of the method for purifying lily positive seedlings according to any one of claims 1 to 8 in the following (1) or (2): (1) Reduce the amount of chimeras in lily genetic transformation; (2) Reduce the probability of positive seedling degeneration during lily genetic transformation.

10. The use according to claim 9, It is characterized in that The lily is Siberian lily.

Images