Application of up-regulated expression BmUMPS gene in improvement of silk yield of bombyx mori and method of up-regulated expression BmUMPS gene

Abstract

The invention discloses an application and a method of up-regulated expression of a BmUMPS gene in improving the silk yield of bombyx mori, and the research finds that a BmUMPS gene overexpression system is obtained by applying a transgenic technology in bombyx mori, and compared with a wild type, the number of silk gland cells, the total cocoon amount, the cocoon shell amount and the cocoon shell rate of a BmUMPS transgenic overexpression system are remarkably improved. According to the BmUMPS gene and the technology for promoting overexpression of the gene, the silk yield of bombyx mori can be increased. The invention provides a new method for increasing the yield of the domestic silkworm cocoon silk, and provides a new strategy for subsequent practical application of increasing the yield of the domestic silkworm cocoon silk by using the gene.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an application and method of up-regulating the expression of BmUMPS gene in improving the silk production of silkworms. Background Art

[0002] The silkworm is a holometabolous insect, classified in the phylum Arthropoda, class Insecta, order Lepidoptera, family Bombyx, genus Bombyx. The silkworm goes through four developmental stages in its life: egg, larva, pupa, and adult. The larval stage is generally divided into five instars, and it needs to go through four molts. The silkworm originated in my country and was domesticated from the wild silkworm in China more than 5,000 years ago. It is an important economic insect and plays an important role in my country's economic and social development and cultural exchanges between China and the West.

[0003] Sericulture is a distinctive industry in my country, and my country's silk production has long been ranked first in the world. Silkworm genetic breeding has a history of more than 100 years. It is the first animal to use hybrid breeding to improve economic traits. Improving silk production has always been the primary goal of breeding work, but traditional breeding technology has been used to the extreme. In the past 30 years, silkworm silk production has not been fundamentally improved. Further improving silkworm silk production requires the use of modern molecular breeding technologies such as transgenics, genome editing, and synthetic biology.

[0004] Transgenic overexpression technology refers to the use of molecular biology and genetic engineering to enhance the expression level of specific genes in organisms, integrate the target gene into a suitable vector, and introduce the vector into cells to express the gene in large quantities in the cells. Transgenic technology is a common method of modern breeding technology, which can utilize excellent genes to improve economic traits.

[0005] According to the analysis, the expression level of the silkworm BmUMPS gene (Bombyx mori uridine 5'-monophosphate synthase) is higher in the egg stage, lower in the larval stage, and highest in the 24h embryonic stage. The present invention uses transgenic technology to construct a BmUMPS gene overexpression system to increase the expression of the gene, aiming to explore its correlation with silkworm cocoon yield. Summary of the invention

[0006] In view of this, one of the objects of the present invention is to provide an application of up-regulating the expression of BmUMPS gene in improving the silk production of silkworms; the second object of the present invention is to provide a method for improving the silk production of silkworms.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] 1. Application of up-regulated expression of BmUMPS gene in improving silk production of silkworms, wherein the amino acid sequence of the protein encoded by the BmUMPS gene is shown in SEQ ID NO.2, and the silk production includes the total cocoon amount, the cocoon layer amount and the cocoon layer rate.

[0009] In some embodiments of the present invention, the nucleotide sequence of the BmUMPS gene is shown as SEQ ID NO.1.

[0010] 2. A method for increasing silk production by silkworms, the method comprising the following steps: upregulating the expression or activity of the BmUMPS gene in the silkworm, the nucleotide sequence of the BmUMPS gene being as shown in SEQ ID NO.1, and the silk production amount including the total cocoon amount, the cocoon layer amount and the cocoon layer rate.

[0011] In some embodiments of the present invention, the method for up-regulating the expression or activity of the BmUMPS gene in the silkworm comprises: administering an agent containing an agent that enhances the transcription, translation or function of the BmUMPS gene in the silkworm.

[0012] In some embodiments of the present invention, the method for up-regulating the expression or activity of the BmUMPS gene in the silkworm comprises: utilizing transgenic technology to increase the expression level of the BmUMPS gene in the silkworm.

[0013] In some embodiments of the present invention, the specific operation steps of the transgenic technology are: connecting the correctly sequenced IE1-BmUMPS-SV40 gene fragment to the pBac[3xP3-EGFPafm] vector to obtain an overexpression vector, and then injecting the overexpression vector into silkworm eggs to screen out transgenic silkworms with high cocoon silk yield.

[0014] The beneficial effect of the present invention is that the present invention can increase the number of silk gland cells of silkworms, increase the total cocoon quantity, cocoon layer quantity and cocoon layer rate of silk by increasing the expression of BmUMPS gene. This invention provides a new entry point for practical applications with the goal of increasing the silkworm cocoon silk yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:

[0016] Figure 1 This is the expression profile of the BmUMPS gene during the same period.

[0017] Figure 2 This is the map of the intermediate vector of psl1180[IE1-BmUMPS-SV40].

[0018] Figure 3 Schematic diagram of the BmUMPS gene overexpression vector.

[0019] Figure 4 Comparison of BmUMPS gene expression levels and cocoon morphology between wild type and overexpression line.

[0020] Figure 5 The total cocoon amount (A), cocoon layer amount (B) and cocoon layer rate (C) of 50 silkworms of both sexes of the wild type and overexpression lines were investigated for the G2 generation.

[0021] Figure 6 Analysis of changes in the number of silk gland cells in the BmUMPS gene overexpression system; Figure A: Silk gland cells were stained with DAPI; Figure B: Statistics of the number of silk gland cells. DETAILED DESCRIPTION

[0022] The present invention is further described below in conjunction with the accompanying drawings and specific examples so that those skilled in the art can better understand the present invention and implement it, but the examples are not intended to limit the present invention. The experimental methods in the examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in Molecular Cloning Laboratory Manual (3rd edition, by J. Sambrook et al.), or according to the conditions recommended by the manufacturer.

[0023] Example 1. Overexpression of the BmUMPS gene in silkworm eggs

[0024] (1) Construction of BmUMPS gene expression profile

[0025] The wild type (Da Zao) was taken at 0h, 3h, 6h, 9h, 12h, 15h, 18h, 21h, 24h, 48h, 72h, 96h, 120h, 144h, 168h, 192h, 216h after laying eggs, larval stage 1st instar 0h, 1st instar dormant, 2nd instar 0h, 2nd instar dormant, 3rd instar 0h, 3rd instar dormant, 4th instar 0h, 4th instar 1 day, 4th instar 2 days, 4th instar 3 days, 4th instar dormant, 5th instar 0h, 5th instar 1 day, 5th instar 2 days, 5th instar 3 days, 5th instar 4 days, 5th instar 5 days, 5th instar 6 days, wandering period (wandering), pre-pupa period (pre-pupa), pupa (pupa) 1 day materials, and quantitative PCR experiments were performed to detect the expression level of BmUMPS genes and construct the period expression profile of BmUMPS genes. The nucleotide sequence of the BmUMPS gene in Bombyx mori is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0026] Based on the BmUMPS gene, the fluorescent quantitative primers and the internal reference gene (sw22934) primers shown in Table 1 were synthesized by Qingke Biotechnology.

[0027] Table 1 Fluorescence quantitative primers and internal reference primers

[0028] qPCR-BmUMPS-F CGGTGAAGGCATATTGAAGG(SEQ ID NO.3) qPCR-BmUMPS-R TCCGGTTATGATGTTTGCAT(SEQ ID NO.4) SW22934-F TTCGTACTGCTCTTCTCGT(SEQ ID NO.5) SW22934-R CAAAGTTGATAGCAATTCCCT(SEQ ID NO.6)

[0029] The results are as follows Figure 1 As shown, the expression level of BmUMPS gene is higher in the egg stage (i.e., embryonic stage), and lower in the larval stage, with the highest expression level at 18h in the egg stage.

[0030] (2) Cloning of the BmUMPS gene

[0031] According to the gene expression profile, the cDNA of the embryonic period with high expression level was selected as the template, and the target fragment was amplified using the PrimeSTAR GXL DNA Polymeras reagent produced by Takara. According to the BmUMPS gene, the amplification primers shown in Table 2 were synthesized by Qingke Biotechnology.

[0032] Table 2 Primers for BmUMPS gene amplification

[0033] BmUMPS-F CTCAGCAGACCTCACCATGA(SEQ ID NO.7) BmUMPS-R CCCTGCCTATTTCTGCCATA(SEQ ID NO.8)

[0034] Recover the target DNA fragment (Roche gel recovery kit). Connect the above-mentioned recovery product to the PEASY-BluntZero vector, transform, and perform bacterial liquid PCR detection using the above-mentioned bacterial liquid as a template and the universal primer M13 on the PEASY-Blunt Zero vector to perform bacterial liquid PCR to detect whether the target band is cloned into the PEASY-Blunt Zero vector. After the PCR is completed, perform electrophoresis detection, and send the bacterial liquid with the correct band size to Qingke Bio for sequencing.

[0035] Table 3 Bacterial liquid detection primers

[0036] M13-F CAGGAAACAGCTATGAC(SEQ ID NO.9) M13-R GTAAAACGACGGCCAGT(SEQ ID NO.10)

[0037] (3) Preparation of psl1180[IE1-MCS-SV40] intermediate vector

[0038] The transcription activator IE1 and the termination signal SV40 were connected to the pSLfa1180fa vector. The downstream restriction site of the transcription activator IE1 was BamHI, and the upstream restriction site of the termination signal SV40 was NotⅠ, and the psl1180[IE1-MCS-SV40] intermediate vector was obtained, such as Figure 2 shown.

[0039] (4) Homologous recombination into psl1180[IE1-MCS-SV40] vector

[0040] Amplify BamHI homology arm + target gene + NotⅠ homology arm.

[0041] Enter the target gene sequence and the psl1180[IE1-MCS-SV40] intermediate vector sequence in the EasyGeno primer design on the official website of Tiangen Biochemical Technology (Beijing) Co., Ltd., select the BamHⅠ and NotⅠ double restriction method, and obtain primers with BamHⅠ and NotⅠ homology arms. Use the positive bacterial solution of the target gene successfully cloned into the PEASY-Blunt Zero vector as a template and primers with BamHⅠ and NotⅠ homology arms to amplify the target fragment.

[0042] The psl1180[IE1-MCS-SV40] intermediate vector was digested with restriction enzymes, and the target fragment with homology arms and the linear vector after digestion were recovered by gel.

[0043] The target fragment was homologously recombined with the linear vector to obtain the psl1180[IE1-BmUMPS-SV40] intermediate vector, which was then connected, transformed, and tested by bacterial solution PCR. The above bacterial solution was used as a template and the universal primer M13 on the psl1180 vector was used to perform bacterial solution PCR to detect whether the target band was homologously recombined into the psl1180[IE1-BmUMPS-SV40] vector.

[0044] (5) Homologous recombination into pBac[3xP3-EGFPafm] vector

[0045] The pBac[3xP3-EGFPafm] vector was sent to Qingke Company for testing. The sequence was input into SnapGene, which showed that there was a BglⅡ restriction site in the vector.

[0046] Enter IE1+target fragment+SV40 sequence and pBac[3xP3-EGFPafm] vector sequence in the EasyGeno primer design on the official website of Tiangen Biochemical Technology (Beijing) Co., Ltd., select BglⅡ single enzyme digestion method, and obtain primers with IEⅠ and SV40 homology arms.

[0047] Table 4 Primers with IEⅠ and SV40 homology arms

[0048]

[0049] The bacterial solution on the psl1180[IE1-BmUMPS-SV40] vector that successfully underwent homologous recombination was used as a template, and primers containing IE1 and SV40 homologous arms were used to amplify the IE1-BmUMPS-SV40 fragment.

[0050] The pBac[3xP3-EGFPafm] vector was digested with enzymes, and the IE1-BmUMPS-SV40 fragment and the pBac[3xP3-EGFPafm] linear vector after digestion were recovered by gel. The IE1-BmUMPS-SV40 fragment and the pBac[3xP3-EGFPafm] linear vector were homologously recombined, connected, and transformed. Primers (PB) were designed at both ends of the BglⅡ restriction site on the pBac[3xP3-EGFPafm] vector. The above bacterial solution was used as a template for PCR to detect whether the sequence between the IE1 promoter and the SV40 terminator was homologously recombined into the pBac[3xP3-EGFPafm] vector. After the PCR was completed, electrophoresis was performed, and the bacterial solution with the correct band size was sent to Qingke Bio for sequencing. The successfully constructed overexpression vector PiggyBac[3xP3-EGFP-SV40, IE1-BmUMPS-SV40] is shown in Figure 3 As shown, EGFP is enhanced green fluorescent protein, which is used to screen positive individuals. The promoter of green fluorescent protein is 3xP3 promoter, the termination sequence is SV40, the promoter of BmUMPS gene is IE1 promoter, and the SV40 sequence is the termination sequence of BmUMPS gene.

[0051] Table 5 PiggyBac vector primers

[0052] PB-F CCCGACAACCACTACCTGAG(SEQ ID NO.13) PB-R TGAAGATGACGTCCAGAGCG(SEQ ID NO.14)

[0053] Extract ultrapure plasmids, microinject overexpression vectors and screen positive individuals. The PiggyBac vector contains the 3P3 promoter and EGFP gene, which will produce green fluorescence specifically in the eye, and can be screened using a stereo fluorescence microscope. After the G1 generation of ant silkworms hatch, use a stereo fluorescence microscope to screen positive individuals to obtain the BmUMPS gene overexpression strain.

[0054] After the silkworm eggs were injected, the silk gland cells of the silkworms were counted, and the silkworm eggs of the wild type and the BmUMPS gene overexpression strain were released from diapause by immediate acid immersion. The silkworm eggs were placed in an incubator at 25°C to accelerate greening. After the silkworms hatched, the silk glands were removed and counted. Figure 6 As shown, the average silk gland cell number of the wild type is 917, and the average silk gland cell number of the overexpression line is 973. The number of silk gland cells in the BmUMPS overexpression line is significantly increased compared with the wild type.

[0055] After primer detection Green Pro Taq HS premixed qPCR reagent was used to conduct quantitative experiments, evaluate data, and analyze and plot. Figure 4 As shown, the expression of BmUMPS in the overexpression line was significantly increased, and the cocoons of the overexpression line were significantly larger than those of the wild type.

[0056] (5) G2 generation The total cocoon weight (CW), cocoon layer weight (CSW) and cocoon layer rate (CSR) of 50 wild-type and overexpression silkworms of both sexes were investigated, and the results were given in Table 6 below.

[0057] Table 6 Average values ​​of total cocoon quantity, cocoon layer quantity and cocoon layer rate

[0058]

[0059] The statistical results are as follows Figure 5 As shown: The total cocoon weight (CW), cocoon layer weight (CSW) and cocoon layer rate (CSR) of male and female overexpression lines were higher than those of wild type. Compared with the wild type, the total cocoon weight (CW) of the overexpression line increased by 6.96% in females and 2.71% in males; the cocoon layer weight (CSW) increased by 17.27% in females and 11% in males; the cocoon layer rate (CSR) increased by 10.19% in females and 7.37% in males. The total cocoon weight, cocoon layer weight and cocoon layer rate of male and female overexpression lines were higher than those of wild type.

[0060] In the embodiment of the present invention, transgenic technology is used to up-regulate the expression of the BmUMPS gene. It is well known to those skilled in the art that any means that can up-regulate the expression of the BmUMPS gene can achieve the purpose of the present invention. It should be understood by those skilled in the art that various modifications can be made to the present invention without departing from the scope defined by the claims of the present invention.

[0061] The above-described embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. Application of up-regulating the expression of BmUMPS gene in increasing silk production in silkworms, It is characterized in that The amino acid sequence of the protein encoded by the BmUMPS gene is shown in SEQ ID NO.2, and the silk production amount includes the total cocoon amount, the cocoon layer amount and the cocoon layer rate.

2. The use according to claim 2, It is characterized in that The nucleotide sequence of the BmUMPS gene is shown in SEQ ID NO.

1.

3. A method for increasing silk production by silkworms, It is characterized in that The method comprises the following steps: up-regulating the expression or activity of the BmUMPS gene in the silkworm, the nucleotide sequence of the BmUMPS gene is shown in SEQ ID NO.1, and the silk production of the silkworm includes the total cocoon amount, the cocoon layer amount and the cocoon layer rate.

4. The method according to claim 3, It is characterized in that The method for up-regulating the expression or activity of the BmUMPS gene in the silkworm comprises: administering a reagent containing a substance that enhances the transcription, translation or function of the BmUMPS gene in the silkworm.

5. The method according to claim 3, It is characterized in that The method for up-regulating the expression or activity of the BmUMPS gene in the silkworm comprises: utilizing transgenic technology to increase the expression level of the BmUMPS gene in the silkworm.

6. The method according to claim 5, It is characterized in that The specific operation steps of the transgenic technology are: connecting the correctly sequenced IE1-BmUMPS-SV40 gene fragment to the pBac[3xP3-EGFPafm] vector to obtain an overexpression vector, and then injecting the overexpression vector into silkworm eggs to screen out transgenic silkworms with high cocoon silk yield.

Images