KASP primer group for detecting peanut net blotch resistance molecular marker and application of KASP primer group

Abstract

The invention discloses a peanut net blotch resistant KASP molecular marker primer group and application, the molecular marker is located at the SNP site of the 12966357 site of the No.16 chromosome of peanut and the 51828217 site of the No.13 chromosome of peanut, the KASP primer group is designed according to the sequences of 100bp before and after the two molecular marker sites, and the KASP molecular marker of the sites is developed based on the wild type and mutant type sequences of candidate genes. The base polymorphisms of the two sites are G / C. The KASP molecular marker can be used for genotype detection of peanut materials and judgment of whether the materials have net blotch resistance or not, through high-throughput genotyping detection, manpower and material resources are saved, the KASP molecular marker is not affected by environmental factors, the result is accurate and reliable, the KASP molecular marker can be used for early screening of peanut net blotch resistant varieties, the breeding period can be shortened, and the breeding efficiency can be improved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a KASP primer set for detecting a peanut web blotch resistance molecular marker and an application thereof. Background Art

[0002] Peanut (Arachis hypogaea L.) is an important oil crop, which is widely planted around the world and plays an important role in my country's agricultural production. Peanut web blotch is an important peanut disease. In production, peanut web blotch often appears together with brown spot and black spot. The disease usually starts to occur during the flowering period, and its peak period is from the pod-setting period to the maturity period. The lesions first appear on the leaves at the bottom of the plant, and appear as gray-brown needle-shaped dots in the early stage. Then they expand outward in a radial form, and the color gradually changes from gray-brown to black-brown. When the disease is severe, it will cause a large number of leaves to fall off, while damaging the petioles and stems, seriously affecting the yield and quality of peanuts. It is estimated that the disease can cause a 10% to 20% reduction in peanut production, and in severe cases it can reach 30%, causing huge losses to peanut production.

[0003] Although traditional pesticide control methods have certain effects, they are costly and may lead to pesticide residues, which in turn reduces the quality of peanuts and may cause environmental pollution. Currently, the most economical and effective control measure is to breed resistant peanut varieties. Therefore, developing and screening molecular markers linked to the peanut net blotch resistance gene for disease resistance detection in different peanut varieties (lines) can provide important technical support for the identification of peanut net blotch resistance and the breeding of disease-resistant varieties. Summary of the invention

[0004] In view of the problems existing in the prior art, the present application provides a KASP primer set for detecting molecular markers of peanut web blotch resistance, and also provides a method for detecting peanut web blotch resistance using the KASP primer set, providing technical support for early identification of web blotch resistance.

[0005] The technical solution of the present invention:

[0006] 1. A KASP molecular marker primer set for detecting peanut web blotch resistance, comprising: upstream primer 1, upstream primer 2 and downstream primer 3 of molecular marker Chr.16.12966357; upstream primer 4, upstream primer 5 and downstream primer 6 of molecular marker Chr.13.51828217;

[0007] Upstream Primer 1:

[0008] GAAGGTGACCAAGTTCATGCTTACACACCAGTTCAACACATGCC(SEQ ID NO.1)

[0009] Upstream Primer 2:

[0010] GAAGGTCGGAGTCAACGGATTTACACACCAGTTCAACACATGCG(SEQ ID NO.2)

[0011] Downstream primer 3: TGTGTTGCGAGCCATTGCAATTGTG (SEQ ID NO. 3)

[0012] Upstream primer 4:

[0013] GAAGGTGACCAAGTTCATGCTTTACCTGGAACATAACGGGTACC(SEQ ID NO.4)

[0014] Upstream primer 5:

[0015] GAAGGTCGGAGTCAACGGATTTTACCTGGAACATAACGGGTACG(SEQ ID NO.5)

[0016] Downstream primer 6: CATATGTATATTTTCCGCATAAAATACTTA (SEQ ID NO. 6).

[0017] The KASP molecular markers include SNP sites Chr.16.12966357 and SNP sites Chr.13.51828217,

[0018] The SNP site Chr.16.12966357 is located on chromosome 16 of peanut. The mutation site is G / C. The sequences of 100 bp before and after the mutation site are: TGCATTAAGGGAATATTGTGTGCACTGTGCTTATCTCTTTAA TATTTGATTCAGTGATTTGTGTGTTGCGAGCCATTGCAATTGTGGGGTTGTAATTTAG (SEQ ID NO.7).

[0019] GCATGTGTTGAACTGGTGTGTACATTAGTTGACCAAGCCGGTATTAATGAATTTTGTG GAAGCTACTAAATACTAATGTCTAATGCAACTCATGTGGACAA (SEQ ID NO. 8);

[0020] The SNP site Chr.13.51828217 is located on chromosome 13 of peanut. The mutation site is G / C. The sequences of 100 bp before and after the mutation site are:

[0021] ACATGAATTCACCAATTAGATAGCGTATCGCATACCAATTCATCTGCATATATACCAGAA CGTCATATGTATATTTTCCGCATAAAATACTTACATATGG (SEQ ID NO. 9);

[0022] GTACCCGTTATGTTCCAGGTAACTGGCTTGGAATGAGGAACAGAACACTAGGTTT GTGTACTCACCGTACTATTTCTTTCTTTAAGTTGATGACTCCCTA (SEQ ID NO. 10).

[0023] 2. A detection reagent or kit for the KASP molecular marker primer set.

[0024] 3. The method for detecting peanut web blotch resistance using the KASP molecular marker primer set is to extract DNA of the peanut material to be identified, and perform PCR identification using the molecular marker KASP primer set. When the genotype of the SNP sites Chr.16.12966357 and Chr.13.51828217 is GG, the peanut material to be identified is disease resistant.

[0025] The PCR reaction program is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing / extension at 55-61°C for 60 s, decreasing 0.6°C in each cycle, 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, 26 cycles.

[0026] 4. Application of the KASP molecular marker primer set in breeding peanut varieties resistant to net blotch disease.

[0027] Beneficial Effects of the Invention

[0028] The KASP molecular marker primer set and detection method for peanut web blotch resistance of the present invention are suitable for detecting most peanut web blotch resistance and have important significance in peanut breeding practice.

[0029] (1) The molecular markers of the present invention linked to the net blotch resistance trait of peanuts are located by constructing a genetic segregation population by hybridizing net blotch resistance peanuts with susceptible peanut materials, and stably inherited net blotch resistance materials are obtained by detection using the above markers.

[0030] (2) The molecular marker linked to the net blotch resistance trait of the present invention can be used to detect the genotype of peanuts, and then determine whether the material has net blotch resistance. Through high-throughput genotyping detection, manpower and material resources can be greatly saved. The detection is not affected by environmental factors, and the results are accurate and reliable. It can be used for early screening of peanut net blotch resistance varieties, which can shorten the breeding period and improve breeding efficiency.

[0031] (3) The KASP molecular markers Chr.16.12966357 and Chr.13.51828217 of the present invention can be used for the breeding of peanut germplasm resistant to net blotch disease, accurately perform genotyping on the peanut net blotch disease trait, and can be applied to the screening of germplasm resistant to net blotch disease and assist peanut molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 It is the chromosomal region of 11 recombinant individuals on chromosome 16;

[0033] Figure 2 It is the chromosomal region of 11 recombinant individuals on chromosome 13;

[0034] Figure 3 Genotyping of the RIL population for markers Chr.16.12966357 and Chr.13.51828217;

[0035] Figure 4 Box plot of the net blotch disease index of 353 natural accessions marked with Chr.16.12966357 and Chr.13.51828217, respectively. DETAILED DESCRIPTION

[0036] The present invention is further described in detail below in conjunction with specific embodiments. Unless otherwise specified, the materials and reagents used in the examples are all obtained from commercial sources, and the methods used are all conventional methods.

[0037] The YY187 strain was provided by the Institute of Plant Protection, Henan Academy of Agricultural Sciences.

[0038] Example 1. Development of KASP molecular markers Chr.16.12966357 and Chr.13.51828217 tightly linked to peanut net blotch resistance

[0039] 1. Indoor identification of net spot disease resistance of RIL population

[0040] By crossing Jinong 99 and Yuhua 22 as parents, the F2 generation was obtained and then advanced to the next generation through single seed transmission, and finally a peanut RIL population containing 444 families was obtained. On the basis of accurate resistance identification of individual plants in the RIL population, 30 highly resistant plants and 30 highly susceptible plants were selected by bulk segregant analysis (BSA), and the genomic DNA of their young leaves was extracted using a DNA extraction kit, as shown in the following steps.

[0041] 2. Extraction of DNA from Peanut Population

[0042] 0.1 g of young peanut leaves were collected and peanut DNA was extracted using Tiangen Extraction Kit (model: DP305). The specific extraction method was referred to the operating instructions of the kit.

[0043] 3. Identification of the Net Blotch Resistance Phenotype in Peanut Populations

[0044] ① Activation and cultivation of strains before inoculation: Take out the YY187 strain from the -80℃ refrigerator, place it on the PDA medium, and activate and culture it at 25℃ for 5-10 days. Then transfer the activated mycelium to the OA medium and culture it in the dark at 25℃ for 10-15 days until conidia are produced. Transfer the conidia to the new OA medium for propagation and cultivation. After a large number of conidia are produced, filter them with sterile multi-layer gauze and adjust the concentration of the spore suspension to 2×10 6 spores / mL.

[0045] ②Inoculation: When the peanut plants grow to the 6-8 leaf stage, mark the ropes on the unfolded top leaves, and then evenly inoculate 5 mL of conidia suspension on the surface of each leaf. After inoculation, cover the plants with plastic film to keep them moist. After 48 hours of dark culture, remove the film and culture them under normal light, i.e. 16 hours of light / 8 hours of darkness, culture temperature 25°C, humidity 85%. All inoculation tests were repeated at least 3 times, and 12 plants were inoculated in each family. On the 14th day after inoculation, take the three leaves under the marked leaves on all plants (the third leaf from the marked leaves on the main stem), and conduct a symptom classification survey and disease index statistical analysis.

[0046] ③Disease classification: The disease is classified according to the area of ​​the lesion. The disease classification corresponding to the lesion area is as follows:

[0047] No lesions are recorded as level 0; 0%<lesion area ≤1% is recorded as level 1; 1%<lesion area ≤3% is recorded as level 2; 3%<lesion area ≤5% is recorded as level 3; 5%<lesion area ≤7% is recorded as level 4; 7%<lesion area ≤10% is recorded as level 5; 10%<lesion area ≤15% is recorded as level 6; 15%<lesion area ≤18% is recorded as level 7; 18%<lesion area ≤20% is recorded as level 8; and lesion area>20% is recorded as level 9.

[0048] In order to evaluate the disease resistance of different varieties, the relative disease resistance index was used.

[0049] The specific standards are as follows: immune (I, index is 1.0); high resistance (HR, disease resistance index is between 0.80-0.99); disease resistance (R, disease resistance index is between 0.60-0.79); moderate resistance (MR, disease resistance index is between 0.40-0.59); susceptible (S, disease resistance index is between 0.20-0.39); highly susceptible (HS, disease resistance index is less than 0.20).

[0050] The calculation formulas for the disease index and relative disease resistance index are as follows:

[0051] Disease index = Σ(number of diseased leaves at each level × corresponding disease level value) / (total number of leaves surveyed × highest disease level value) × 100

[0052] Relative disease resistance index = 1-(disease index of identified varieties / disease index of the most susceptible variety)

[0053] 4. BSA-Seq sequencing analysis

[0054] According to the results of RIL population resistance identification, 30 highly resistant and 30 highly susceptible plants were selected to construct disease-resistant and disease-susceptible pools, respectively. In order to obtain QTLs closely related to resistance to net blotch, BSA-Seq sequencing analysis was further performed on four samples, including Jinong 99, Yuhua 22, and the disease-resistant and disease-susceptible pools.

[0055] 5. Development of SNP molecular markers tightly linked to net spot disease resistance

[0056] The BSA-Seq data were used for whole-genome SNP identification, calculation of genotype frequency difference between mixed pools (Δ(SNP-index)), and association analysis using Euclidean distance and Fisher's exact test. Sixteen candidate QTL intervals associated with net blotch resistance were located on chromosomes 1, 3, 5, 6, 13, 15, and 16.

[0057] A series of SNP sites were further screened based on the SNP data in the associated region, and corresponding KASP markers were developed. The successfully developed KASP markers were used to perform genotyping on 444 families in the RIL population, and a genetic linkage map was constructed using the QTL IciMapping software. Combined with the phenotypic identification results of the RIL population, the QTL for net blotch resistance was located, and finally a QTL was detected on chromosomes 13 and 16 respectively.

[0058] The QTL on chromosome 13 was located between markers Chr.13.50751192 and Chr.13.52100203, with a LOD value of 7.04, explaining 7.48% of the phenotypic variation; a candidate interval for net blotch resistance was obtained between markers Chr.13.50751192 and Chr.13.52100203, with a size of 1.35Mb.

[0059] The QTL on chromosome 16 was located between markers Chr.16.1296635 and Chr.16.13041784, with a LOD value of 13.12, explaining 15.44% of the phenotypic variation.

[0060] Using the flanking markers Chr.16.12447069 and Chr.16.13614536 of the candidate interval on chromosome 16, all the individuals in the RIL population derived from the hybridization of Jinong 99 and Yuhua 22 were detected, and 11 recombinant individuals were screened, namely RIL-WG742, RIL-WG743, RIL-WG467, RIL-WG705, RIL-WG389, RIL-WG718, RIL-WG331, RIL-WG504, RIL-WG636, RIL-WG654, and RIL-WG660.

[0061] The 11 recombinant strains were further genotyped using 8 groups of KASP markers within the interval of Chr.16.12447069 and Chr.16.13614536 (Table 1). Linkage analysis revealed that the recombinant strains RIL-WG331 and RIL-WG504 had exchange phenomena in the chromosome region between markers Chr.16.12966357 and Chr.16.13041784; RIL-WG705 had exchange phenomena in the chromosome region between Chr.16.12872635 and Chr.16.12966357, and was homozygous in the chromosome region between Chr.16.12966357 and Chr.16.13041784;

[0062] RIL-WG636 and RIL-WG654 exchanged in the chromosomal region between Chr.16.12872635 and Chr.16.12966357, and were homozygous in the chromosomal region between Chr.16.12966357 and Chr.16.13041784 ( Figure 1 ). From the above analysis, it can be concluded that marker Chr.16.12966357 co-segregates with net blotch resistance.

[0063] Table 1 Eight SNP markers developed near the disease resistance association interval on chromosome 16

[0064]

[0065] We continued to encrypt markers within the target interval of chromosome 13, and finally successfully developed two KASP markers within the candidate interval of chromosome 13: Chr.13.51759417 and Chr.13.51828217.

[0066] Using the flanking markers Chr.13.42196092 and Chr.13.54733271 of the candidate interval on chromosome 13, all the individuals in the RIL population derived from the hybridization of Jinong 99 and Yuhua 22 were detected, and 11 recombinant individuals were screened: L-WG358, RIL-WG470, RIL-WG530, RIL-WG441, RIL-WG415, RIL-WG507, RIL-WG517, RIL-WG675, RIL-WG456, RIL-WG583, and RIL-WG390.

[0067] Further, 10 groups of KASP markers (Table 2) within the interval between Chr.13.42196092 and Chr.13.54733271 on chromosome 13 were used to genotype the 11 recombinant strains. Linkage analysis revealed that the recombinant strain WG470, which was consistent with the parent YH22 (susceptible) phenotype, had a fragment exchange in the chromosome region between markers Chr.13.5210203 and Chr.13.5268771, and the chromosome region between Chr.13.51828217 and Chr.13.52100203 was a homozygous region; it was consistent with the parent JN99 (resistant) phenotype. The recombinant strain WG530 had a fragment exchange in the chromosome region between Chr.13.51759417 and Chr.13.51828217, and a homozygous region between Chr.13.51828217 and Chr.13.52100203; the recombinant strain WG456, which was consistent with the parent YH22 (susceptible) phenotype, had a fragment exchange in the chromosome region between markers Chr.13.51759417 and Chr.13.51828217, and a homozygous region between Chr.13.51828217 and Chr.13.52100203 ( Figure 2 ). Therefore, the above analysis showed that marker Chr.13.51828217 co-segregated with net blotch resistance.

[0068] Table 2 Ten SNP markers developed near the disease resistance association interval on chromosome 13

[0069]

[0070] Thus, the SNP site Chr.16.12966357 on peanut chromosome 16 and the SNP site Chr.13.51828217 on peanut chromosome 13 were obtained.

[0071] The primers for the molecular marker SNP sites Chr.16.12966357 and Chr.13.51828217 each include two upstream primers and one downstream primer.

[0072] Primers for SNP site Chr.16.12966357 include:

[0073] (1) Sequence of upstream primer Chr.16.12966357-FAM:

[0074] 5'-gaaggtgaccaagttcatgctTACACACCAGTTCAACACATGCC-3' (SEQ ID NO. 1),

[0075] The lowercase letters are the universal tag sequences corresponding to FAM fluorescence;

[0076] (2) Sequence of upstream primer Chr.16.12966357-HEX:

[0077] 5'-gaaggtcggagtcaacggattTACACACCAGTTCAACACATGCG-3' (SEQ ID NO. 2), wherein the lowercase letters are the universal tag sequence corresponding to HEX fluorescence;

[0078] (3) Sequence of downstream primer Chr.16.12966357-Com:

[0079] 5'-TGTGTTGCGAGCCATTGCAATTGTG-3' (SEQ ID NO. 3).

[0080] Primers for SNP site Chr.13.51828217 include:

[0081] (1) Sequence of upstream primer Chr.13.51828217-FAM:

[0082] 5'-gaaggtgaccaagttcatgctTTACCTGGAACATAACGGGTACC-3' (SEQ ID NO. 4), wherein the lowercase letters are the universal tag sequence corresponding to FAM fluorescence;

[0083] (2) Sequence of upstream primer Chr.13.51828217-HEX:

[0084] 5'-gaaggtcggagtcaacggattTTACCTGGAACATAACGGGTACG-3' (SEQ ID NO. 5), wherein the lowercase letters are the universal tag sequence corresponding to HEX fluorescence;

[0085] (3) Sequence of downstream primer Chr.13.51828217-Com:

[0086] 5'-CATATGTATATTTTCCCGCATAAAATACTTA-3' (SEQ ID NO. 6).

[0087] The SNP site Chr.16.12966357 is located on chromosome 16 of peanut. The mutation site is G / C. The sequences of 100 bp before and after the mutation site are: TGCATTAAGGGAATATTGTGTGCACTGTGCTTATCTCTTTAA TATTTGATTCAGTGATTTGTGTGTTGCGAGCCATTGCAATTGTGGGGTTGTAATTTAG (SEQ ID NO.7).

[0088] GCATGTGTTGAACTGGTGTGTACATTAGTTGACCAAGCCGGTATTAATGAATTTTG TGGAAGCTACTAAATACTAATGTCTAATGCAACTCATGTGGACAA (SEQ ID NO. 8);

[0089] The SNP site Chr.13.51828217 is located on chromosome 13 of peanut. The mutation site is G / C. The sequences of 100 bp before and after the mutation site are:

[0090] ACATGAATTCACCAATTAGATAGCGTATCGCATACCAATTCATCTGCATATATACCAGAA CGTCATATGTATATTTTCCGCATAAAATACTTACATATGG (SEQ ID NO. 9);

[0091] GTACCCGTTATGTTCCAGGTAACTGGCTTGGAATGAGGAACAGAACACTAGGTTT GTGTACTCACCGTACTATTTCTTTCTTTAAGTTGATGACTCCCTA (SEQ ID NO. 10).

[0092] PCR amplification system: 2 μL of DNA with a concentration of 100 ng / μL, 1 μL of 1×PARMS PCR Mix, and 1 μL of Primer Mix; the Primer Mix includes upstream primers and downstream primers, and the concentrations of the two upstream primers are both 400 nM; the concentration of the downstream primer is 150 nM.

[0093] The PCR amplification program was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing / extension at 55-61°C for 60 s, decreasing 0.6°C in each cycle, for 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for 26 cycles.

[0094] High-throughput genotyping was performed using the SNP Line typing platform (LGC, UK), and SNP viewer software was used to perform genotyping and data analysis on PCR products.

[0095] During detection, if the homozygous disease-resistant signal is blue on the typing chart, the output result is HEX; if the homozygous disease-susceptible signal is red on the typing chart, the output result is FAM; and the heterozygous disease-resistant signal is green on the typing chart, the output result is FAM HEX.

[0096] Using the primers obtained, genotyping of 444 RIL families derived from Jinong 99, Yuhua 22 and their hybrids was performed according to the PCR amplification reaction system and amplification procedure described above. The typing results are as follows: Figure 3 shown.

[0097] Figure 3 In the figure, A and B are the genotyping of the RIL population by markers Chr.16.12966357 and Chr.13.51828217, respectively; the black dots close to the origin represent the blank control without template DNA; the red dots close to the Y-axis and the blue dots close to the X-axis represent the families carrying the C allele mutation site and the families carrying the G allele mutation site, respectively.

[0098] The horizontal axis represents the HEX fluorescence signal value, and the vertical axis represents the FAM fluorescence signal value.

[0099] Determine the genotype of the Chr.16.12966357 and Chr.13.51828217 sites of the peanut genome to be tested, that is, detect whether the 12966357 base of chromosome 16 and the 51828217 base of chromosome 13 of the peanut genome are G or C.

[0100] If the fluorescence signal value of the peanut amplification product to be tested is close to the horizontal axis, and the fluorescence reading is blue (HEX signal), the genotypes of the Chr.16.12966357 and Chr.13.51828217 sites in the peanut genome to be tested are both GG homozygous (i.e., the 12966357th base of chromosome 16 and the 51828217th base of chromosome 13 of the peanut genome are both GG homozygous);

[0101] If the fluorescence signal value of the peanut amplification product to be tested is close to the ordinate and the fluorescence reading is red (FAM signal), the genotypes of the Chr.16.12966357 and Chr.13.51828217 sites in the peanut genome to be tested are both CC homozygous (i.e., the 12966357th base of chromosome 16 and the 51828217th base of chromosome 13 of the peanut genome are both CC homozygous);

[0102] If the fluorescence signal value of the peanut amplification product to be tested is close to the middle of the horizontal and vertical axes, and the fluorescence reading is green (FAM and HEX signals), the genotypes of the Chr.16.12966357 and Chr.13.51828217 sites in the peanut genome to be tested are both GC heterozygous (i.e., the 12966357th base on chromosome 16 and the 51828217th base on chromosome 13 of the peanut genome are both GC heterozygous).

[0103] The black sample near the origin in the lower left corner is the blank control, and the pink sample is the test failure.

[0104] According to the above PCR amplification reaction system and amplification procedure, the recombinant strains in the 11 RIL populations screened on chromosome 16 were genotyped.

[0105] The typing results (Table 3) showed that the genotype of the Chr.16.12966357 locus was GG in 6 strains, and their resistance to net blotch was R or HR; the genotype of the Chr.16.12966357 locus was CC in 5 strains, and their resistance to net blotch was S or HS. This result shows that the Chr.16.12966357 marker can obtain stable PCR products in 11 RIL population recombinant strains, the two genotypes can be distinguished and clustered, and the Chr.16.12966357 marker is consistent with the identification results of the net blotch resistance phenotype.

[0106] Table 3 Genotyping of recombinant strains in the interval of Chr.16.12447069 to Chr.16.13614536

[0107]

[0108] Note: HR in the table means high resistance; R means resistance; HS means high sensitivity; S means susceptible.

[0109] According to the above-mentioned PCR amplification system and amplification procedure, the recombinant strains in the 11 RIL populations screened on chromosome 13 were genotyped.

[0110] The typing results showed (Table 4) that the genotype of the Chr.13.51828217 locus of 6 strains was GG, and their resistance to net blotch was R or HR; the genotype of the Chr.13.51828217 locus of 5 strains was CC, and their resistance to net blotch was S or HS. This result shows that the Chr.13.51828217 marker can obtain stable PCR products in 11 RIL population recombinant strains, the two genotypes can be clearly distinguished and clustered, and the Chr.13.51828217 marker is consistent with the identification results of the net blotch resistance phenotype.

[0111] Therefore, the Chr.16.12966357 and Chr.13.51828217 markers of the present invention can be used for molecular marker breeding of peanut web blotch resistance interval.

[0112] Table 4 Genotyping of recombinant strains in the interval Chr.13.42196092~Chr.13.54733271

[0113]

[0114] Example 2: Detection and application of peanut SNP locus genotype

[0115] To verify the reliability and accuracy of the KASP marker, a joint analysis and verification of the two molecular markers was conducted in a natural population containing 353 domestic and foreign germplasms. The steps are as follows:

[0116] 1. Extraction of peanut genomic DNA: The total DNA of the peanut material to be tested was extracted using the CTAB method. The specific method is as follows:

[0117] (1) Take young and tender leaves of peanut, grind them into powder using liquid nitrogen in a pre-cooled mortar and pestle, and put them into a 2 mL centrifuge tube.

[0118] (2) Add 650 μL of CTAB extract (preheated in a 65°C water bath) to the centrifuge tube, mix well, and place in a 65°C water bath for 40 min. During this time, invert the sample 3-4 times to mix well.

[0119] (3) After cooling to room temperature, add an equal volume of a mixture of chloroform and isoamyl alcohol (the volume ratio of chloroform to isoamyl alcohol is 24:1) to the centrifuge tube, invert to mix, and centrifuge at 12,000 rpm for 10 min;

[0120] (4) Take the supernatant and transfer it to a new 1.5 mL centrifuge tube, and repeat step (3) once.

[0121] (5) Take the supernatant and transfer it to a new 1.5 mL centrifuge tube. Add an equal volume of isopropanol, invert and mix, and incubate at -20°C for 30 min.

[0122] (6) Centrifuge at 12000 rpm for 10 min, discard the supernatant, and add appropriate volume of 75% ethanol to wash the precipitate twice.

[0123] (7) After air-drying the DNA precipitate, add 150 μL of ddH2O to dissolve it;

[0124] (8) After the DNA is fully dissolved, test its concentration and purity.

[0125] 2. PCR amplification: The KASP-1 primer mixture includes upstream primer Chr.16.12966357-FAM (SEQ ID No.1), upstream primer Chr.16.12966357-HEX (SEQ ID No.2), downstream primer Chr.16.12966357-Com (SEQ ID No.3) and ddH2O.

[0126] The KASP-2 primer mixture includes an upstream primer Chr. 13.51828217-FAM (SEQ ID No. 4), an upstream primer Chr. 13.51828217-HEX (SEQ ID No. 5), a downstream primer Chr. 13.51828217-Com (SEQ ID No. 6) and ddH2O.

[0127] The primer mixture of KASP was composed of an upstream primer at a concentration of 100 μM, an upstream primer, a downstream primer and pure water in a volume ratio of 6:6:15:23.

[0128] ① Use KASP primer mixture to carry out PCR amplification reaction in water bath PCR instrument LGC HydroCycler2. PCR reaction system: 2μL of 30ng / μL DNA, 1μL of KASP primer mixture, and 1μL of 1×KASP Master Mix.

[0129] ②PCR reaction program: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, gradient annealing / extension at 55°C-61°C for 60 s, decreasing by 0.6°C in each cycle, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for a total of 26 cycles.

[0130] After the reaction, the fluorescence data of the reaction product was read on the PHERA Star Plus SNP instrument, and the genotypes of 353 peanut germplasm resources were performed on the real-time fluorescence quantitative PCR instrument using the KASP molecular marker primer pair to determine the genotypes of the SNP sites Chr.16.12966357 and Chr.13.51828217 in the peanut genome to be tested, that is, to detect whether the nucleotide at position 12966357 of chromosome 16 of the peanut genome is G or C, and whether the nucleotide at position 51828217 of chromosome 13 is G or C.

[0131] Judgment principle: If the fluorescence signal data of the peanut amplification product to be tested is close to the Y axis (FAM signal), the genotypes of the SNP sites Chr.16.12966357 and Chr.13.51828217 in the peanut genome to be tested are both CC homozygous;

[0132] If the fluorescence signal data of the amplified product of the peanut to be tested is close to the X-axis (HEX signal), the genotypes of the SNP sites Chr.16.12966357 and Chr.13.51828217 in the genome of the peanut to be tested are both GG homozygous.

[0133] The CC genotype indicates that the nucleotide types of the SNP sites Chr.16.12966357 and Chr.13.51828217 in the peanut genome are both C; the GG genotype indicates that the nucleotide types of the SNP sites Chr.16.12966357 and Chr.13.51828217 in the peanut genome are both G; finally, 17 natural germplasms (including Jinong 99) with the gene marked Chr.16.12966357 as GG type and the gene marked Chr.13.51828217 as GG type were screened out from 353 natural germplasm resources (Table 5).

[0134] The markers of Chr.16.12966357 genotype GG in 353 natural populations were marked as AA, and those of Chr.16.12966357 genotype CC were marked as aa; the markers of Chr.13.51828217 genotype GG in natural populations were marked as BB, and those of Chr.13.51828217 genotype CC were marked as bb. According to the marker type of each natural germplasm Chr.16.12966357 and Chr.13.51828217, the genotype of each natural germplasm was divided into 4 categories: AABB, AAbb, aaBB, and aabb. Then, the combined genotypes of Chr.16.12966357 and Chr.13.51828217 of each germplasm in natural populations were jointly analyzed with the disease index of net blotch ( Figure 4 ).

[0135] The results of genotyping different peanut germplasm resources with Chr.16.12966357 and Chr.13.51828217 markers showed that the molecular markers could clearly separate the two genotypes, of which 1.4% (5 samples) of peanut germplasm had Chr.16.12966357 genotype GG, and 3.7% (13 samples) of peanut germplasm had Chr.13.51828217 genotype GG. The peanut germplasm with Chr.16.12966357 and Chr.13.51828217 marker GG genotypes had different degrees of resistance to net blotch (high resistance to medium resistance). In addition, Jinong 99 with both Chr.16.12966357 and Chr.13.51828217 marker GG genotypes was a highly resistant net blotch germplasm.

[0136] Therefore, the KASP markers Chr.16.12966357 and Chr.13.51828217 of the present invention can be used for breeding of peanut germplasm resistant to net blotch disease, and can accurately perform genotyping on the peanut net blotch disease trait. The molecular markers can be applied to screening of germplasm resistant to net blotch disease and assist in peanut molecular breeding.

[0137] Table 5 Polymorphism analysis of markers Chr.16.12966357 and Chr.13.51828217 in 7 peanut germplasm resources

[0138]

Claims

1. A KASP molecular marker primer set for detecting peanut web blotch resistance, characterized in that: The primer set comprises: The molecular marker Chr.16.12966357 includes upstream primer 1, upstream primer 2 and downstream primer 3; The molecular marker Chr.13.51828217 includes upstream primer 4, upstream primer 5 and downstream primer 6; Upstream Primer 1: GAAGGTGACCAAGTTCATGCTTACACACCAGTTCAACACATGCC(SEQ ID NO.1) Upstream Primer 2: GAAGGTCGGAGTCAACGGATTTACACACCAGTTCAACACATGCG(SEQ ID NO.2) Downstream primer 3: TGTGTTGCGAGCCATTGCAATTGTG (SEQ ID NO. 3) Upstream primer 4: GAAGGTGACCAAGTTCATGCTTTACCTGGAACATAACGGGTACC(SEQ ID NO.4) Upstream Primer 5: GAAGGTCGGAGTCAACGGATTTTACCTGGAACATAACGGGTACG (SEQ ID NO. 5) downstream primer 6: CATATGTATATTTTCCGCATAAAATACTTA (SEQ ID NO. 6).

2. The KASP molecular marker primer set according to claim 1, characterized in that: The KASP molecular markers include SNP sites Chr.16.12966357 and SNP sites Chr.13.51828217, The SNP site Chr.16.12966357 is located on chromosome 16 of peanut. The mutation site is G / C. The sequences of 100 bp before and after the mutation site are: TGCATTAAGGGAATATTGTGTGCACTGTGCTTATCTCTTTAATATTTGATTCAGTGATT TGTGTGTTGCGAGCCATTGCAATTGTGGGGTTGTAATTTAG (SEQ ID NO. 7); GCATGTGTTGAACTGGTGTGTACATTAGTTGACCAAGCCGGTATTAATGAATTTTG TGGAAGCTACTAAATACTAATGTCTAATGCAACTCATGTGGACAA (SEQ ID NO. 8); The SNP site Chr.13.51828217 is located on chromosome 13 of peanut. The mutation site is G / C. The sequences of 100 bp before and after the mutation site are: ACATGAATTCACCAATTAGATAGCGTATCGCATACCAATTCATCTGCATATATACCAG AACGTCATATGTATATTTTCCGCATAAAATACTTACATATGG (SEQ ID NO. 9); GTACCCGTTATGTTCCAGGTAACTGGCTTGGAATGAGGAACAGAACACTAGGTTT GTGTACTCACCGTACTATTTCTTTCTTTAAGTTGATGACTCCCTA (SEQ ID NO. 10).

3. A detection reagent or kit for the KASP molecular marker primer set according to claim 1.

4. A method for detecting peanut web blotch resistance using the KASP molecular marker primer set according to claim 1, characterized in that: The DNA of the peanut material to be identified was extracted, and PCR identification was performed using the molecular marker KASP primer set. When the genotype of the SNP sites Chr.16.12966357 and Chr.13.51828217 was GG, the peanut material to be identified showed disease resistance.

5. The method for detecting peanut web blotch resistance using the KASP molecular marker primer set according to claim 4, characterized in that: The PCR reaction program is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing / extension at 55-61°C for 60 s, decreasing 0.6°C in each cycle, 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, 26 cycles.

6. Use of the KASP molecular marker primer set according to claim 1 in breeding peanut seeds resistant to net blotch disease, characterized in that: The SNP marker genotype of the peanut material to be identified is detected. When the genotypes of the SNP sites Chr.16.12966357 and Chr.13.51828217 are both GG, the peanut material to be identified exhibits disease resistance.

Images