Application of streptomyces cancefacetin FJ-10 in prevention and treatment of corn diseases, microbial agent and pharmaceutical composition

Abstract

The invention relates to the technical field of biological prevention and treatment, in particular to application of streptomyces cancefactiticus FJ-10 in prevention and treatment of corn diseases, a microbial agent and a pharmaceutical composition. The invention provides an application of streptomyces canceostimuli FJ-10 in prevention and treatment of corn diseases. The preservation number of the streptomyces canceostimuli FJ-10 is CGMCC (China General Microbiological Culture Collection Center) NO.27911. The invention further provides an application of the streptomyces canceostimuli FJ-10. The streptomyces cancericola FJ-10 provided by the invention not only has a very strong bacteriostatic effect on corn southern leaf blight pathogenic bacteria, namely, helminthosporium longibrachiatum, but also has a relatively good inhibiting effect on common corn diseases such as corn leaf blight, corn alternaria leaf spot, corn fusarium stem rot, corn sheath blight and corn stem rot. Field experiments prove that corn southern leaf blight can be effectively prevented and treated after corn plants are inoculated with the streptomyces cancericola FJ-10 fermentation liquor for 28 days.

Description

Technical Field

[0001] The invention relates to the technical field of biological control, and in particular to application of Streptomyces cyperus FJ-10 in preventing and controlling corn diseases, a microbial agent and a drug combination. Background Art

[0002] Corn is an important food crop and feed crop with great production potential and high economic benefits. It can be used for food, feed and various industrial purposes, and plays an important strategic role in ensuring food security. Corn is not only an important food crop, but also an important feed crop and industrial raw material. In addition, corn has high comprehensive utilization value. It is rich in protein and dietary fiber, which helps promote gastrointestinal motility and prevent constipation. Corn is also rich in vitamins and minerals, which helps to improve human immunity and promote physical health.

[0003] Corn leaf blight is one of the main diseases of corn. It spreads very quickly from onset to wide range, causing serious damage. Corn leaf blight, also known as corn spot disease, occurs in all corn-growing areas in my country. It is caused by infection of Helminthosporium and occurs in corn. It mainly harms leaves, but leaf sheaths, bracts and cobs can also be affected. It can occur throughout the entire growth period of corn, but it is most serious during the tasseling and filling stages. Corn diseases have great harm to corn yield and quality. At the same time, they are contagious and spreadable, which brings great troubles to corn production. In order to effectively prevent and control corn diseases, biological control and chemical control can be used. Chemical control is a commonly used means of prevention and control of corn leaf blight, but chemical agents will pollute the environment. Long-term abuse and excessive use can easily lead to drug resistance in pathogens.

[0004] Streptomyces is a gram-positive aerobic bacterium with filamentous branching hyphae. It is the genus of Actinomycetes that produces the most natural active compounds. Streptomyces has the characteristics of fast growth, strong metabolic activity, and many metabolites, and is widely used in agricultural production. Microbial pesticides mainly include living microbial pesticides and microbial metabolite pesticides. Streptomyces jingyangensis 5406 has a good control effect on wheat root rot, rice seedling rot and cotton wilt; Jinggangmycin, an aminoglycoside metabolite produced by Streptomyces hygroscopicus var. jinggangensis TH82, has a good control effect on rice sheath blight, rice false smut, corn leaf spot, as well as diseases of vegetables, cotton, beans and other crops; Zhongshengmycin, an N-glycoside secondary metabolite produced by Streptomyces lavendulae var. hainanensis, has obvious antibacterial activity against cabbage soft rot, cucumber angular leaf spot, rice white leaf blight, apple ring rot and wheat fusarium.

[0005] Microbial control is safe, effective, has no residue, and is not prone to drug resistance. It is one of the important measures to achieve safe production of crops. Screening of Streptomyces biocontrol strains can provide an effective source of bacteria and a control method for biological control of plant diseases. Summary of the invention

[0006] In order to solve the above problems, the present invention provides the use of Streptomyces f. canicidalis FJ-10 in preventing and controlling corn diseases, a microbial agent and a drug combination. The Streptomyces f. canicidalis FJ-10 provided by the present invention has a significant inhibitory effect on the pathogenic blight of corn, Helminthosporium, and also has a broad-spectrum inhibitory effect on common corn pathogens, such as Alternaria alternata, Fusarium graminearum, Fusarium pseudoverticillium, Rhizoctonia solani and Pythium graminearum. Its fermentation liquid has a good control effect on corn blight, and after mixing with a fungicide, the control effect of the fungicide is significantly improved, and the fungicide has the potential to be developed as a microbial control agent.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] The invention provides application of Streptomyces carcinogenes FJ-10 in preventing and controlling corn diseases. The preservation number of the Streptomyces carcinogenes FJ-10 is CGMCC NO.27911.

[0009] Preferably, the corn diseases include one or more of corn leaf spot, corn leaf spot and corn stalk rot.

[0010] Preferably, the pathogen of corn leaf blight is Helminthosporium.

[0011] Preferably, the pathogens of corn leaf spot are Alternaria alternata and Fusarium graminearum.

[0012] Preferably, the pathogens of corn stalk rot include one or more of Fusarium solani, Rhizoctonia solani and Pythium graminearum.

[0013] Preferably, the 16s rRNA sequence of the Streptomyces carcinogenes FJ-10 is shown as SEQ ID NO.1, and the rpoB gene sequence is shown as SEQ ID NO.2.

[0014] The present invention provides a microbial agent, which comprises the Streptomyces spp. FJ-10 and / or fermentation broth used in the application of the above technical solution;

[0015] The fermentation liquid is obtained by fermenting the Streptomyces cerevisiae FJ-10.

[0016] The present invention also provides the use of the microbial agent described in the above technical solution in preventing and controlling corn diseases.

[0017] The present invention also provides a drug combination for preventing and controlling corn diseases, including a microbial fermentation dilution and difenoconazole;

[0018] The mass percentage of difenoconazole in the drug combination is 10%;

[0019] The microbial fermentation dilution liquid is obtained by diluting the fermentation liquid obtained by fermentation of Streptomyces cerevisiae FJ-10 in the application of the above technical solution by 10%.

[0020] The present invention also provides the use of the drug combination described in the above technical solution in preventing and controlling corn diseases.

[0021] Beneficial effects of the present invention:

[0022] (1) The Streptomyces sp. FJ-10 provided by the present invention not only has a strong antibacterial effect on the pathogen of corn leaf blight, Helminthosporium spp., but also has a good inhibitory effect on common corn diseases such as corn leaf blight, corn Alternaria leaf spot, corn Fusarium stalk rot, corn sheath blight, and corn stalk rot.

[0023] (2) Field experiments have shown that the fermentation liquid of Streptomyces f. japonicus FJ-10 can effectively prevent and control corn leaf blight 28 days after inoculation of corn plants.

[0024] (3) Streptomyces FJ-10 is easy to culture, and its fermentation broth is easy to extract and prepare. Compared with chemical agents, it has the advantages of low toxicity, no pollution, low residue and not easy to develop drug resistance.

[0025] (4) Streptomyces cytokinin FJ-10 was isolated from the soil around the soybean rhizosphere, which has little impact on soil balance and will not harm the beneficial organisms in the corn rhizosphere. Therefore, Streptomyces cytokinin FJ-10 has the potential to be developed into a biocontrol agent and has good market application prospects for the prevention and control of corn fungal diseases.

[0026] Biological Deposit Description

[0027] Streptomyces gancidicus FJ-10, Latin name Streptomyces gancidicus, was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on July 17, 2023, with the deposit number CGMCC NO.27911, and the address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0029] Figure 1 The culture characteristics and hyphae and spore morphology of Streptomyces gancidicus strain FJ-10 on Gao's medium No. 1; A: colony morphology, B: spore hyphae and spore morphology;

[0030] Figure 2 This is a phylogenetic tree constructed based on the 16S rRNA sequence of Streptomyces gancidicus strain FJ-10;

[0031] Figure 3 This is a phylogenetic tree constructed based on the rpoB sequence of Streptomyces gancidicus strain FJ-10;

[0032] Figure 4 This is a phylogenetic tree constructed based on the 16S rRNA-rpoB sequence of Streptomyces gancidicus strain FJ-10;

[0033] Figure 5The antagonistic effect of Streptomyces gancidicus strain FJ-10 on common maize pathogens under confrontation culture conditions was determined; A: Bipolaris maydis, B: Alternaria alternata, C: Fusarium graminearum, D: Fusarium verticillioides, E: Rhizoctonia solani, F: Pythium graminicola, CK was the control group;

[0034] Figure 6 The antagonistic effect of the fermentation liquid of Streptomyces gancidicus strain FJ-10 on the mycelial growth of common maize pathogens was determined; A: Bipolaris maydis, B: Alternaria alternata, C: Fusarium graminearum, CK was the control group;

[0035] Figure 7 The control effect of Streptomyces gancidicus strain FJ-10 on corn leaf blight; wherein A: fermentation broth of strain FJ-10, B: 10% difenoconazole water dispersible granules 1125 times diluted with 10-fold diluted fermentation broth of strain FJ-10 as solvent, C: 10% difenoconazole water dispersible granules 1125 times diluted, and D: clear water control. DETAILED DESCRIPTION

[0036] The invention provides application of Streptomyces carcinogenes FJ-10 in preventing and controlling corn diseases. The preservation number of the Streptomyces carcinogenes FJ-10 is CGMCC NO.27911.

[0037] In the present invention, the corn diseases preferably include one or more of corn leaf spot, corn leaf spot and corn stalk rot. In the present invention, the pathogen of corn leaf spot is preferably Helminthosporium. In the present invention, the pathogen of corn leaf spot is preferably Alternaria alternata and Fusarium graminearum. In the present invention, the pathogen of corn stalk rot preferably includes one or more of Fusarium pseudoverticillium, Rhizoctonia solani and Pythium graminearum.

[0038] The present invention provides a microbial agent, which includes the Streptomyces cyperus FJ-10 and / or fermentation broth in the application described in the above technical solution; the fermentation broth is obtained by fermenting the Streptomyces cyperus FJ-10. The present invention does not specifically limit the culture medium and fermentation conditions used in the fermentation, and those skilled in the art can adopt conventional methods.

[0039] The present invention also provides the use of the microbial agent described in the above technical solution in preventing and controlling corn diseases.

[0040] The present invention also provides a drug combination for preventing and controlling corn diseases, comprising a microbial fermentation dilution and difenoconazole; the mass percentage of difenoconazole in the drug combination is 10%; the microbial fermentation dilution is obtained by diluting the fermentation liquid obtained by fermenting the carcinocinogen Streptomyces FJ-10 in the application described in the above-mentioned technology by 10%.

[0041] The present invention also provides the use of the drug combination described in the above technical solution in preventing and controlling corn diseases.

[0042] Gao's medium No. 1: soluble starch 20 g, NaCl 0.5 g, KNO31 g, K2HPO4·3H2O 0.5 g, MgSO4·7H2O 0.5 g, FeSO4·7H2O 0.01 g, agar 18 g, distilled water 1000 mL, pH 7.0.

[0043] Gao's No. 1 liquid culture medium: soluble starch 20 g, NaCl 0.5 g, KNO31 g, K2HPO4·3H2O0.5 g, MgSO4·7H2O 0.5 g, FeSO4·7H2O 0.01 g, distilled water 1000 mL, pH 7.0.

[0044] PDA solid culture medium: 200 g potato, 20 g glucose, 18 g agar, 1000 mL distilled water.

[0045] PDA liquid culture medium: 200 g potato, 20 g glucose, 1000 mL distilled water.

[0046] Improved HVA medium: humic acid 0.1g, CaCO3 0.02g, Na2HPO4 0.5g, MgSO4·7H2O 0.5g, KCl 1.7g, FeSO4·7H2O 0.01g, riboflavin m 0.5 mg, thiamine 0.5mg, vitamin B6 0.5mg, niacin 0.5mg, inositol 0.5mg, pantothenic acid 0.5mg, biotin 0.25mg, p-aminobenzoic acid 0.5mg, agar 18g, distilled water 1000mL.

[0047] Czapek medium: NaNO3 3g, K2HPO4 1g, MgSO4·7H2O 0.5g, KCl 0.5g, FeSO4·7H2O 0.01g, sucrose 30g, agar 18g, pH 7.2, distilled water 1000mL.

[0048] Glucose asparagine medium: L-aspartic acid 18 g, glycerol 10 g, K2HPO4 1 g, FeSO4·7H2O 0.1 g, MnCl2·4H2O 0.1 g, ZnSO4·7H2O 0.1 g, agar 18 g, pH 7.2, distilled water 1000 mL.

[0049] Glycerol asparagine medium: L-asparagine 1 g, ZnSO4·7H2O 0.001 g, FeSO4·7H2O0.001 g, MnCl2·4H2O 0.001 g, K2HPO41 g, agar 18 g, pH 7.4, distilled water 1000 mL.

[0050] Inorganic salt starch medium: soluble starch 10g, K2HPO41 g, Mg SO41 g, NaCl 1g, (NH4)2SO42g, CaCO32 g, FeSO4·7H2O 0.001g, MnCl2·4H2O 0.001g, ZnSO4·7H2O 0.001g, agar 18g, pH 7.4, distilled water 1000mL.

[0051] ISP-2 medium: yeast extract 4 g, malt extract 10 g, glucose 4 g, agar 18 g, pH 7.0, distilled water 1000 mL.

[0052] Oatmeal medium: oatmeal powder 20g, FeSO4·7H2O 0.001, MnCl2·4H2O 0.001g, ZnSO4·7H2O0.001g, agar 18g, pH 7.2, distilled water 1000mL.

[0053] Santa's medium: yeast extract 1 g, KH2PO4 0.5 g, NH4Cl 1 g, Na2SO4 1 g, CaCl2·2H2O 0.1 g, MgSO4·7H2O 2 g, L-cysteine ​​hydrochloride 0.75 g, Fe(NH4)2·(SO4)2·6H2O 0.5 g, agar 18 g, pH 7.2, distilled water 1000 mL.

[0054] In order to further illustrate the present invention, the present invention is described in detail below in conjunction with embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0055] Example 1

[0056] Isolation and identification of Streptomyces gancidicus strain FJ-10:

[0057] 1. Collection of soil samples

[0058] The samples were collected from the soybean planting base in Xindian Town, Jin'an District, Fuzhou City, Fujian Province (longitude: 119°32′, latitude: 26°14′). The surface soil was removed around the rhizosphere of healthy soybean plants, and soil samples at a depth of 5-20 cm were collected. After marking, the samples were brought back to the laboratory for natural air drying.

[0059] 2. Isolation of actinomycetes

[0060] The air-dried soil sample was ground in a mortar, 1 g of the sample was weighed and suspended in a test tube with 9 mL of sterile water, and then shaken at 40°C and 180 rpm for 30 min and allowed to stand for 5 min. The sample was then diluted with 10-fold gradient to prepare 10 -2 , 10 -3 , 10 -4 0.1 mL of the suspension of different concentrations was taken and added to the modified HVA medium (potassium dichromate with a final concentration of 100-200 ppm) plate. After evenly spreading, the plate was inverted and cultured at 28°C for observation. After 5-7 days, different single colonies were picked out for streak purification. The purified strains were stored in a -80°C refrigerator using the glycerol method.

[0061] 3. Screening of actinomycetes

[0062] Antagonistic bacteria were screened by confrontation culture method with Bipolaris maydis, the pathogen of corn leaf spot, as the target bacteria.

[0063] Initial screening: The isolated antagonistic Streptomyces were inoculated in two directions 22 mm away from the center of the plate in a straight line and cultured in the dark at 28°C. After 3 days, purified 5 mm target bacteria cakes were inoculated in the center of the PDA plate culture medium and cultured at 28°C for 7 days. Strains with an inhibition bandwidth greater than 5 mm were selected for re-screening.

[0064] Rescreening: According to the initial screening results, antagonistic Streptomyces were inoculated in two directions 22 mm away from the center of the plate in a straight line and cultured in the dark at 28°C. After 3 days, purified 5 mm target bacteria cakes were inoculated in the center of the PDA plate culture medium and cultured at a constant temperature of 28°C for 7 days to screen antagonistic Streptomyces with large inhibition zone width and high target bacteria hyphae inhibition rate.

[0065] 3. Identification of Streptomyces gancidicus strain FJ-10

[0066] (1) Observation of morphological characteristics

[0067] Eight culture media for international strain identification were used for identification. Strain FJ-10 was inoculated into the eight culture media and inverted at 28°C for culture. After 7 days, the aerial hyphae, intrabasal hyphae and soluble pigment colors of the strain on different culture media were observed, as shown in Table 1. It can be seen that strain FJ-10 can grow on all eight culture media. There are no aerial hyphae on glucose asparagine medium, but aerial hyphae are produced in the remaining seven culture media. The hyphae are white, gray or millet yellow, and no soluble pigments are produced. Strain FJ-10 grows well on Gao's No. 1 medium. In the early stage of culture, the colonies are white, without aerial hyphae, with irregular edges and uneven surfaces. In the later stage of culture, the colonies are gray and the aerial hyphae are white (see Figure 1 Middle A). Under an optical microscope, the spores of strain FJ-10 are straight, flexible, hooked, and spiral; the spores are oval (see Figure 1 (middle B).

[0068] Table 1 Culture characteristics of strain FJ-10

[0069] Cultivation characteristics: Aerial hyphae Mycelium in the base Soluble pigments Czapek medium White Squid Gray none Glucose-aspartate medium none Ivory Yellow none Glycerol Asparagine Medium Little, millet yellow Soybean yellow none Inorganic starch culture medium White Cork Yellow none ISP-2 medium White Cinnamon Brown none Oatmeal culture medium grey Light withering gray none Gao's medium No.1 White Soybean juice yellow none Santa's medium White Coffee Brown none

[0070] (2) Physiological and biochemical characteristics

[0071] According to the method described in the "Streptomyces Identification Manual" (Actinomycetes Classification Group, Institute of Microbiology, Chinese Academy of Sciences. Streptomyces Identification Manual [M]. Beijing: Science Press, 1975: 17-66), the physiological and biochemical characteristics of strain FJ-10, such as gelatin liquefaction, milk coagulation and peptone, were determined. The results are shown in Table 2.

[0072] Table 2 Physiological and biochemical characteristics of strain FJ-10

[0073]

[0074] The results showed that strain FJ-10 can utilize D-glucose, D-xylose, D-galactose, lactose, trehalose, D-fructose, maltose, L-rhamnose, D-ribose, L-arabinose, cellobiose, starch, glycogen, mannitol, salicin, inositol, glycerol, amygdalin, esculin, gluconate, and N-acetyl-glucosamine as carbon sources, and can utilize nitrogen sources such as lysine, threonine, alanine, and proline, and can peptone and coagulate milk. It is positive for amylase and tyrosinase, and negative for nitrate reduction.

[0075] (3) Sequence analysis

[0076]

[0077] The rpoB sequence of strain FJ-10 is: CAGTCGTCGTCTGACGCCCTCGGCCCGGG TGGTCTCTCCCGTGAGCGGGCCGGCTTCGAGGTCCGTGACGTGCACCCCTCGCACTACGGCCGCATGTGCCCGATCGAGACGCCGGAAGGCCCGAACATCGGTCTGATCGGTTCGCTCGCCTCCTACGGGCGGATCAACCCGTTCGGCTTCATCGAGACGCCGTACCGCAAGGTCGTCGACGGCCAGGTCACCGACGAGGTGGACTACCTGACCGCCGACGAGGAGGACCGCTTCGTCATCGCGCAGGCCAACGCGCCGCTGAACGACGAGATGCGCTTCGTCGAGAACCGCATCCTGGTCCGCCGCCGCGGCGGCGAGGTCGACTACGTCCCCGGCGACGAGGTCGACTACATGGACGTCTCGCCGCGCCAGATGGTGTCGGTCGCGACCGCCATGATCCCGTTCCTCGAGCACGACGACGCCAACCGCGCCCTCATGGGCGCGAACATGATGCGCCAGGCCGTGCCGCTCATCAAGAGCGAGGCCCCGCTCGTCGGCACCGGCATGGAGTACCGCTCCGCCGTCGACGCCGGTGACGTGGTCAAGGCGGAGAAGGCGGGTGTGGTCCAGGAGGTCTCCGCGGACTACATCACCACGGCCAACGACGACGGCACGTACATCACGTACCGCCTGGCCAAGTTCTCCCGCTCCAACCAGGGCACCTCGGTCAACCAGAAGGTCATCGTCTCCGAGGGCGACCGCGTCATCGAGGGCCAGGTCCTCGCCGACGGTCCGGCCACCCAGAACGGCGAGATGGCGCTGGGCAAGAACCTGCTCGTGGCGTTCATGCCGTGGGAGGTAAAAAATCCAAAGGGG (SEQ ID NO.2).

[0078] The obtained sequences were submitted to the GenBank database for BLAST homology comparison, and the 16S rRNA and rpoB genes of related strains were obtained from the GenBank database. The phylogenetic tree was constructed using the Neighbor-joining analysis method on MEGA7.0. The results showed that the 16S rRNA and rpoB gene sequence fragments had high homology with several species of Streptomyces sp. in GenBank. The similarities of the 16S rRNA gene sequence fragment with Streptomyces pseudogriseolus (accession number: KY753277.1) and Streptomyces gancidicus (accession numbers: ON898062.1 and CP108344.1) were 99.93%, 99.93% and 99.86%, respectively; the rpoB gene sequence fragment with Streptomyces gancidicus (accession number: CP108344.1), Streptomyces cellulosae (accession number: CP109197.1) and Streptomyces thermocarboxydus (accession numbers: CP058273.1: CP109197.1) with similarities of 99.76%, 98.67% and 98.67% respectively. The constructed phylogenetic tree showed that strain FJ-10 was clustered with Streptomyces gancidicus and Streptomyces pseudogriseolus in the phylogenetic tree based on 16S rRNA (see Figure 2 ), and clustered with Streptomyces gancidicus in the phylogenetic tree based on rpoB (see Figure 3 ), and the phylogenetic tree based on 16S rRNA and rpoB clusters with Streptomyces gancidicus (see Figure 4 ).

[0079] Based on the preliminary identification results of the strain's morphological characteristics and physiological and biochemical characteristics, combined with 16S rRNA and rpoB sequence analysis, the strain FJ-10 was ultimately determined to be Streptomyces gancidicus.

[0080] The strain FJ-10 has been deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration, abbreviated as CGMCC, with the address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit time is July 17, 2023. The classification name is Streptomyces gancidicus, and the deposit number is CGMCC NO.27911.

[0081] Example 2

[0082] Determination of the antagonistic effect of Streptomyces gancidicus strain FJ-10 on common maize pathogens:

[0083] The plate confrontation culture method was used to test the inhibitory effect of Streptomyces gancidicus strain FJ-10 on the common maize pathogen Bipolaris maydis, and the antagonistic effect on the common maize pathogens Alternaria alternata, Fusarium graminearum, Fusarium verticillioides, Rhizoctonia solani and Pythium graminicola was determined. First, the strain FJ-10 was inoculated on both sides of the edge of the PDA medium. After 3 days, a 5mm diameter bacterial cake of the test pathogen was inoculated in the center of the plate, and cultured in the dark at 28℃. After 7 days, the width of the inhibition zone of strain FJ-10 against the test pathogen was measured, and the test pathogen without antagonistic bacteria was used as the control. The experiment was repeated 3 times. The results are shown in Table 3. The Streptomyces gancidicus strain FJ-10 has a strong antagonistic effect on the common maize pathogens Bipolaris maydis, Alternaria alternata, Fusarium graminearum, Fusarium verticillioides, Rhizoctonia solani and Pythium graminicola ( Figure 5 ).

[0084] Table 3 Antagonistic effect of strain FJ-10 on common maize pathogens

[0085]

[0086] Example 3

[0087] Determination of the inhibitory effect of the fermentation broth of Streptomyces gancidicus strain FJ-10 on common maize pathogens

[0088] The spores of strain FJ-10 activated by Gao's medium were inoculated into Gao's liquid medium No. 1. The fermentation temperature was 28°C and the fermentation time was 7 days. The fermentation liquid was filtered and sterilized through a 0.22 μm microporous filter membrane for use.

[0089] The PDA medium was cooled to 45°C, and the sterilized and filtered fermentation broth of strain FJ-10 was added. After mixing, a PDA fermentation broth plate was prepared. The final concentration of the fermentation broth was 10%. A 5mm diameter bacterial cake of the test strain was inoculated into the center of the PDA fermentation broth plate, and cultured in the dark at 28°C. The colony diameter was measured after 7 days. The addition of an equal amount of sterile water was used as a control. The experiment was repeated 3 times. The results are shown in Table 4. The fermentation broth of Streptomyces gancidicus strain FJ-10 had a strong inhibitory effect on the common maize pathogens Bipolaris maydis, Alternaria alternata, Fusarium graminearum, Fusarium verticillioides, Rhizoctonia solani and Pythium graminicola ( Figure 6 ).

[0090] Table 4 Inhibitory effect of the fermentation broth of strain FJ-10 on common maize pathogens

[0091]

[0092]

[0093] Example 4

[0094] Application of the fermentation liquid of Streptomyces gancidicus strain FJ-10 in the prevention and treatment of corn large and small spot diseases:

[0095] After activation, Bipolaris maydis, the pathogen of corn leaf spot, was transferred to PDA culture dishes and cultured in the dark at 28°C. After 7 days, the spores were washed with sterile water and prepared into 1×10 5 spore suspension, mixed in a 1:1 ratio, added with 0.1% Tween 80 and set aside.

[0096] The test site was selected in Xindian Town, Jin'an District, Fuzhou City, Fujian Province, and the corn variety was top grade. The test set up 4 treatments, namely: A strain FJ-10 fermentation liquid, B strain FJ-10 fermentation liquid 10 times diluted as solvent to prepare 10% difenoconazole water dispersible granules 1125 times liquid, C 10% difenoconazole water dispersible granules 1125 times liquid, D clear water control, each treatment 15 corn plants, 3 replicates, a total of 12 plots, plots randomly arranged in blocks. Spray the pesticide at the big bell mouth stage of corn, and inoculate the above-mentioned corn leaf spot mixed culture 24h after the spraying, spray 100mL per plot; at 25-30℃, the disease situation was investigated 10d after inoculation, and the disease index and technical prevention effect were statistically calculated.

[0097] Survey method: All corns were surveyed, and the total number of ears and the number of cases at each level were recorded.

[0098] Disease classification standard

[0099] Level 0: no lesions;

[0100] Level 1: There are no lesions on the leaves or there are only sporadic lesions on the leaves below the ear, and the lesions occupy less than or equal to 5% of the leaf area;

[0101] Level 3: There are a small number of lesions on the leaves below the ear, accounting for 6% to 10% of the leaf area, and there are sporadic lesions on the leaves above the ear;

[0102] Level 5: There are many lesions on the leaves below the ear, accounting for 11% to 30% of the leaf area, and there are a few lesions on the leaves above the ear;

[0103] Level 7: There are a large number of lesions on the leaves below the ear or on the leaves above the ear. The lesions are connected and occupy 31% to 70% of the leaf area.

[0104] Level 9: The leaves of the entire plant are basically covered with lesions and the leaves are dead.

[0105] Disease index = ∑ (number of diseased ears at each level × number of levels at each level) / (total number of ears surveyed × 9) × 100

[0106] Control effect = (control group disease index - treatment group disease index) / control group disease index × 100%

[0107] Table 5 Field control effect of the fermentation liquid of strain FJ-10 on corn leaf blight

[0108] deal with Average disease index Average control effect Significance of difference A 14.57 68.47 B B 12.10 73.80 aA C 14.81 67.93 B D 46.18 - -

[0109] Through the above treatment, the field efficacy test results of the fermentation liquid of strain FJ-10 on corn leaf spot disease showed that after the corn was inoculated with the fermentation liquid of strain FJ-10, the plants grew well and the disease severity was reduced (see Appendix Figure 7As shown in Table 5, the control effect of the fermentation liquid of strain FJ-10 on corn leaf blight was 68.74%. At the 5% significance level and above, the average control effect of the treatment with 10% difenoconazole water dispersible granules 1125 times diluted was not significantly different from that of the treatment with 10% difenoconazole water dispersible granules 1125 times diluted with the fermentation liquid of strain FJ-10 as the solvent was significantly different from that of the treatment with 10% difenoconazole water dispersible granules 1125 times diluted with the fermentation liquid of strain FJ-10 as the solvent. The average control effect of 10% difenoconazole water dispersible granules 1125 times diluted with the fermentation liquid of strain FJ-10 was 73.8% on corn leaf blight. At the 5% significance level, the average control effect of the treatment with the fermentation liquid of strain FJ-10 and 10% difenoconazole water dispersible granules 1125 times diluted was significantly different from that of the fermentation liquid of strain FJ-10 and 10% difenoconazole water dispersible granules 1125 times diluted was significantly different from that of the fermentation liquid of strain FJ-10. At the 1% extremely significant level, the average control effect of the three treatments on corn leaf blight was not significantly different. The results showed that the fermentation broth of strain FJ-10 had an inhibitory effect on corn leaf blight caused by Bipolaris maydis, showing good application prospects.

[0110] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of Streptomyces carcinogenes FJ-10 in preventing and controlling corn diseases, wherein the deposit number of Streptomyces carcinogenes FJ-10 is CGMCC NO.27911.

2. The use according to claim 1, characterized in that: The corn diseases include one or more of corn leaf spot, corn leaf spot and corn stalk rot.

3. The use according to claim 2, characterized in that: The pathogen of corn leaf spot is Helminthosporium.

4. The use according to claim 2, characterized in that: The pathogens of corn leaf spot are Alternaria alternata and Fusarium graminearum.

5. The use according to claim 2, characterized in that: The pathogens of corn stalk rot include one or more of Fusarium solani, Rhizoctonia solani and Pythium graminearum.

6. The use according to claim 1, characterized in that: The 16s rRNA sequence of the Streptomyces carcinogenes FJ-10 is shown in SEQ ID NO.1, and the rpoB gene sequence is shown in SEQ ID NO.

2.

7. A microbial agent, characterized in that: The microbial agent comprises the Streptomyces spp. FJ-10 and / or fermentation broth used in any one of claims 1 to 6; The fermentation liquid is obtained by fermenting the Streptomyces cerevisiae FJ-10.

8. Use of the microbial agent according to claim 7 in preventing and controlling corn diseases.

9. A drug combination for preventing and treating corn diseases, characterized in that: It includes a microbial fermentation diluent and difenoconazole; The mass percentage of difenoconazole in the drug combination is 10%; The microbial fermentation dilution liquid is obtained by diluting the fermentation liquid obtained by fermentation of Streptomyces cerevisiae FJ-10 in the application according to any one of claims 1 to 6 by 10%.

10. Use of the drug combination according to claim 9 in preventing and controlling corn diseases.

Images