Nucleic acid aptamer specifically combined with TIGIT as well as screening and application of nucleic acid aptamer

Abstract

The invention relates to a nucleic acid aptamer specifically combined with TIGIT and screening and application thereof.The nucleic acid aptamer is a nucleic acid aptamer E1, and the sequence of the nucleic acid aptamer E1 is shown as SEQ ID NO.1. TIGIT serves as a target, the aptamer is enriched from 35 base random sections and an ssDNA library with the total length of 75 bases through a magnetic bead-SELEX technology through eight rounds of screening processes, and the nucleic acid aptamer specifically combined with TIGIT is obtained. Sequence information of candidate aptamers is obtained through sequencing, so that an aptamer sequence E1 with the highest enrichment degree is obtained; the affinity of a candidate aptamer and a target molecule is verified through flow cytometry, the change trend of fluorescence intensity is fitted into an equation Y = B * X / (Kd + X), the Kd value is calculated to be 377nM / L, and the aptamer can replace an antibody to specifically recognize TIGIT on the surface of a cell membrane.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biomedical technology and medical biology, and specifically relates to a nucleic acid aptamer that can specifically bind to TIGIT and its screening and application. Background Art

[0002] In the complex network of immune regulation, T cell immunoglobulin and immunoreceptor tyrosine inhibitory motif domain protein (TIGIT) is an emerging immune co-inhibitory receptor (IR), and its importance is becoming increasingly prominent. TIGIT regulates the function of T cells and natural killer (NK) cells by binding to ligands (such as CD155 on dendritic cells), transmitting inhibitory signals, reducing the activity and proliferation of these immune cells, and thus becoming one of the key mechanisms for tumor cells to evade immune system surveillance. Many studies have shown that TIGIT is highly expressed in a variety of tumors and is closely related to poor prognosis. This discovery has opened up a new direction for tumor immunotherapy.

[0003] However, current antibody-based immunotherapy faces many challenges in the treatment of TIGIT, including high cost, low stability, and complexity of modification. These issues limit the widespread application and popularity of antibody therapy in clinical practice.

[0004] In view of the above-mentioned defects of immunotherapy, it is particularly important to explore a new, efficient and economical alternative therapy. Nucleic acid aptamers, as a single-stranded oligonucleotide obtained by systematic evolution of ligands by exponential enrichment (SELEX) technology, have become a research hotspot due to their unique advantages. Aptamers can not only bind to target molecules (such as TIGIT) with high affinity and strong specificity, but also have many advantages such as small molecular weight, easy large-scale synthesis, high stability, low immunogenicity, easy modification and low manufacturing cost. These characteristics make aptamers show great application potential in the field of disease detection and treatment.

[0005] Therefore, the development of nucleic acid aptamers for TIGIT aims to overcome the limitations of antibody therapy and provide new strategies and means for the treatment of immune diseases and tumors by specifically binding to TIGIT and regulating its role in the disease. At present, no nucleic acid aptamers with high affinity and specific binding to TIGIT have been reported. Therefore, screening and developing such aptamers has become an important research goal in this field, aiming to achieve more accurate, effective and economical immunotherapy solutions. Summary of the invention

[0006] 1. Technical issues to be resolved

[0007] The use of antibodies as immune target TIGIT blockers has the problems of high cost, cumbersome preparation, room temperature instability, high immunogenicity, and low tissue penetration, which are limited in terms of drug formulation and function. Specific TIGIT aptamers are expected to replace antibodies, achieve their molecular binding and site blocking, and have advantages in regulating cellular immune activity. The present invention provides TIGIT high-affinity nucleic acid aptamers and screening methods thereof, which can be used to solve the above problems.

[0008] (II) Technical solution

[0009] In order to achieve the above object, the main technical solutions adopted by the present invention include:

[0010] In a first aspect, the present invention provides a nucleic acid aptamer of a T cell immunoglobulin and an immunoreceptor tyrosine inhibitory motif domain protein (T cell immunoglobulin and ITIM domain, TIGIT), wherein the nucleic acid aptamer is nucleic acid aptamer E1, and the sequence thereof is:

[0011] 5'-TCAAGTCACAGGTTCCAGGTCACGGAGCACCGTGAGCGAAGGCATTGTCCTGGGAATAGGCACTGACACGACACT-3' (shown in SEQ ID NO. 1).

[0012] At 25 °C, 100 mM Na + , 1 mM Mg 2+ Under the conditions, the spatial structure of the nucleic acid aptamer E1 is as follows:

[0013]

[0014] The 5' end or 3' end of the nucleic acid aptamer E1 is chemically modified with a fluorescent group, an amino group, biotin, digoxigenin or polyethylene glycol.

[0015] The 5' end of the nucleic acid aptamer E1 is modified with a FAM group.

[0016] In a second aspect, the present invention provides the use of the nucleic acid aptamer in the preparation of a reagent, a kit or a sensor for detecting TIGIT.

[0017] The nucleic acid aptamer is used in preparing a separation and enrichment reagent for TIGIT in a sample.

[0018] The use of the nucleic acid aptamer in preparing a TIGIT site blocker.

[0019] In a third aspect, the present invention further provides a kit for specifically recognizing TIGIT, which comprises the nucleic acid aptamer, namely, nucleic acid aptamer E1.

[0020] In the fourth aspect, the present invention also provides a method for screening the nucleic acid aptamer, which comprises: using magnetic bead-SELEX technology, taking TIGIT as the target, and performing the following steps: ① construction of an initial library of random oligonucleotides; ② positive screening and negative screening; ③ elution to obtain sequences; ④ amplification, separation and purification to form a secondary library; ⑤ multiple rounds of steps 2 to 4; ⑥ sequencing and clustering analysis and structural analysis; ⑦ affinity and specificity characterization.

[0021] Finally, the full-length candidate nucleic acid aptamer E1 No. 1 was screened out and identified by flow cytometry. It has good affinity and specificity with TIGIT immobilized on magnetic beads. The nucleic acid aptamer E1 is expected to be used as a blocker of the TIGIT site.

[0022] (III) Beneficial effects

[0023] The present invention takes TIGIT as the target, utilizes the magnetic bead-SELEX technology to enrich aptamers from a ssDNA library with a random segment of 35 bases and a total length of 75 bases through an 8-round screening process, and obtains the sequence information of the candidate aptamers through sequencing, thereby obtaining the aptamer sequence E1 with the highest enrichment degree; the affinity of the candidate aptamer to the target molecule is verified by flow cytometry, the fluorescence intensity change trend is fitted to the equation Y=B*X / (Kd+X), and the Kd value is calculated to be 377nM / L, which can replace the antibody to specifically recognize TIGIT on the cell membrane surface.

[0024] The TIGIT aptamer provided by the present invention can be screened in vitro with a short screening cycle, and the screened sequence has strong specific binding ability and high affinity with the target molecule. In the future, it can be used to replace TIGIT antibodies, and can regulate the functions of T cells and NK cells by targeting TIGIT molecules, providing a new perspective for tumor immunotherapy. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Results of exploring the binding ability of the secondary library with MB-TIGIT.

[0026] Figure 2 This is a comparison of the abundance of the first 10 and 100 sequences in the secondary library (3P, 4P, 6P, 7P, 8P, 9P).

[0027] Figure 3 This is a graph showing the homology comparison results of random region sequence segments of the top 30 sequences in terms of abundance after sequencing.

[0028] Figure 4 This is the evolutionary tree analysis of the adaptors of the top 30 sequences in terms of abundance after sequencing.

[0029] Figure 5 This is a graph comparing the affinity analysis results of aptamers E1 and E2.

[0030] Figure 6 This is the flow cytometry fluorescence peak diagram of aptamer E1 binding to TIGIT.

[0031] Figure 7 Fitting curve for the fluorescence intensity change trend.

[0032] Figure 8 This is the secondary structure model of aptamer E1.

[0033] Fig. 9 Mountain plot of the thermodynamic ensemble and center-of-mass structure of aptamer E1.

[0034] Fig.10 This is the three-dimensional structure model of aptamer E1.

[0035] Fig.11 This is the docking model of aptamer E1 and TIGIT.

[0036] Fig.12 Characterize the specificity of aptamers by flow cytometry.

[0037] Fig.13 Comparison of NK cell activity between experimental wells (aptamer) and control wells (no aptamer). DETAILED DESCRIPTION

[0038] The present invention is described in detail below with reference to the accompanying drawings and embodiments:

[0039] 1. TIGIT aptamer screening

[0040] 1.1 Design of initial library and primers

[0041] TIGIT-specific aptamers were screened using the Capture-SELEX method. The screening buffer was 1×PBS (containing 1 mM Mg 2+ ), the ssDNA library used a self-designed random sequence of 35 nt in length and a total length of 75 nt. The library and PCR amplification primer information used for screening are shown in Table 1. The required sequence was synthesized by Shanghai Bioengineering.

[0042] Table 1. Nucleotide sequence information used for screening

[0043]

[0044] 1.2 Preparation of TIGIT-immobilized magnetic beads

[0045] Magnetic beads were purchased from HisPur TM Ni-NTA Magnetic Beads, the protein used was Recombinant Human TIGIT (C-6His) from Suzhou Nearshore Protein Company, molecular weight: 14.1KDa. 50μL of 5% (w / v) Ni-NTA magnetic bead suspension was washed twice with PBS, and 20μg of TIGIT protein was added to a total volume of 500μL of buffer (1×PBS, 1mM Mg 2+ ) and incubated with horizontal shaking for 2 h to prepare TIGIT-immobilized magnetic beads, washed twice with binding buffer, and separated by magnetic absorption for later use, which was recorded as MB-TIGIT.

[0046] 1.3 Activation of carboxyl magnetic beads and preparation of magnetic beads for reverse screening of serum proteins

[0047] Take 100 μL of carboxyl magnetic beads and wash them twice with pure water. Add an equal volume of 0.1M NHS and 0.4M EDC mixture and incubate at room temperature for 20 minutes. After magnetic separation and washing, the activated carboxyl magnetic beads are resuspended in 100 μL of water, and 80 μL of serum and 80 μL of pH 4.0 sodium acetate are added, and incubated at 25°C for 60 minutes. After magnetic separation, add 100 μL of ethanolamine (pH 8.5) and incubate for 10 minutes with shaking to block unreacted sites. Wash 3 times with PBS to obtain MB-S for use.

[0048] 1.4 Screening process

[0049] Eight rounds of screening were performed, with the third and seventh rounds being reverse screening and the rest being positive screening. Positive screening: Mix 400 μL of the library with MB-TIGIT and incubate at room temperature for 1 hour. After magnetic separation, collect the supernatant. Wash the magnetic beads bound to the library twice with PBS and recover the supernatant. Resuspend the magnetic beads with 200 μL PBS, incubate at 95°C for 10 minutes, and immediately perform magnetic separation. Collect the supernatant as the eluted fragment for amplification of the secondary library. Reverse screening: Mix the secondary library with the reverse screening magnetic beads and incubate at room temperature for 1 hour. After magnetic separation, the unbound portion is used as the library for the next round of positive screening.

[0050] 1.5 Secondary library amplification and purification

[0051] Taq DNA polymerase with standard Taqbuffer from New England biolabs was used for conventional PCR amplification. Amplification sample system: 300 μL 1+E~8+E was used as the template for secondary library preparation; 10 μL of primer E-FP (Fam) (10 μM); 10 μL of primer E-RP (Bio) (10 μM); 10 μL of dNTPs 10 mM; 10 μL of Taq DNA enzyme, add ddH 2O to 800μL. The amplification program is: ①95℃, 60s; ②94℃, 30s; ③three annealing temperatures, 30s; ④72℃, 30s; ⑤72℃, 180s; ⑥4℃, ∞. Steps 2 to 4 are cycled 30 times. After amplification, the double-stranded DNA is bound to the streptavidin magnetic beads, and the single-stranded secondary library is obtained after washing and heat treatment. After the nucleic acid concentration is determined, it is used for subsequent screening.

[0052] 2. Aptamer Identification

[0053] 2.1 Library affinity detection

[0054] The affinity changes between the single-stranded DNA library and TIGIT protein were monitored by flow cytometry. The secondary library was amplified using a forward primer labeled with FAM fluorescence and a reverse primer modified with biotin, and the single-stranded DNA was recovered and purified using streptavidin magnetic beads. The single-stranded DNA of each round of library was accurately quantified using an ultra-micro-volume UV spectrophotometer. The quantitative MB-TIGIT was incubated with the DNA library to explore the enrichment of the library in each round of screening, thereby evaluating its affinity with TIGIT.

[0055] Flow cytometry was used to verify the binding ability of the libraries with equal quality to MB-TIGIT. Figure 1 As shown in the figure, as the screening process progresses, the fluorescence shift of the next-level library (3P, 5P, 7P, 9P) obtained from the 2nd, 4th, 6th, and 8th rounds of screening becomes more and more significant. This change also reflects that the increase in the number of screening rounds leads to an increase in the amount of single-stranded DNA bound to the MB-TIGIT complex, which is then reflected in the enhancement of fluorescence shift.

[0056] 2.2 Sequencing and analysis of candidate nucleic acid aptamers

[0057] In the subsequent stage of library screening, we conducted in-depth sequence characterization analysis. The following are the detailed analysis steps and their supplementary contents:

[0058] (1) External sequencing:

[0059] In order to obtain detailed information on the DNA sequences in the enriched libraries, after completing SELEX, the enriched libraries (3P, 4P, 6P, 7P, 8P, and 9P) obtained from the 2nd, 3rd, 5th, 6th, 7th, and 8th rounds of screening were selected for external high-throughput sequencing. Illumina HiSeq 2500 sequencing was performed, and the perl script was used to filter out low-quality sequences, and the sequence clustering was used to obtain the abundance of each cluster. The total number of the top 10 and top 100 sequences with the highest abundance at each level of library was counted, and their proportion in the library at that level was counted. The count and the sum increased with the increase in rounds ( Figure 2 As shown), the quantity of 4P decreased slightly due to reverse screening.

[0060] (2) Primary structure homology analysis:

[0061] ClusterX2 software was used to analyze the primary structure homology of the sequencing data, and MEGA software was used to construct an evolutionary tree. Through alignment and clustering, we were able to identify target sequences that showed specific enrichment characteristics in the library. These sequences may have specific biological functions or have similarities with other known sequences, providing valuable clues for subsequent biological research.

[0062] After removing the terminal primer sequences, the core random sequences were subjected to homology analysis. The first 30 sequences were analyzed and compared using ClustalX and MEGA software. These sequences can be divided into 7 families in the evolutionary tree. Each family has similarities, such as Figure 3 , 4 shown.

[0063] 2.3 Flow cytometry verification of the affinity of aptamer E1 for TIGIT protein

[0064] Through the homology comparison of the primary structure, the full-length sequences of the most abundant aptamers E1 and E2 were selected as candidate aptamers for affinity comparison analysis. Among them, the nucleotide sequence of aptamer E1 is 5'-TCAAGTCACAGGTTCCAGGTCACGGAGCACCGTGAGC GAAGGCATTGTCCTGGGAATAGGCACTGACACGACACT-3'.

[0065] The sequence of nucleic acid aptamer E2 is 5′-TCAAGTCACAGGTTCCAGGTGGACCCAATGCGTCTCAGGTTGCTGTGAGCACCGCATAGG CACTG ACACG ACACT-3′.

[0066] The affinity of candidate aptamers to TIGIT protein was determined by flow cytometry. 3 μL of magnetic beads were coupled to 3 μg of TIGIT protein. Then, 5 μL (10 μM) of candidate aptamers labeled with fluorescein (FAM) were combined. Figure 5 As shown in the figure, E1 has the best affinity, while E2 has poor affinity. In addition, as the concentration of aptamer E1 increases, the fluorescence intensity is observed to shift significantly to the right, as shown in Figure 6 As shown in FIG. 1 , the trend of the average fluorescence intensity of the magnetic beads changing with the concentration of the aptamer was fitted to the equation Y=B*X / (Kd+X) using Origin (Origin Lab, USA) software, where Y represents the normalized value of the average fluorescence intensity of the cells, and X represents the concentration of the aptamer. The Kd value was calculated to be 377 nM / L, as shown in FIG. Figure 7 shown.

[0067] 2.4 Secondary structure simulation:

[0068] To further understand the possible functional mechanisms of the most enriched E1 sequences in cells or in vitro, we used RNAfold 2.6.3 software to simulate DNA secondary structures. DNA aptamers can form stable secondary structures under specific conditions, and these structures are closely related to their biological activities.

[0069] Simulate secondary structures such as Figure 8 As shown in the figure, the thermodynamic ensemble prediction results show that the free energy is -12.56 kcal / mol; the MFE (Most Frequent) structure frequency is 2.99%; and the diversity of the ensemble is 12.54. The mountain diagram of the MFE structure, the thermodynamic ensemble of the DNA structure, and the center of mass structure is shown in the figure. Fig. 9 shown.

[0070] 2.5 Three-dimensional structure simulation:

[0071] In order to more comprehensively understand the spatial structure of DNA aptamers and their interaction with target molecules, we further used 3dRNA (http: / / biophy.hust.edu.cn / new / 3dRNA) to perform three-dimensional structural simulation. Through this step, we can more accurately predict the binding mode of DNA aptamers with target molecules.

[0072] The three-dimensional structure of the protein was predicted based on the assembly of minimal secondary elements (SSES) on the 3dRNA / DNA Web server, including the stem (helix), hairpin loop, internal loop, convex loop, pseudoknot loop and knot loop, as shown in Fig.10 shown.

[0073] (5) Molecular docking analysis

[0074] Search the PDB format file of the protein target on the PDB official website: https: / / www.rcsb.org / . And export the aptamer E1 to simulate the three-dimensional conformation PDB file. Finally, we used the HDock software to simulate the molecular docking of TIGIT protein and DNA aptamer. The docking model of nucleic acid aptamer E1 and TIGIT was simulated by HDock software. Fig.11 shown.

[0075] The nucleic acid aptamer E1 that specifically binds to TIGIT is finally screened out and provided by the present invention, and its nucleotide sequence is 5'-TCAAGTCACAGGTTCCAGGTCACGGAGCACCGTGAGCGAAGG CATTGTCCTGGGAATAGGCACTGACACGACACT-3'.

[0076] 2.6 Preliminary study on the specificity of candidate aptamer E1

[0077] C-reactive protein (CRP), procalcitonin (PCT) and tumor necrosis factor (TNF) are important biomarkers for their immunomodulation, anti-inflammatory effects and cell induction. Using these biomarkers as nonspecific reference indicators, the difference in fluorescence signals was detected by flow cytometry to evaluate the specificity of candidate aptamer E1. When the aptamer interacted with MBs modified with other three proteins, such as CRP, PCT and TNF, the fluorescence shift of its samples was not obvious, such as Fig.12 As shown, this indicates that the degree of binding of nucleic acid aptamer E1 to these three proteins is low, thus confirming the specificity of the interaction between nucleic acid aptamer E1 and TIGIT.

[0078] 2.7 Preliminary study on the regulation of NK cell activity by aptamer E1

[0079] The function of NK cells is finely regulated by the interaction between its surface receptor TIGIT and its ligand (such as CD155 on dendritic cells). Once TIGIT binds to CD155, it transmits inhibitory signals, effectively reducing the activity and proliferation potential of NK cells. By using the nucleic acid aptamer E1 as an intervention method, E1 can competitively bind to TIGIT, thereby blocking the TIGIT-mediated inhibitory signaling pathway. In order to quantitatively evaluate the effect of this intervention on NK cell activity, the lactate dehydrogenase release experiment was used as a detection method. The activity state of NK cells is indirectly reflected by measuring the level of lactate dehydrogenase (LDH) released after NK cells kill target cells K5622. If E1 successfully blocks the inhibitory interaction of TIGIT-CD155, the activity of NK cells will be restored or enhanced.

[0080] Peripheral blood mononuclear cells (effector cells) were obtained by centrifugation with ficoll separation solution (ficoll: peripheral blood = 1; 1), and the cell concentration was adjusted to 1×107 / mL. The purchased K562 (target cells) cells were thawed and revived, and passaged 3 times to restore and stabilize their growth state, and the concentration of K562 cells (target cells) was adjusted to 1×105 / mL. The effector-target cells were co-cultured, and experimental wells, control wells, natural release wells, and maximum release wells were set up with two additional wells for each group. Incubate in a 37°C, 5% CO2 incubator for 2 hours, as shown in Table 2. The culture supernatant was taken and the LDH value was detected by a biochemical analyzer, and the NK cell activity (%) was calculated = (experimental well OD value-natural release well OD value) / maximum release well OD value) × 100%. By performing a paired t-test analysis, it was found that the measurement results between the experimental group and the control group showed statistically significant differences (t(2) = 25.64, p < 0.01) as shown in Fig.13This result suggests that nucleic acid aptamer E1 restores part of the activity of NK cells by targeting TIGIT molecules and has a significant impact on the activity of NK cells.

[0081] Table 2. Sample addition system for investigating the effect of E1 on NK cells (n=3)

[0082]

[0083] Finally, it should be noted that the above-described embodiments are only part of the embodiments of the present invention and cannot be used to limit the present invention. All equivalent changes and modifications made to the patent scope of the present invention and the contents of the specification should still fall within the scope of the present invention.

Claims

1. A nucleic acid aptamer of a T cell immunoglobulin and an immunoreceptor tyrosine inhibitory motif domain protein, characterized in that: The nucleic acid aptamer is nucleic acid aptamer E1, and its sequence is: 5'-TCAAGTCACAGGTTCCAGGTCACGGAGCACCGTGAGCGAAGGCATTGTCCTGGGAATAGGCACTGACACGACACT-3'.

2. The nucleic acid aptamer according to claim 1, characterized in that: At 25 °C, 100 mM Na + , 1 mM Mg 2+ Under the conditions, the spatial structure of the nucleic acid aptamer E1 is as follows:

3. The nucleic acid aptamer according to claim 1, characterized in that: The 5' end or 3' end of the nucleic acid aptamer E1 is chemically modified with a fluorescent group, an amino group, biotin, digoxigenin or polyethylene glycol.

4. The nucleic acid aptamer according to claim 3, characterized in that: The 5' end of the nucleic acid aptamer E1 is modified with a FAM group.

5. Use of the nucleic acid aptamer according to any one of claims 1 to 4 in the preparation of a reagent, a kit or a sensor for detecting TIGIT.

6. Use of the nucleic acid aptamer according to any one of claims 1 to 4 in preparing a reagent for separation and enrichment of TIGIT in a sample.

7. Use of the nucleic acid aptamer according to any one of claims 1 to 4 in the preparation of a TIGIT site blocker.

8. A kit for specifically recognizing TIGIT, characterized in that: It comprises the nucleic acid aptamer according to any one of claims 1 to 4.

Images