A muscle repair material and its preparation method and use

Abstract

The present invention belongs to the field of biomedical materials, and specifically discloses a muscle repair material and a preparation method and use thereof, wherein the muscle repair material is a three-dimensional scaffold prepared from methacrylated gelatin and VCAM-1 aptamers. The present invention utilizes the VCAM-1 aptamer with unique affinity for muscle repair effector cells to achieve directional and efficient recruitment of effector cells to the damaged area, thereby achieving self-repair of the muscle damaged area, avoiding the complications caused by free muscle flap transplantation commonly used in the current clinical treatment of volumetric muscle loss, as well as the drawbacks of exogenous cell transplantation, and also breaking through the current limitation that the aptamer connected to the carrier can only be used as a carrier for other drugs and has no muscle repair effect itself.

Description

Technical Field

[0001] The invention belongs to the field of biomedical materials, and in particular relates to a muscle repair material and a preparation method and application thereof. Background Art

[0002] Muscle injury is a microscopic injury or partial or complete tear of the muscle caused by active and strong contraction or passive over-stretching of the muscle. Muscle injury has different manifestations depending on the degree and type of injury, such as pain, swelling, cramps, weakened muscle strength, and limited mobility. Muscle injury is an inevitable part of sports medicine, which not only affects the competitive performance of athletes, but also threatens the health and quality of life of the general population.

[0003] Nucleic acid aptamers, including ssDNA or RNA oligonucleotides, are highly promising candidate chemokines and have been widely used in disease diagnosis, treatment and tissue engineering. Compared with antibodies and peptides, nucleic acid aptamers have obvious advantages such as high affinity and specificity with target cells, small size, customizable structure, easy chemical modification, low synthesis cost, low immunogenicity and high stability. Professor Su Jiacan's team from the Institute of Translational Medicine of Shanghai University used Cell-SELEX technology to screen and identify an ssDNA nucleic acid aptamer, and connected it to nanoliposomes to construct aptamer-targeted liposomes Lipo-PEG-apt, which can effectively transport drugs directly into damaged muscle tissue as a carrier to repair damaged muscle tissue. However, the repair effect of aptamers that only play a targeting role on muscle damage is limited by the drugs they carry, resulting in the treatment effect being affected by multiple factors such as the patient's own conditions and drug pharmacokinetics, making the repair effect unstable, and it is even more impossible to achieve effective repair when facing large-volume muscle defects.

[0004] The efficient recruitment of endogenous repair effector cells at the site of injury and defect provides a new repair perspective for muscle injury. At present, there are no reports at home and abroad on the in vivo recruitment of muscle repair effector cells in muscle tissue through nucleic acid aptamers to repair damaged muscles. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a VCAM-1 aptamer, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0006] The present invention also provides a use of the aforementioned VCAM-1 aptamer in preparing a muscle repair material.

[0007] The present invention also provides a muscle repair material, which is a three-dimensional scaffold prepared from methacrylated gelatin and a VCAM-1 aptamer having a nucleotide sequence as shown in SEQ ID NO: 1;

[0008] The molar ratio of the methacrylated gelatin to the VCAM-1 aptamer is 9000:1.

[0009] Furthermore, the 5' end of the VCAM-1 aptamer is modified with a thiol group, and the modified nucleotide sequence is SH-(CH 2 ) 6 - ATACCAGCTTATTCAATTGGACACGGCAAAGGGGT

[0010] ATAGCCTACCGGACCGTGAACATGGAATGGTGTGCTGCGTGGAGATAGTAAGTGCAATCT.

[0011] Furthermore, the VCAM-1 aptamer is combined with methacrylated gelatin through Michael addition reaction, and then electrospinning is performed to form a three-dimensional scaffold.

[0012] The present invention also provides a method for preparing the aforementioned muscle repair material, comprising the following steps:

[0013] The thiol-modified VCAM-1 aptamer is added to methacrylate-acylated gelatin for reaction, and the liquid after the reaction is completed is taken to remove bubbles and electrospin to obtain the product.

[0014] Furthermore, the molar ratio of the methacrylated gelatin to the VCAM-1 aptamer is 9000:1

[0015] Furthermore, the reaction conditions are: stirring at room temperature for 5 minutes.

[0016] Furthermore, the electrospinning conditions are: spinning voltage 15 kV, flow rate 6 mL / h, receiving distance 20 cm, and rotation speed 2800 r / min.

[0017] Finally, the present invention provides a use of the aforementioned VCAM-1 aptamer and the aforementioned muscle repair material in preparing a drug for treating muscle damage.

[0018] In the early stage of the present invention, single-cell RNA sequencing technology was used to clarify that the target transmembrane glycoprotein vascular cell adhesion molecule-1 (VCAM-1) is expressed on the surface of repair effector cells of muscle tissue after acute injury. On this basis, VCAM-1 nucleic acid aptamers with high specificity for repair effector cells were screened by exponential enrichment ligand system evolution technology (SELEX). The present invention uses VCAM-1 aptamers with unique affinity for muscle repair effector cells to achieve directional and efficient recruitment of effector cells to the damaged area, thereby achieving self-repair of the muscle damaged area, avoiding the complications caused by exogenous cell delivery brought about by free muscle flap transplantation commonly used in the current clinical treatment of volumetric muscle loss, limited utilization of autologous tissue, infection, necrosis and other drawbacks, and also breaks through the current limitation that aptamers connected to carriers can only be used as other drug carriers, targeting damaged areas, and have no muscle repair effect themselves.

[0019] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0020] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Results of in vitro affinity experiments of VCAM-1 aptamers with muscle repair effector cells; a: Fluorescence images of VCAM-1 aptamers modified with FITC 3' end after co-incubation with MuSCs and activated HUVECs, FAPs and MPs; b: Quantitative statistical analysis data of affinity of VCAM-1 aptamers with MuSCs and activated HUVECs, FAPs and MPs;

[0022] Figure 2 Results of in vitro transwell experiments on electrospun scaffolds loaded with VCAM-1 aptamers and muscle repair effector cells; a: Chemotaxis experiments on effector cells in vitro with or without VCAM-1 aptamer-functionalized scaffolds (scaffolds loaded with aptamers and scaffolds without aptamers), and crystal violet staining of cells migrating to the lower chamber of the transwell; b: Quantitative statistical analysis of the number of cell migration;

[0023] Figure 3Results of affinity and chemotaxis experiments between human muscle stem cells and VCAM-1 aptamers; a. Expression of VCAM-1 on the membrane surface of human MuSCs; b: In vitro affinity experiment between human MuSCs and VCAM-1 aptamer; c: Schematic diagram of in vitro Transwell experiment of human MuSCs; d: Crystal violet staining of cells migrating in the Transwell experiment chamber; e: Quantitative statistical analysis of the migration of human MuSCs in two groups of scaffolds modified or unmodified with VCAM-1 aptamer;

[0024] Figure 4 In vivo affinity experiment of electrospun scaffold loaded with VCAM-1 aptamer to muscle repair effector cells; a: Pax7 creER / ROSA nT-nG a: PAX7 lineage tracing of tool mice showed the infiltration of MuSCs in the VML damaged areas of different groups; b: PAX7 immunofluorescence staining showed the infiltration of MuSCs in the VML damaged areas of different groups; c: Quantitative analysis and statistical results of MuSCs infiltration in the damaged areas of different groups using immunofluorescence technology. DETAILED DESCRIPTION

[0025] The raw materials and equipment used in the specific embodiments of the present invention are all known products, which are obtained by purchasing commercially available products. Among them, the nucleotide sequence of the VCAM-1 aptamer SEQ ID NO: 1 5'-ATACCAGCTTATTCAATTGGACACGGCAAAGGGGTATAGCCTACCGGACCGTGAACATGGAATGGTGTGCTGCGTGGAGATAGTAAGTGCAATCT-3' was chemically synthesized by Shenzhen BGI Co., Ltd.;

[0026] The 5' end of the VCAM-1 aptamer was modified with thiol groups, also by Shenzhen BGI Co., Ltd. The nucleotide sequence 5'-3' after thiol modification is:

[0027] SH-(CH 2 ) 6 - ATACCAGCTTATTCAATTGGACACGGCAAAGGGGTATAGCC

[0028] TACCGGACCGTGAACATGGAATGGTGTGCTGCGTGGAGATAGTAAGTGCAATCT

[0029] Example 1. Preparation of the muscle repair material of the present invention

[0030] Methacrylated gelatin (GelMA) was dissolved in hexafluoroisopropanol to prepare a solution containing 90 mg of GelMA per 1 ml of hexafluoroisopropanol, and then thiol-modified VCAM-1 aptamer was added to make the molar ratio of GelMA to aptamer 9000:1. The mixture was slowly stirred at room temperature for 5 minutes, during which the thiol group of aptamer and the double bond in GelMA underwent Michael addition reaction to connect aptamer to GelMA. The reaction solution was taken to remove bubbles and then electrospun to obtain a repair material with a three-dimensional scaffold structure.

[0031] The electrospinning conditions were as follows: spinning voltage 15 kV, flow rate 6 mL / h, receiving distance 20 cm, and rotation speed 2800 r / min.

[0032] Comparative Example 1 Muscle repair material

[0033] The difference between this comparative example and Example 1 is that no thiol-modified VCAM-1 aptamer is added during the preparation.

[0034] The beneficial effects of the present invention are described below through test examples.

[0035] Experimental Example 1: In vivo recruitment of muscle repair effector cells using VCAM-1 nucleic acid aptamers

[0036] 1. Affinity of VCAM-1 aptamer for muscle repair effector cells

[0037] The 3' end of VCAM-1 aptamer was modified with the fluorescent group FITC. After incubating the fluorescent group-modified aptamer with effector cells (mouse-derived muscle stem cells MuSCs, activated human umbilical vein endothelial cells HUVECsActivated, activated fibroadipogenic progenitor cells FAPsActivated, activated mononuclear phagocytes MPsActivated, unactivated human umbilical vein endothelial cells HUVECs, unactivated mononuclear phagocytes MPs) in a cell incubator for 30 minutes, the affinity of muscle repair effector cells was observed under a fluorescence microscope.

[0038] Results Figure 1 ,from Figure 1 It can be seen that after the FITC3'-modified VCAM-1 aptamer was co-incubated with MuSCs, ECs, FAPs and MPs (Macrophages) in an activated state, strong green fluorescence was observed around the nucleus. VCAM-1aptamer binds to the cell membrane VCAM-1 transmembrane protein, indicating that VCAM-1 aptamer has affinity with these four cell groups.

[0039] 2. Investigate the chemotaxis of VCAM-1 aptamer on muscle repair effector cells

[0040] Using the three-dimensional scaffold structure repair materials prepared in Example 1 and Comparative Example 1, a transwell experiment was performed to investigate the chemotaxis of VCAM-1 aptamer on muscle repair effector cells. 4 The cells (MuSCs, activated ECs, FAPs and MPs, unactivated FAPs) were resuspended in 100 μL serum-free DMEM and placed in the upper chamber, and the three-dimensional scaffolds prepared in Example 1 and Comparative Example 1 containing 200 μL DMEM with 10% fetal bovine serum were placed in the lower chamber for 36 hours, and then the cells were fixed with 4% paraformaldehyde and stained with crystal violet. The results are expressed as the average number of cells per field of view ± standard deviation.

[0041] Results Figure 2 ,from Figure 2 It can be seen that compared with the scaffold without VCAM-1 aptamer, the VCAM-1 aptamer-functionalized scaffold attracted more MuSCs and activated ECs, FAPs and MPs to migrate to the lower chamber of the Transwell chamber. There was no statistical difference in the in vitro chemotaxis of the VCAM-1 aptamer-modified scaffold and the unmodified scaffold to the unactivated FAPs. It can be seen that when the muscle is damaged and ECs, FAPs and MPSs are activated, these activated cells and MuSCs can be recruited around the VCAM-1 aptamer-functionalized scaffold to accelerate the repair of damaged muscles.

[0042] 3. Affinity and chemotaxis of VCAM-1 aptamer to human muscle stem cells MuSCs

[0043] The PRONASE enzyme method was used to extract human MuSCs cells, and immunofluorescence technology was used to explore the expression of VCAM-1 on the surface of human MuSCs membranes. The results showed that VCAM-1 membrane protein was expressed on the surface of human MuSCs membranes ( Figure 3 a). Therefore, VCAM-1 aptamer was used to test the affinity and chemotaxis of human-derived MuSCs cells expressing VCAM-1 membrane protein.

[0044] In vitro affinity experiment: 20,000 human-derived MuSCs cells were seeded into a 24-well plate at a density of 10,000 per well. After they adhered to the wall, 200 μL of 100 nM FITC-labeled aptamer was added to each well and incubated in a cell incubator for 30 minutes. Hochest was used to stain the nuclei for 15 minutes, and the cells were washed three times with PBS before imaging and analyzing them under a fluorescence microscope.

[0045] In vitro chemotaxis assay: 10 4 Human MuSCs cells were resuspended in 100 μL serum-free DMEM and placed in the upper chamber. VCAM-1 aptamer-modified and unmodified scaffolds (prepared according to Example 1 and Comparative Example 1, respectively) containing 200 μL DMEM with 10% fetal bovine serum were placed in the lower chamber for 36 hours. The cells were then fixed with 4% paraformaldehyde and stained with crystal violet. The results are expressed as the average number of cells per field of view ± standard deviation.

[0046] Results Figure 3 b~e. From the results of in vitro affinity experiments ( Figure 3 b) Visible: Strong green fluorescence around the nucleus of human-derived MuSCs cells, indicating that human-derived MuSCs have a strong affinity for VCAM-1 aptamer; from the results of in vitro chemotaxis experiments Figure 3 As shown in c~e: compared with the scaffolds not modified with VCAM-1 aptamer, the scaffolds loaded with VCAM-1aptamer have stronger chemotaxis to MuSCs, and this is statistically significant; it can be seen that VCAM-1aptamer also has strong affinity and chemotaxis to human MuSCs in vitro, providing a strong basis for further clinical transformation.

[0047] 4. In vivo affinity experiment of VCAM-1 aptamer functionalized scaffolds for repair effector cells

[0048] 4.1. Preparation of large-volume masseter muscle defect model in mice

[0049] Reference Ning Zhao et al. A critical size volumetric muscle loss model inmousemasseter with impairedmastication on nutrition, Cell Proliferation, January 2024; The specific construction method is: the mice were anesthetized by inhalation of 1% ~ 3% isoflurane, and buprenorphine sustained-release (0.8mg / mL) was given for analgesia. The maxillofacial incision was depilated and disinfected with 75% alcohol and iodine. All operations were performed by the same surgeon. The mice were weighed before surgery, the skin was incised, the masseter muscle was exposed, and a 2.0mm diameter biopsy device was used to form a full-thickness defect to the bone surface in the middle ventral area of ​​the masseter muscle. Avoid damaging facial blood vessels and nerves during the operation. The deep fascia and the surface skin were sutured interruptedly with 5-0 absorbable sutures.

[0050] 4.2. Drug administration and results

[0051] A total of 24 mice with large muscle defect models from the same batch were randomly divided into a no repair (No Repair) group, a disordered scaffold (RS) group, an ordered scaffold (AS) group, and an ordered scaffold + aptamer (As+Apt) group, with 6 mice in each group; mice in the No Repair group were not repaired after injury, mice in the RS group were implanted with disordered and messy scaffolds (i.e., hexafluoroisopropanol solution containing 90 mg GelMA per 1 ml was spun according to the size of the defect under the conditions of voltage 15 kV, flow rate 6 mL / h, and receiving distance 20 cm, and then trimmed into a scaffold in accordance with the defect shape) for repair; mice in the AS group were implanted with ordered aligned scaffolds (prepared according to Comparative Example 1) for repair after injury; mice in the As+Apt group were implanted with electrospinning scaffolds loaded with VCAM-1aptamer (prepared according to Example 1) for repair after injury. At the same time, 6 healthy mice were used as the control group (uninjured).

[0052] 14 days after implantation, immunofluorescence and Pax7 creER / ROSA nT-nG The tracing tool found that the number of muscle stem cells in the uninjured group accounted for about 2% of the total number of cells; the proportion of muscle stem cells in the No Repair group, RS group, and AS group was significantly lower than that in the uninjured group; the proportion of muscle stem cells in the injured area of ​​the As+Apt group was significantly higher than that in the uninjured group, with significant differences ( Figure 4 This proves that VCAM-1aptamer has a powerful function in recruiting muscle stem cells in the injured area and has the effect of accelerating the repair of damaged muscles.

[0053] In summary, the VCAM-1 nucleic acid aptamer of the present invention has a strong affinity and chemotaxis for repair effector cells. After being directly injected into the damaged muscle area without volume defect, the repair effector cells are efficiently recruited to the muscle damaged area, which can achieve rapid self-repair of damaged muscles. When there is a large volume defect of muscle, i.e., muscle volume defect, the VCAM-1 nucleic acid aptamer is carried on a scaffold and implanted into the damaged area. Through the powerful muscle stem cell recruitment function of the VCAM-1 nucleic acid aptamer, the regeneration and repair of the defective muscle can also be accelerated.

Claims

1. Use of VCAM-1 aptamer in preparing muscle repair material, characterized in that: The nucleotide sequence of the VCAM-1 aptamer is shown in SEQ ID NO:

1.

2. A muscle repair material, characterized in that: It is a three-dimensional scaffold prepared from methacrylic acid acylated gelatin and a VCAM-1 aptamer with a nucleotide sequence as shown in SEQ ID NO: 1; The molar ratio of the methacrylated gelatin to the VCAM-1 aptamer is 9000:

1.

3. The muscle repair material according to claim 2, characterized in that: The 5' end of the VCAM-1 aptamer is modified with a thiol group, and the modified nucleotide sequence is SH-(CH2)6-ATACCAGCTTATTCAATTGGACACGGCAAAGGGGTATAGCCTACCGGACCGTGAACATGGAATGGTGTGCTGCGTGGAGATAGTAA GTGCAATCT.

4. The muscle repair material according to claim 3, characterized in that: The VCAM-1 aptamer is combined with methacrylated gelatin through Michael addition reaction, and then a three-dimensional scaffold is prepared by electrospinning.

5. A method for preparing the muscle repair material according to any one of claims 2 to 4, characterized in that: The steps include: The thiol-modified VCAM-1 aptamer is added to methacrylated gelatin for reaction, and the liquid after the reaction is completed is taken to remove bubbles and electrospin to obtain the product.

6. The preparation method according to claim 5, characterized in that: The molar ratio of the methacrylated gelatin to the VCAM-1 aptamer is 9000:

1.

7. The preparation method according to claim 5, characterized in that: The reaction conditions are: stirring at room temperature for 5 min.

8. The preparation method according to claim 5, characterized in that: The electrospinning conditions are as follows: spinning voltage 15 kV, flow rate 6 mL / h, receiving distance 20 cm, and rotation speed 2800 r / min.

9. Use of a VCAM-1 aptamer or a muscle repair material according to any one of claims 2 to 4 in the preparation of a drug for treating muscle damage, characterized in that: The nucleotide sequence of the VCAM-1 aptamer is shown in SEQ ID NO:1.

Images