Antibodies to novel bunyaviruses and uses thereof

By providing a novel Bunyavirus antibody with high titer, affinity, and sensitivity, the problem of delayed detection of novel Bunyavirus in existing technologies has been solved, enabling highly sensitive early diagnosis and detection, and is particularly suitable for the detection of SFTSV.

CN119119252BActive Publication Date: 2025-11-04ZHENGZHOU IMMUNO BIOTECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410754174.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-12
Publication Date
2025-11-04
Estimated Expiration
2044-06-12

AI Technical Summary

Technical Problem

The current lack of suitable antigen detection antibodies for the new Bunyavirus has led to delays and insufficient sensitivity in early diagnosis and testing, affecting the effectiveness of epidemic prevention and control.

Method used

We provide high-titer, high-affinity, and high-sensitivity antibodies against the new Bunyavirus for double-antibody sandwich assays, which can specifically bind to different mutation types of the new Bunyavirus.

Benefits of technology

It enables early diagnosis and detection of the new Bunyavirus, with a detection sensitivity as low as 0.5 ng/mL, and is suitable for early diagnosis and detection of SFTSV.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
Patent Text Reader

Abstract

The present application relates to the technical field of in vitro diagnosis, in particular to antibodies of new bunyavirus and application thereof. The present application provides antibodies of new bunyavirus and application thereof. The antibodies of new bunyavirus screened by the present application can specifically bind to new bunyavirus of different mutation types, have high sensitivity and strong specificity, and have good market application prospect. The detection sensitivity of SFTSV is determined by using a double-antibody sandwich method, and the results show that the antibodies of new bunyavirus provided by the present application have a detection sensitivity as low as 0.5 ng / mL, and can be used for early diagnosis and detection of SFTSV.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of in vitro diagnostic technology, specifically to antibodies against the novel Bunyavirus and their applications. Background Technology

[0002] In 2009, China reported its first emerging infectious disease, characterized by fever, thrombocytopenia, leukopenia, and multiple organ dysfunction, with a high mortality rate. The pathogen, novel Bunyavirus (also known as Severe Fever with Thrombocytopenia Syndrome Virus, SFTSV), was reportedly isolated and confirmed by the Chinese Center for Disease Control and Prevention in 2010. The disease caused by this virus was named Severe Fever with Thrombocytopenia Syndrome (SFTS). This virus belongs to the sandfly virus genus, and tick bites are the primary route of transmission. Reports of this disease have been found in China, Japan, and South Korea.

[0003] SFTSV is a spherical viral particle with a diameter between 80 and 100 nm. Its viral envelope consists of a lipid bilayer and two regularly arranged transmembrane glycoproteins, Gn and Gc, forming a spike-like surface. The SFTSV genome consists of three single-stranded negative-sense RNA segments: large (L), medium (M), and small (S). Similar to other viruses in the Bunyaviridae family, the 3′ and 5′ ends of the viral genome are complementary, forming a non-covalently closed circular RNA. The L segment encodes an RNA-dependent RNA polymerase consisting of 2084 amino acids; the M segment encodes a membrane protein precursor with 1073 amino acids, which, after translation, is modified by intracellular proteases to form two glycoproteins, Gn and Gc; the S segment is a ambiguous RNA, encoding both the nucleocapsid protein NP and the non-structural protein NSs.

[0004] Since specific therapeutic drugs and effective vaccines have not yet been successfully developed, early diagnosis has become a crucial measure for epidemic prevention and control. Currently, early nucleic acid diagnosis and clinical diagnosis are important bases for confirmation. Although nucleic acid diagnosis is fast, it is affected by testing sites, and the test results have a certain lag. Serological diagnosis detects the body's immune response after pathogen infection. This response lasts for a long time, is stable, and dynamically changes with the progression of the disease. Therefore, serological diagnosis is also an important means of early diagnosis and assessment of the infection status.

[0005] Currently, there are no commercially available antibodies suitable for SFTSV antigen detection, both domestically and internationally. Therefore, establishing and developing antibody-based detection and treatment products is of great practical significance for the detection and intervention of SFTSV. Summary of the Invention

[0006] In view of this, the technical problem to be solved by the present invention is to provide antibodies against the new Bunyavirus and their applications. The present invention provides antibodies against the new Bunyavirus with high titer, affinity and sensitivity, which can be used for the detection of the new Bunyavirus by the double antibody sandwich method and can be used for the early diagnosis and detection of SFTSV.

[0007] This invention provides an antibody against a novel Bunyavirus, comprising the following amino acid sequence.

[0008] (1) The three CDR regions of its heavy chain have amino acid sequences as shown in any one of SEQ ID NO:1~6; the three CDR regions of its light chain have amino acid sequences as shown in any one of SEQ ID NO:7~12;

[0009] (2) An amino acid sequence that has undergone substitution, addition, or deletion of one or more amino acids as shown in (1), but has the same or similar function as the amino acids shown in (1); or

[0010] (3) An amino acid sequence that has at least 80% homology with the amino acid sequence shown in (1) or (2).

[0011] In some embodiments, the three CDR regions of the heavy chain of the novel Bunyavirus antibody have amino acid sequences as shown in SEQ ID NO: 1, 2 and 3, respectively;

[0012] In some embodiments, the three CDR regions of the heavy chain of the novel Bunyavirus antibody have amino acid sequences as shown in SEQ ID NO:4, 5 and 6, respectively;

[0013] In some embodiments, the three CDR regions of the light chain of the novel Bunyavirus antibody have amino acid sequences as shown in SEQ ID NO: 7, 8 and 9, respectively;

[0014] In some embodiments, the three CDR regions of the light chain of the novel Bunyavirus antibody have amino acid sequences as shown in SEQ ID NO: 10, 11 and 12, respectively.

[0015] In this invention, the antibody against the novel Bunyavirus contains,

[0016] (i) The four FR regions of its heavy chain each have an amino acid sequence as shown in any one of SEQ ID NO:13~20; the four FR regions of its light chain each have an amino acid sequence as shown in any one of SEQ ID NO:21~28;

[0017] (ii) An amino acid sequence that has undergone substitution, addition, or deletion of one or more amino acids as shown in (i), but has the same or similar function as the amino acids shown in (i); or

[0018] (iii) An amino acid sequence that has at least 80% homology with the amino acid sequence shown in (i) or (ii).

[0019] In this invention, the sequence having at least 80% homology is an amino acid sequence obtained by substituting, adding, or deleting one or more amino acids based on the original sequence, wherein the plurality of amino acids is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38.

[0020] In some embodiments, the four FR regions of the heavy chain of the novel Bunyavirus antibody have amino acid sequences as shown in SEQ ID NO: 13, 14, 15 and 16, respectively;

[0021] In some embodiments, the four FR regions of the heavy chain of the novel Bunyavirus antibody have amino acid sequences as shown in SEQ ID NO: 17, 18, 19 and 20, respectively;

[0022] In some embodiments, the four FRs of the light chain of the novel Bunyavirus antibody have amino acid sequences as shown in SEQ ID NO:21, 22, 23 and 24, respectively;

[0023] In some embodiments, the four FRs of the light chain of the novel Bunyavirus antibody have amino acid sequences as shown in SEQ ID NO:25, 26, 27 and 28, respectively.

[0024] In some specific embodiments, the antibody heavy chain variable region of the new Bunyavirus includes the CDR region shown in SEQ ID NO:1, 2 and 3 and the FR region shown in SEQ ID NO:13, 14, 15 and 16.

[0025] In some specific embodiments, the antibody heavy chain variable region of the novel Bunyavirus includes the CDR region shown in SEQ ID NO:4, 5 and 6 and the FR region shown in SEQ ID NO:17, 18, 19 and 20.

[0026] In some specific embodiments, the antibody light chain variable region of the novel Bunyavirus includes the CDR region shown in SEQ ID NO:7, 8 and 9 and the FR region shown in SEQ ID NO:21, 22, 23 and 24.

[0027] In some specific embodiments, the antibody light chain variable region of the novel Bunyavirus includes the CDR region shown in SEQ ID NO:10, 11 and 12 and the FR region shown in SEQ ID NO:25, 26, 27 and 28.

[0028] In some embodiments, the antibody heavy chain variable region of the novel Bunyavirus has an amino acid sequence as shown in SEQ ID NO:29 or 30;

[0029] The antibody light chain variable region of the novel Bunyavirus has an amino acid sequence as shown in SEQ ID NO:31 or 32.

[0030] In some specific embodiments, the antibody heavy chain variable region of the novel Bunyavirus has an amino acid sequence as shown in SEQ ID NO:29;

[0031] The antibody light chain variable region of the novel Bunyavirus has an amino acid sequence as shown in SEQ ID NO:31.

[0032] In some specific embodiments, the antibody heavy chain variable region of the novel Bunyavirus has an amino acid sequence as shown in SEQ ID NO:30;

[0033] The antibody light chain variable region of the novel Bunyavirus has an amino acid sequence as shown in SEQ ID NO:32.

[0034] In some embodiments, the antibody against the novel Bunyavirus further includes a constant region, wherein the constant region of the heavy chain is IgG1 and the constant region of the light chain is the κ chain.

[0035] This invention provides biological materials comprising at least one of the following I to VI:

[0036] Ⅰ. Nucleic acid encoding the antibody against the novel Bunyavirus;

[0037] II. An expression vector containing the nucleic acid;

[0038] III. Transform or transfect host cells with the expression vector;

[0039] IV. The conjugate prepared by coupling the antibody against the novel Bunyavirus with a solid or semi-solid medium;

[0040] V. Antibodies against the novel Bunyavirus, which have been chemically or biologically labeled;

[0041] VI. Conjugates prepared by chemically or biologically labeling antibodies against the novel Bunyavirus and conjugating them to a solid or semi-solid medium.

[0042] The expression vector of the present invention can express antibodies against the new Bunyavirus in a host cell, wherein the host cell is selected from Escherichia coli, yeast, insect cells or mammalian cells.

[0043] The chemical marker is an isotope, immunotoxin, and / or chemical drug; the biomarker is biotin, avidin, or an enzyme marker. The enzyme marker is preferably horseradish peroxidase or alkaline phosphatase.

[0044] The solid or semi-solid medium refers to any support to which the antibody or labeled antibody described in this invention can attach, including but not limited to nitrocellulose membranes, polyvinylidene fluoride (PVDF) membranes, iPDMS chips, microplates, polystyrene plates, microparticles, microcarriers, gels, etc.

[0045] The present invention provides a method for preparing the antibody, comprising: culturing host cells in the biological material to induce the expression of the antibody against the novel Bunyavirus.

[0046] This invention provides the use of at least one of the following (i) to (iii) in the preparation of a detection reagent or kit for novel Bunyavirus:

[0047] i. The antibodies against the aforementioned new Bunyavirus;

[0048] ii. The aforementioned biomaterials;

[0049] iii. Antibodies against the new Bunyavirus were prepared using the method described above.

[0050] This invention provides a detection reagent or detection kit, comprising at least one of the following ① to ③:

[0051] ① The antibodies against the aforementioned new Bunyavirus;

[0052] ② The aforementioned biomaterials;

[0053] ③ Antibodies against the new Bunyavirus were prepared using the method described above.

[0054] In some embodiments, the detection kit includes a double-antibody sandwich detection kit, which includes a coating antibody and a labeled antibody, wherein,

[0055] The heavy chain variable region of the coated antibody has an amino acid sequence as shown in SEQ ID NO:29; the light chain variable region of the coated antibody has an amino acid sequence as shown in SEQ ID NO:31.

[0056] The heavy chain variable region of the labeled antibody has an amino acid sequence as shown in SEQ ID NO:30; the light chain variable region of the labeled antibody has an amino acid sequence as shown in SEQ ID NO:32.

[0057] This invention provides a method for detecting a new Bunyavirus, comprising: detecting a sample using the aforementioned detection reagent or detection kit.

[0058] This invention provides antibodies against the novel Bunyavirus and their applications. The antibodies against the novel Bunyavirus screened by this invention can specifically bind to different mutant types of the novel Bunyavirus, exhibiting high sensitivity and strong specificity, and possessing excellent market application prospects. The detection sensitivity of SFTSV was determined using a double-antibody sandwich method. Results showed that the detection sensitivity of the novel Bunyavirus antibody provided by this invention is as low as 0.5 ng / mL, making it suitable for the early diagnosis and detection of SFTSV. Attached Figure Description

[0059] Figure 1 The figure shows the results of antibody detection sensitivity using the double antibody sandwich method. In the figure, the first antibody is the coating antibody and the second antibody is the labeled antibody. Detailed Implementation

[0060] This invention provides antibodies against the novel Bunyavirus and their applications. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately alter and combine the methods and applications described herein without departing from the scope and relevance of this invention to implement and apply the technology of this invention.

[0061] The test materials used in this invention are all commercially available products. The invention will be further illustrated below with reference to specific embodiments.

[0062] Example 1

[0063] (1) Antigen Immunization

[0064] The S fragment of the recombinant SFTSV nucleocapsid protein (NCBI Sequence: NC_043452.1) was mixed with an equal volume of Freund's complete adjuvant. This emulsion was subcutaneously injected into BALB / c mice at a dose of 0.15 mL. Fourteen days after the first immunization, a booster immunization was administered intraperitoneally (an equal volume of antigen mixed with Freund's incomplete adjuvant). After four booster immunizations, tail blood was collected for titer testing to determine if the titer met the fusion requirements. Three days before fusion, a booster immunization was administered intraperitoneally with the same dose of antigen, using the same method as above.

[0065] (2) Preparation of hybridoma cell lines

[0066] Spleens were collected from mice three days after the last immunization, placed in a petri dish, washed once with RPMI 1640 basal culture medium, ground, filtered, and a cell suspension was prepared. The suspension was centrifuged, the supernatant discarded, and the cells resuspended in RPMI 1640 basal culture medium. This process was repeated three times to obtain immunized spleen cells. Mouse myeloma cells were selected for 8-azoguanine, cultured to the logarithmic growth phase, and a cell suspension was prepared. The suspension was centrifuged, the supernatant discarded, and the cells resuspended in RPMI 1640 basal culture medium. This process was repeated three times to obtain myeloma cells.

[0067] Myeloma cells and immune spleen cells were mixed at a ratio of 1:10 and washed once with RPMI 1640 basal culture medium in a centrifuge tube. After centrifugation, the supernatant was discarded, and the cells were remixed. 2 mL of 50% PEG1500 was slowly added for fusion. After 1 minute of fusion, 20 mL of RPMI 1640 basal culture medium was added to terminate cell fusion. After centrifugation, the supernatant was discarded, and the cells were resuspended in RPMI 1640 selection culture medium. The cells were aliquoted into 96-well plates at a volume of 50 μL / well and cultured at 37°C with 5% CO2. On day 6, the culture medium was replaced twice with HAT medium (RPMI 1640 complete culture medium containing HAT).

[0068] (3) Hybridoma cell screening

[0069] The nucleocapsid protein of recombinant SFTSV was diluted with 0.05M pH 9.6 carbonate buffer to a final concentration of 1 μg / mL. 0.1 mL was added to each well of a 96-well polystyrene plate and incubated overnight at 4°C. The next day, 0.15 mL / well of 0.02M pH 7.2 PBS containing 10% fetal bovine serum was added and the plate was blocked at 37°C for 2 hours for detection. On the seventh day after fusion, 0.1 mL of cell supernatant was added to the above 96-well detection plate and incubated at 37°C for 30 minutes. After washing six times with PBST, 2000-fold diluted horseradish peroxidase-labeled goat anti-mouse IgG was added, and the plate was washed again at 37°C for 30 minutes. Then, 100 µl of TMB chromogenic solution was added to each well, and after 10 minutes of development, 100 µl of stop solution was added to each well. The OD value of each well was measured using a microplate reader. RPMI 1640 complete culture medium was used as a negative control. A well with a measured value ≥ 2.1 of the control value was considered a positive cell well.

[0070] Antibody-positive cells were cloned at 1 cell / well in a 96-well plate using limiting dilution. Positive cells were screened and cloned three times consecutively using the same method. After expansion culture, the cells were cryopreserved in culture medium containing 10% DMSO at a cell density of 102. 6 Cells / mL. Three stable hybridoma cell lines were obtained and named 2B5, 3C1, and 6E3, respectively.

[0071] (4) Preparation of monoclonal antibodies

[0072] Select robust BALB / c mice aged 6–8 weeks and inject each mouse intraperitoneally with 0.5 mL of norperidine; 10 days later, inject 1 × 10⁻⁶ ozonoside intraperitoneally. 6 Hybridoma cells. Ascites will be produced 7-10 days after cell inoculation. Closely observe the animal's health and signs of ascites. When ascites is as abundant as possible and the mouse is close to death, sacrifice the mouse and use a dropper to aspirate the ascites into a test tube. Generally, 5-10 mL of ascites can be obtained from one mouse. Collect the ascites, centrifuge to obtain the supernatant, and store it in a -20°C freezer.

[0073] Collect the supernatant from the ascites fluid, dilute it with 3 times its volume of PBS, and filter it through filter paper. Add the resulting filtrate to a protein G affinity chromatography column equilibrated with PBS at a flow rate of 1 mL / min. Wash with PBS at a flow rate of 1 mL / min to remove any unadsorbed material until the absorbance at OD280 nm reaches baseline. Elute with 0.1 M glycine elution buffer (pH 2.5) and recover the antibody. Neutralize the recovered solution with 0.1 M Tris (pH 8.8), adjust the antibody concentration to a suitable level by ultrafiltration, and aliquot and store at -20°C.

[0074] (5) Valence determination

[0075] The recombinant SFTSV nucleocapsid protein was diluted to 1 μg / mL with 0.05 mmol / L, pH=9.6 CB buffer, and 50 μL / well was added to the microplate. The plate was incubated overnight at 4°C. After coating, the plate was blocked with 100 μL / well of Casein at 37°C for 2 hours. Antibodies prepared in step (4) with different dilution gradients were added to the SFTSV-coated microplate at 50 μL / well and incubated at 37°C for 30 minutes (negative control wells were prepared simultaneously with 0.05 mmol / L, pH=9.6 CB buffer). Horseradish peroxidase-labeled goat anti-mouse IgG enzyme-labeled secondary antibody (diluted 6000 times with blocking buffer) was added at 100 μL / well and incubated at 37°C for 30 minutes. 100 µl of TMB chromogenic solution was added to each well, and after 10 minutes of chromogenic development, 100 µl of stop solution was added to each well. The OD values ​​of each well were detected using a microplate reader. The results are shown in Table 1 below.

[0076] Table 1 Absorbance at different dilution factors

[0077]

[0078] Therefore, it can be seen that the titers of the three monoclonal antibodies obtained by this invention can all reach 1:128K, especially the monoclonal antibody 2B5, which has a titer of 1:512K, exhibiting a higher titer.

[0079] (6) Affinity test

[0080] Antibody affinity was determined using a Biacore T200 workstation. The affinity results are shown in Table 2. The antigen was SFTSV nucleocapsid protein.

[0081] The results are shown in Table 2. As can be seen, all three monoclonal antibodies, 2B5, 3C1, and 6E3, can bind efficiently to the nucleocapsid protein of SFTSV.

[0082] Table 2. Affinity assay data for three monoclonal antibodies.

[0083] (7) Identification of monoclonal antibody type

[0084] The three SFTSV monoclonal antibody subtypes were identified using an antibody subtype identification kit. The absorbance was measured at 450 nm using ELISA. The results showed that the three monoclonal antibodies, 2B5, 3C1, and 6E3, were all IgG1 with the κ light chain.

[0085] (8) Detection of SFTSV using the double-antibody sandwich method

[0086] Step A: Coat ELISA plates with three monoclonal antibodies, 2B5, 3C1, and 6E3, at a concentration of 10 μg / mL, and incubate overnight at 4°C. The plates are then blocked with 1% BSA for 2 hours the next day and washed three times.

[0087] Step B: Add 0.1 μg / ml to inactivate SFTSV, then serially dilute to 0.5 ng / ml, incubate at 37°C for 1 h, and wash 3 times.

[0088] Step C: Add other HRP-labeled antibodies (1:1000 dilution) with different sites from the coating antibody, incubate at 37°C for 1 h, wash 5 times with PBST, add luminescent substrate, and read the luminescence value on a luminometer.

[0089] See results Figure 1 (The first antibody in the label is the coating antibody, and the second antibody is the labeling antibody.) It can be seen that the three monoclonal antibodies 2B5, 3C1, and 6E3 can all be paired for the double-antibody sandwich method to detect SFTSV. Among them, 2B5 as the coating antibody and 3C1 as the labeling antibody show the best pairing effect, with a detection limit of less than 0.5 ng / mL. The detection limits of the other two paired antibodies are also less than 5 ng / mL.

[0090] (9) Monoclonal antibody sequencing

[0091] Primers were synthesized based on the constant region sequence of the antibody gene, and the genes of the two monoclonal antibodies 2B5 and 3C1 were sequenced. The results are shown below and in Table 3.

[0092] Monoclonal antibody 2B5 antibody sequence:

[0093] The sequences of the heavy chain variable regions CDR1 to CDR3 are shown in SEQ ID NO:1 to 3, respectively;

[0094] The sequences of the light chain variable regions CDR1 to CDR3 are shown in SEQ ID NO:7 to 9, respectively;

[0095] The sequences of the heavy chain variable regions FR1 to FR4 are shown in SEQ ID NO:13 to 16, respectively;

[0096] The sequences of the light chain variable regions FR1 to FR4 are shown in SEQ ID NO:21 to 24, respectively;

[0097] The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO:29, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO:33;

[0098] The amino acid sequence of the light chain variable region is shown in SEQ ID NO:31, and the nucleic acid sequence of the light chain variable region is shown in SEQ ID NO:34;

[0099] GAGGTGCAGCTGGTGGAGTCTGGGGGAGACTTGGTGAAGCCTGGAGGGTCCCTGAAACTCTCCTGTGCAGCCTCTGGATTCACTTTCAGTAACTATGCCATGTCTTGGGTTCGCCAGACTCCAGACAAGAGGCTGGAGTGGGTCGCAACCATTACTAGTGGTGGTAGTTACACCTAC TACCCAGACAGTGTGAAGGGGCGATTCACCATCTCCAGAGACAATGCCAAGAACACCCTGTACCTGCAAATGACCAGTCTGCGGTCTGAGGACACAGCCATGTATTTTTGTGCAAGACGGGATTACGACTATTTTGACTACTGGGGCCAAGGCACCACTCTCACAGTCTCCTCA (SEQ ID NO:33);

[0100] GACATCCAGATGACTCAGTCTCCAGCCTCCCTATCTGTATCTGTGGGACAAACTGTCACCATCACATGTCGTGCAAGTGAGAATATTAACAGTAATTTAGCATGGTATCAGCAGAAACAGGGAAAATCTCCTCAGCTCCTGGTCTATGCTGCAACAAACTTAG CAGATGGTGTGCCATCAAGGTTCAGTGGCAGTGGATCAGGCACACAGTACTCCCTCAAGATCAACAGCCTGCAGTCTGAAGATTTTGGGAGTTATTATTGCCAACATTTTTGGGGTAGTCCTCCGACGTTCGGTGGAGGCACCAACCTGGAAATCAAAC (SEQ ID NO:34).

[0101] Monoclonal antibody 3C1 antibody sequence:

[0102] The sequences of the heavy chain variable regions CDR1 to CDR3 are shown in SEQ ID NO:4 to 6, respectively;

[0103] The sequences of the light chain variable regions CDR1 to CDR3 are shown in SEQ ID NO:10 to 12, respectively;

[0104] The sequences of the heavy chain variable regions FR1 to FR4 are shown in SEQ ID NO:17 to 20, respectively;

[0105] The sequences of the light chain variable regions FR1 to FR4 are shown in SEQ ID NO 25 to 28, respectively;

[0106] The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO:30, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO:35;

[0107] The amino acid sequence of the light chain variable region is shown in SEQ ID NO:32, and the nucleic acid sequence of the light chain variable region is shown in SEQ ID NO:36;

[0108] GAGGTTCAGCTGCAGCAGTCTGGGGCTGAGCTTGTGAGGCCAGGGGCCTTAGTCAAGTTGTCCTGCAAAGCTTCTGCCTTCAACATTAAAGACTACTATATACATTGGGTGAAGCAGAGGCCTGAACAGGGCCTGGAGTGGATTGGATGGCTTGATCCTGAGAATGGTAATACTTATAG ATATGATCCGAAGTTCCAGGACAAGGCCAGTATGACAGCAGACACATCCTCCAACACAGCCTACCTACAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTGCCTCTGGGACGACCTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTCTCCTCA (SEQ ID NO:35);

[0109] GACATTGTGATGACCCAGTCTCACAAATCCATGTCCGCATCAGTTGGAGACAGGGTCAGCATTACCTGCAAGGCCAGTCAGGATGTGACTACTACTATAGCCTGGTATCAACAGAAACCAGGACAATCACCTAAACTATTGATTTATTCGGCATCCTACCGGT ACACTGGAGTCCCTGATCGCTTCACTGGCAGTGGATCTGGGACGGATTTCACTTTCACCATCAGCAGTGTGCAGGCTGAAGACCTGGCAGTTTTACTGTCAGCATTATTATACAAATCCTCCCACGTTCGGTGCTGGGACCAAGCTGGAGCTGAAAC (SEQ ID NO:36).

[0110] Table 3. Amino acid sequence information of 2B5 and 3C1 monoclonal antibodies

[0111]

[0112] The above are merely preferred embodiments of the present invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Antibodies against the novel Bunyavirus, characterized in that, The antibody comprises the following amino acid sequence: The amino acid sequences of CDR1, CDR2, and CDR3 in the three CDR regions of its heavy chain are shown in SEQ ID NO:1, 2, and 3, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 in the three CDR regions of its light chain are shown in SEQ ID NO:7, AAT, and SEQ ID NO:9, respectively; or The amino acid sequences of CDR1, CDR2 and CDR3 in the three CDR regions of its heavy chain are shown in SEQ ID NO:4, 5 and 6 respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 in the three CDR regions of its light chain are shown in SEQ ID NO:10, SAS and SEQ ID NO:12 respectively.

2. The antibody according to claim 1, characterized in that, The antibody comprises the following amino acid sequence: In its heavy chain, the four FR regions FR1, FR2, FR3, and FR4 have the amino acid sequences shown in SEQ ID NO:13, 14, 15, and 16, respectively; and in its light chain, the four FR regions FR1, FR2, FR3, and FR4 have the amino acid sequences shown in SEQ ID NO:21, 22, 23, and 24, respectively; or In the four FR regions of its heavy chain, FR1, FR2, FR3 and FR4 have amino acid sequences as shown in SEQ ID NO:17, 18, 19 and 20, respectively, and in the four FR regions of its light chain, FR1, FR2, FR3 and FR4 have amino acid sequences as shown in SEQ ID NO:25, 26, 27 and 28, respectively.

3. The antibody according to claim 1 or 2, characterized in that, Its heavy chain variable region has the amino acid sequence shown in SEQ ID NO:29, and its light chain variable region has the amino acid sequence shown in SEQ ID NO:31; or Its heavy chain variable region has an amino acid sequence as shown in SEQ ID NO:30, and its light chain variable region has an amino acid sequence as shown in SEQ ID NO:

32.

4. The antibody according to claim 3, characterized in that, It also includes constant regions, wherein the constant region of the heavy chain is IgG1 and the constant region of the light chain is the κ chain.

5. A biomaterial, characterized in that, Includes at least one of the following I to VI: I. Nucleic acid encoding the antibody against the novel Bunyavirus as described in any one of claims 1 to 4; II. An expression vector containing the nucleic acid; III. Transform or transfect host cells with the expression vector; IV. A conjugate prepared by conjugating the antibody against the novel Bunyavirus as described in any one of claims 1 to 4 with a solid or semi-solid medium; V. Antibodies against the novel Bunyavirus as described in any one of claims 1 to 4, which are chemically or biologically labeled; VI. A conjugate prepared by coupling an antibody to the novel Bunyavirus as described in any one of claims 1 to 4, which is chemically or biologically labeled, with a solid or semi-solid medium.

6. The method for preparing the antibody according to any one of claims 1 to 4, characterized in that, include: Culture host cells in the biological material as described in claim 5 to induce the expression of antibodies against the novel Bunyavirus.

7. The use of at least one of the following (i) to (iii) in the preparation of a detection reagent or kit for the novel Bunyavirus: i. An antibody against the novel Bunyavirus as described in any one of claims 1 to 4; ii. The biomaterial as described in claim 5; iii. Antibodies against the new Bunyavirus are prepared by the preparation method described in claim 6.

8. A detection reagent or detection kit, characterized in that, Includes at least one of the following ①~③: ① An antibody against the novel Bunyavirus as described in any one of claims 1 to 4; ② The biomaterial as described in claim 5; ③ An antibody against the new Bunyavirus was prepared by the preparation method described in claim 6.

Citation Information

Patent Citations

  • Rapid isolation of monoclonal antibodies from animals

    CN103003697A

  • Production and application of a monoclonal antibody and the development of a competitive enzyme-linked immunosorbent assay(c-ELISA) for detection of severe fever with thrombocytopenia syndrome virus(SFTSV)

    KR1020160054161A