Targeted NPM1c derived new antigen TCR and application thereof

Abstract

The invention provides a TCR targeting an NPM1c derived neoantigen, a nucleic acid molecule containing a nucleotide sequence encoding the TCR or a complementary sequence thereof, a carrier containing the nucleic acid molecule, a cell transducing the nucleic acid molecule or the carrier, and a pharmaceutical composition containing the TCR, the nucleic acid molecule, the carrier or the cell as an active component. The invention also discloses application of the TCR, the nucleic acid molecule, the carrier, the cell and the pharmaceutical composition in detection, prevention and / or treatment of NPM1c gene mutation derived neoantigen related cancers.

Description

Technical Field

[0001] The present invention belongs to the field of polypeptide drugs and polypeptide vaccines, and specifically relates to a specific TCR targeting NPM1c-derived neoantigens and its application in tumor immunotherapy. Background Art

[0002] Acute myeloid leukemia (AML) is a highly heterogeneous and aggressive malignant disease originating from myeloid precursor cells, accounting for 70% of adult leukemia. At present, the overall clinical treatment effect of AML is poor, with a 5-year survival rate of 35%-50%, and even lower to 5%-10% for elderly patients. The continuous accumulation of gene mutations gives leukemia cells extremely complex survival capabilities, leading to their continued clonal proliferation, which is the key to the poor prognosis of AML. Targeting gene mutations to specifically eliminate leukemia cell clones and promote immune balance are of great scientific significance for prolonging the disease-free survival of AML patients and reducing the relapse rate.

[0003] NPM1 tyrosine kinase catalytic domain mutations (cytoplasmic NPM1 mutations, NPM1c) are the most common gene mutations in AML patients, and the functional structural abnormalities caused by them are considered to be important factors in the occurrence and development of AML. + / – The mice showed genomic instability and eventually developed leukemia dominated by myeloid abnormalities. More than 33% of AML patients had NPM1c at the time of initial diagnosis, and persistent NPM1c could still be detected in relapsed patients, with a high degree of overlap with the NPM1c sequence at the time of initial diagnosis. This suggests the importance of targeted elimination of NPM1c in prolonging the survival of AML patients. However, there is currently a lack of treatments targeting NPM1c.

[0004] NPM1c generally occurs in exon 12, with more than 50 subtypes, of which type A is the most common, in which the TCTG base is inserted in nucleotides 956-969, resulting in an open reading frame shift, causing the 7 amino acid sequence of wild-type NPM1 (WQWRKSL) to mutate into 11 different amino acid sequences on NPM1c (CLAVEEVSLRK). We previously detected NPM1c-specific T cells in the peripheral blood and bone marrow-infiltrating lymphocytes of AML patients, suggesting that specific T cells targeting NPM1c play an important role in anti-leukemia immunity. However, the proportion of such cells in AML patients is extremely low (about 0.02%), and it is difficult to completely eliminate malignant cells when leukemia cells continue to clone and proliferate. By artificially increasing the proportion of NPM1c-specific T cells, enhancing the anti-leukemia ability of T cells, inducing leukemia cell lysis and releasing more immunogenic proteins, relieving the immunosuppressive state, expanding the breadth and depth of targeted immune responses, and thus forming a virtuous immune cycle, it will be possible to restore the patient's immune balance and achieve long-term survival with tumors or even cure AML.

[0005] The initiation of T cell immune response depends on the recognition of antigen by TCR. TCR-T cells constructed by artificially transducing antigen-specific TCR into T cells can target and kill tumor cells, change the body's immunosuppressive state, and induce specific immune responses. Among them, the selection of targets is the key. Neoantigens are derived from somatic gene mutations, are specifically expressed in cancer cells, do not cause central immune tolerance, have the advantages of strong immunogenicity and good safety, and are ideal targets for immune cell therapy. Our previous studies have found that NPM1c-derived neoantigens bind to human leukocyte antigen HLA-A*02:01, are presented to the surface of leukemia cells by it to form a pHLA complex, and induce specific T cell immune responses, suggesting that NPM1c-derived neoantigens are important targets for T cell-based immunotherapy.

[0006] Based on the fact that NPM1c is a good target for AML immunotherapy and that TCR recognition of new antigens initiates specific immune responses, adoptive transfer of TCR-T cells targeting NPM1c is a direct way to increase the number of NPM1c-specific T cells. However, artificial transduction of natural TCR structures has limitations such as low expression rate and high mismatch rate. Therefore, it is necessary to develop TCR mutants with enhanced affinity. Summary of the invention

[0007] The purpose of the present invention is to address the deficiencies of the prior art. The present invention provides a specific TCR targeting NPM1c-derived neoantigens and its application in tumor immunotherapy.

[0008] According to a first aspect of the present invention, a specific TCR targeting NPM1c-derived neoantigen is provided.

[0009] The NPM1c-derived new antigen (peptide sequence: AIQDLCMAV) binds to the HLA-A*02:01 molecule and is presented to the surface of the target cell to form an AIQDLCMAV-HLA-A*02:01 complex.

[0010] The AIQDLCMAV-HLA-A*02:01 complex is recognized by the specific TCR on the surface of T cells, inducing and initiating a specific immune response.

[0011] The TCR has the property of binding to the AIQDLCMAV-HLA-A*02:01 complex, and the TCR comprises a TCR α chain variable region and a TCR β chain variable region;

[0012] The CDR3 amino acid sequence of the TCR α chain variable region is CATAGGYQGAQKLVF (SEQ ID NO: 7).

[0013] And / or the amino acid sequence of the TCRβ chain variable region is CASSLMGQGTYEQYF (SEQ ID NO: 10).

[0014] Preferably, the amino acid sequences of the three complementary determining regions of the TCR α chain variable region are:

[0015] αCDR1: SEQ ID NO: 5;

[0016] αCDR2: SEQ ID NO: 6;

[0017] αCDR3: SEQ ID NO:7.

[0018] Preferably, the amino acid sequences of the three complementary determining regions of the TCRβ chain variable region are:

[0019] βCDR1: SEQ ID NO: 8;

[0020] βCDR2: SEQ ID NO: 9;

[0021] βCDR3: SEQ ID NO:10.

[0022] Preferably, in the above-mentioned TCR targeting NPM1c-derived neoantigen, the amino acid sequence of the TCR α chain variable region is an amino acid sequence having at least 90% sequence identity with SEQ ID NO:1; and / or the TCR β chain variable region is an amino acid sequence having at least 90% sequence identity with SEQ ID NO:2.

[0023] Preferably, the TCR comprises the α chain amino acid sequence SEQ ID NO:17.

[0024] Preferably, the TCR comprises the β chain amino acid sequence SEQ ID NO:18.

[0025] Preferably, the TCR is an αβ heterodimer.

[0026] Preferably, the α chain and β chain of the TCR contain an artificial interchain disulfide bond.

[0027] Preferably, the amino acid sequence of the TCR is as shown in SEQ ID NO:21.

[0028] The second aspect of the present invention provides a nucleic acid molecule, which comprises a nucleic acid sequence encoding the TCR molecule described in the first aspect of the present invention or a complementary sequence thereof.

[0029] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO: 3 encoding the variable region of the TCR α chain.

[0030] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:4 encoding the variable region of the TCR β chain.

[0031] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:19 encoding the TCR α chain.

[0032] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:20 encoding the TCRβ chain.

[0033] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:22.

[0034] The third aspect of the present invention provides a vector, wherein the vector contains the nucleic acid molecule described in the second aspect of the present invention.

[0035] Preferably, the vector is a viral vector.

[0036] More preferably, the viral vector is a lentiviral vector or a retroviral vector.

[0037] The fourth aspect of the present invention provides an isolated host cell, wherein the host cell contains the vector described in the third aspect of the present invention or an exogenous nucleic acid molecule described in the third aspect of the present invention integrated into its genome.

[0038] The fifth aspect of the present invention provides a cell, which expresses the TCR or its antigen-binding fragment targeting the NPM1c-derived neoantigen described in the first aspect of the present invention, or carries the polynucleotide described in the second aspect of the present invention, or contains the vector described in the third aspect of the present invention.

[0039] Preferably, the cell is a T cell, a peripheral blood mononuclear cell (PBMC) or a stem cell.

[0040] The sixth aspect of the present invention further provides a method for preparing the TCR or its antigen-binding fragment targeting the NPM1c-derived new antigen, the preparation method comprising culturing the cells of the fifth aspect.

[0041] The seventh aspect of the present invention also provides the use of the TCR or its antigen-binding fragment targeting the NPM1c-derived new antigen of the first aspect of the present invention, or the polynucleotide of the second aspect of the present invention, or the vector of the third aspect of the present invention, or the cell of the fourth aspect of the present invention, or the cell of the fifth aspect of the present invention, or the preparation method of the sixth aspect of the present invention in the preparation of a drug for the treatment of leukemia.

[0042] In the eighth aspect, the present invention also provides a drug for treating leukemia, which comprises the TCR or its antigen-binding fragment targeting the NPM1c-derived neoantigen of the first aspect of the present invention, or the polynucleotide of the second aspect, or the vector of the third aspect, or the cell of the fourth aspect, or the cell of the fifth aspect.

[0043] Through extensive and in-depth research, the present invention obtains a high-affinity TCR or its antigen-binding fragment targeting NPM1c-derived neoantigens, as well as a nucleic acid molecule comprising a nucleotide sequence encoding the TCR or its complementary sequence, and a vector containing the nucleic acid molecule, and a cell transducing the nucleic acid molecule or the vector, and a pharmaceutical composition comprising the TCR, nucleic acid molecule, vector or cell as an active ingredient, and the use of the TCR, nucleic acid molecule, vector, cell, and pharmaceutical composition for preparing drugs for detecting and preventing / treating leukemia.

[0044] Compared with the prior art, the present invention has the following beneficial effects:

[0045] (1) The TCR of the present invention can directly eliminate leukemia cells by precisely targeting NPM1c;

[0046] (2) The TCR protein of the present invention is highly expressed in vivo and has no mismatch with endogenous TCR chains;

[0047] (3) T cells expressing the TCR of the present invention have strong killing ability and specificity and can be effectively used to treat leukemia or other cancers containing NPM1c. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 :Detection and isolation of NPM1c-derived neoantigen-specific T cells;

[0049] Figure 2 :Schematic diagram of the original sequence of NPM1c-derived neoantigen-specific TCR;

[0050] Figure 3 : Transduction efficiency of NPM1c-derived neoantigen-specific TCR gene-modified T cells;

[0051] Figure 4 :Verification of in vitro activation of NPM1c-derived neoantigen-specific TCR-T cells;

[0052] Figure 5 :NPM1c-derived neoantigen-specific TCR-T cell killing activity in vitro;

[0053] Figure 6 :NPM1c-derived neoantigen-specific TCR-T cells recognize AML cell lines in vitro;

[0054] Figure 7 :NPM1c-derived neoantigen-specific TCR-T cells kill AML cell lines in vitro;

[0055] Figure 8 :NPM1c-derived neoantigen-specific TCR-T cells recognize AML primitive cells in vitro;

[0056] Fig. 9 :NPM1c-derived neoantigen-specific TCR-T cells kill AML primitive cells in vitro. DETAILED DESCRIPTION

[0057] In order to better understand the technical content of the present invention, specific embodiments are given and described as follows in conjunction with the accompanying drawings.

[0058] Various aspects of the present invention are described in this disclosure with reference to the accompanying drawings, in which many illustrative embodiments are shown. The embodiments of the present disclosure are not necessarily intended to include all aspects of the present invention. It should be understood that the various concepts and embodiments introduced above, as well as those described in more detail below, can be implemented in any of many ways.

[0059] Example 1. In vitro induction of NPM1c-derived neoantigen-specific T cells

[0060] Venous blood was collected from healthy volunteers with positive HLA-A*02:01, and PBMCs were separated and purified by Ficoll density gradient centrifugation. Dynabeads magnetic beads were used to separate CD8 + Cells and CD14 +Cells. CD14+ cells were resuspended in RPMI-1640 medium containing 10% FBS, 1000U / mL IL-4 and 1000U / mL GM-CSF and placed in an incubator for 3 days to induce dendritic cells (DCs). DCs were reselected with fresh medium containing 800IU / mL GM-CSF, 1000IU / mL IL-4, 10ng / mL TNF-α, 10ng / mL IL-1β, 1000IU / mL IL-6 and 1μg / mL PGE2 to induce DCs maturation. Mature DCs were recovered, and the cells were resuspended in serum-free RPMI-1640 medium, and NPM1c-derived neoantigenic peptides (AIQDLCMAV; 10μg / mL) were added and incubated at 37°C for 2-4 hours. DCs pulsed with neoantigen peptides were collected, inactivated with 30 μg / mL mitomycin C at 37°C for 30 min, resuspended in RPMI-1640 medium containing 10% FBS (containing 50 U / mL IL-2, 5 ng / mL IL-7 and 5 ng / mL IL-15), and co-incubated with CD8+ cells. The medium was replaced by half every 2-3 days and cultured for 10-20 days. The cells were collected and stained with PE-labeled neoantigen peptide-HLA-A*02:01-Tetramer and APC-labeled CD8 antibody, and detected by flow cytometry.

[0061] Results: After stimulation with NPM1c-derived neoantigens, healthy donor CD8 + / Tetramer + The proportion of T cells increased from 0.064% to 0.12% ( Figure 1 ), indicating that NPM1c-derived neoantigens induced T cell-specific expansion in vitro.

[0062] Example 2. TCR sequencing to obtain HLA-A*02:01 restricted NPM1c derived new antigen specific TCR

[0063] Flow cytometry sorting of CD8 + / Tetramer + Total RNA was extracted from cells using RNeasy Plus Mini Kit (Qiagen). The TCR Analysis System synthesizes cDNA with a 5' Race adapter from total RNA and introduces a unique molecular identifier (UMI) to control bottleneck effects and eliminate PCR and sequencing errors. Sequencing is done on Illumina The system was run in PE150 mode. CD8 + / Tetramer +The TCRα and TCRβ chain sequences of cells. The sequencing results were analyzed by our independently established method (National Invention Patent Application No.: CN202210939709.2). The TCRα and TCRβ sequences with the highest frequency were considered to be the main clone sequences of T cells, that is, the specific TCR sequences. Among them,

[0064] The amino acid sequence of the TCR α chain variable region is SEQ ID NO: 1.

[0065] The amino acid sequences of the three complementary determining regions of the TCRα chain variable region are:

[0066] αCDR1: TSINN (SEQ ID NO:5),

[0067] αCDR2: IRSNERE (SEQ ID NO:6),

[0068] αCDR3: CATAGGYQGAQKLVF (SEQ ID NO:7).

[0069] The nucleotide sequence of the TCR α chain variable region is SEQ ID NO: 3.

[0070] The nucleotide sequences of the three complementary determining regions of the TCRα chain variable region are:

[0071] αCDR1: ACTAGTATAAACAAT (SEQ ID NO: 11),

[0072] αCDR2: ATACGTTTCAAATGAAAGAGAG (SEQ ID NO: 12),

[0073] αCDR3: TGTGCTACGGCCGGGGGGTATCAGGGAGCCCAGAAGCTGGTATTT (SEQ ID NO: 13).

[0074] The amino acid sequence of the TCRβ chain variable region is SEQ ID NO:2.

[0075] The amino acid sequences of the three complementary determining regions of the TCRβ chain variable region are:

[0076] βCDR1: SGHDT (SEQ ID NO:8),

[0077] βCDR2: YYEEEE (SEQ ID NO:9),

[0078] βCDR3: CASSLMGQGTYEQYF (SEQ ID NO: 10).

[0079] The nucleotide sequence of the TCRβ chain variable region is SEQ ID NO:4.

[0080] The nucleotide sequences of the three complementary determining regions of the variable region of the TCRβ chain are:

[0081] βCDR1:TCTGGGCATGACACT(SEQ ID NO:14),

[0082] βCDR2: TATTATGAGGAGGAAGAG (SEQ ID NO: 15),

[0083] βCDR3: TGTGCCAGCAGCTTGATGGGGGCAGGGAACCTACGAGCAGTACTTC (SEQ ID NO: 16).

[0084] The TCR sequences obtained by sequencing were optimized for the most frequently occurring TCRα and TCRβ sequences, and their constant regions were modified and replaced with optimized mouse constant regions to avoid mismatching between exogenous TCR and endogenous TCR of T cells; the expression sequence was codon optimized to increase protein expression; P2A and Furin-cleavage were used to enable TCRα and TCRβ to be expressed simultaneously in one expression vector.

[0085] Construct a lentiviral expression vector, insert the above TCRα and TCRβ sequences into the same lentiviral expression vector, and the TCR sequence original is as follows Figure 2 As shown. Virus packaging was performed using 293T cells to produce lentiviral particles specific for NPM1c-derived neoantigen-specific TCR.

[0086] Example 3. Construction of specific TCR-T cells targeting NPM1c

[0087] Peripheral blood was collected from healthy volunteers, and PBMCs were separated and purified by Ficoll density gradient centrifugation. The cells were resuspended in AIM-V medium containing 5% FBS, and anti-CD3 antibody (OTK3, 50 ng / mL), IL-2 (300 IU / mL), IL-7 (30 ng / mL), IL-12 (15 ng / mL) and TGF-β (5 ng / mL) were added, and the cells were activated at 37°C for 48 h. TCR lentiviral particles were used to infect activated T cells, and IL-2 (300 IU / mL) and protamine sulfate (8 μg / mL) were added, and the cells were centrifuged at 800 × g for 90 min. TCR-transfected T cells were cultured for 72 h in AIM-V medium containing 10% FBS, IL-7 (5 ng / mL), IL-15 (5 ng / mL) and IL-2 (1000 IU / mL).

[0088] TCR-T cells were collected, washed twice with FACS buffer, and then stained with PE-mTCRβ flow cytometry antibody, PE neoantigen peptide-HLA-A*02:01-Tetramer and APC-CD3 flow cytometry antibody, and detected by flow cytometry.

[0089] The results are as follows Figure 3 Shown: TCR transduction efficiency (CD3 + / mTCRβ + ) was 37.5%, among which the efficiency of expressing heterodimeric TCR (CD3 + / Tetramer + ) was 14.1%, indicating that TCR-T cells were successfully constructed.

[0090] Example 4. Verification of the in vitro activation function of NPM1c-derived neoantigen-specific TCR-T cells

[0091] In order to detect the ability of TCR-T cells to target NPM1c, the activation level of TCR-T cells was measured by enzyme-linked immunosorbent assay (ELISA) of IFN-γ and Granzyme B. The specific steps are as follows:

[0092] TCR-T cells transfected with lentivirus were seeded in 24-well plates at a density of 1×106 / mL. IL-7 (10 ng / mL) and IL-15 (10 ng / mL) were added on Day 1. T2 cells loaded with neoantigen peptides were co-incubated with TCR-T cells at a ratio of 1:10 on Day 2 to achieve secondary antigen stimulation, and IL-21 (30 ng / mL) was added. IL-7 (10 ng / mL) and IL-15 (10 ng / mL) were added on Day 3 and continued to be cultured. TCR-T cells were collected as effector cells.

[0093] Loading different concentrations (10 1 , 10 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 The T2 cells loaded with NPM1c-derived neoantigen peptides at 1×10 5 / 100 μl / well were inoculated in 96-well plates, and TCR-T cells (2×10 5 / 100μl / well), co-culture at 37℃ for 18-24h. Centrifuge the plate, take 100μl supernatant from each well and add it to the ELISA strips pre-coated with IFN-γ or Granzyme B antibody, develop the color according to the instructions, and read the plate with an enzyme reader. Calculate the standard curve based on the absorbance value of the standard, and calculate the IFN-γ or Granzyme B secretion level of each well of the sample accordingly. Set at least 3 replicates for each concentration in each group above, and repeat each experiment 3 times.

[0094] The results are as follows Figure 4 As shown: Under the stimulation of T2 cells loaded with NPM1c-derived neoantigens, TCR-T cells significantly secreted IFN-γ and Granzyme B, while T2 cells loaded with NPM1 wild-type antigen peptides had no effect, indicating that the activation of TCR-T cells is NPM1c-specific.

[0095] Example 5. Verification of the in vitro killing function of NPM1c-derived neoantigen-specific TCR-T cells

[0096] In order to verify the ability of TCR-T cells to target NPM1c, the killing ability of TCR-T cells was evaluated by quantitative detection of lactate dehydrogenase (LDH) released during cell lysis. The specific steps are as follows:

[0097] The transfected and amplified TCR-T cells in Example 4 were collected as effector cells; T2 cells loaded with NPM1c-derived neoantigen peptides (10 μg / mL) were used as target cells in the experimental group, and T2 cells loaded with the corresponding concentration of NPM1 wild-type antigen peptides (10 μg / mL) were used as target cells in the control group. TCR-T cells and target cells were inoculated in 96-well plates at effector-target ratios of 40:1, 20:1, 10:1, and 5:1, respectively. Promega CytoTox Instructions for the Non-Radioactive Cytotoxicity Assay Kit In addition, set up target cell spontaneous release wells, target cell maximum release wells, culture base control wells, and volume correction control wells. Place the 96-well plate at 37°C for 4 hours, centrifuge the plate, aspirate 50μl of supernatant from each well and add it to a new 96-well plate, develop color according to the instructions, read the plate with an enzyme reader, and calculate the cytotoxicity% at different effect-target ratios to evaluate the ability of TCR-T cells to specifically kill T2 cells loaded with NPM1c-derived neoantigens. Set up 3 replicates in each well, and repeat the experiment 3 times.

[0098] The results are as follows Figure 5 As shown: TCR-T cells significantly killed T2 cells loaded with NPM1c-derived neoantigens, but had no effect on T2 cells loaded with NPM1 wild-type antigen peptides, indicating that TCR-T cells have targeted killing function.

[0099] Example 6. NPM1c-derived neoantigen-specific TCR-T cells recognize AML cell lines in vitro

[0100] In order to verify the function of TCR-T cells in recognizing AML cell lines that endogenously present NPM1c-derived neoantigens, the activation capacity of TCR-T cells was determined by IFN-γ- and Granzyme B-ELISA. The specific steps are as follows:

[0101] The TCR-T cells transfected and amplified in Example 4 were collected as effector cells; OCI-AML3 cells with HLA-A*02:01+ and NPM1c+ were used as target cells; + 、NPM1c – THP-1 cells were used as control target cells. 2×10 4 / 100μl / well was inoculated in a 96-well plate, and TCR-T cells were added at effector-target ratios of 20:1, 10:1, 5:1 and 2.5:1. Incubate at 37°C for 18-24h. The secretion levels of IFN-γ and Granzyme B were detected as in Example 4 to evaluate the function of TCR-T cells in specifically recognizing AML cell lines. At least 3 replicate wells were set for each concentration in each group above, and each experiment was repeated 3 times.

[0102] The results are as follows Figure 6 As shown: Under the stimulation of OCI-AML3 cells, TCR-T cells significantly secreted IFN-γ and Granzyme B, but had no effect on THP-1 cells. This indicates that TCR-T specifically recognizes AML cell lines that endogenously present NPM1c-derived neoantigens.

[0103] Example 7: NPM1c-derived neoantigen-specific TCR-T cells kill AML cell lines in vitro

[0104] In order to verify the ability of TCR-T cells to target AML cell lines that endogenously present NPM1c-derived neoantigens, the killing ability of TCR-T cells was determined by LDH release assay. The specific steps are as follows:

[0105] The transfected and amplified TCR-T cells in Example 4 were collected as effector cells; the OCI-AML3 and THP-1 cells in Example 6 were collected as target cells in the experimental and control groups, respectively. TCR-T cells and target cells in each group were added at effector-target ratios of 40:1, 20:1, 10:1, and 5:1, respectively, and incubated at 37°C for 4 hours. The supernatant was collected, the color was developed, and the plate was read according to the instructions. The cell lysis rate was calculated according to the formula to evaluate the ability of TCR-T cells to specifically kill AML cell lines. At least 3 replicate wells were set for each concentration in each group above, and each experiment was repeated 3 times.

[0106] The results are as follows Figure 7 As shown: TCR-T cells significantly killed OCI-AML3 cells, but had no effect on THP-1 cells, indicating that TCR-T cells specifically killed AML cell lines that endogenously presented NPM1c-derived neoantigens.

[0107] Example 8: NPM1c-derived neoantigen-specific TCR-T cells recognize AML primitive cells in vitro

[0108] In order to verify the function of TCR-T cells in recognizing AML primitive cells that endogenously present NPM1c-derived neoantigens, the activation capacity of TCR-T cells was determined by IFN-γ- and Granzyme B-ELISA. The specific steps are as follows:

[0109] The TCR-T cells transfected and amplified in Example 4 were collected as effector cells; HLA-A*02:01 + / NPM1c + Bone marrow primitive cells of AML patients were used as target cells in the experimental group, and HLA-A*02:01 – / NPM1c + 、HLA-A*02:01 + / NPM1c – and HLA-A*02:01 – / NPM1c – AML patients' bone marrow primitive cells were used as the control group target cells. 2×10 4 / 100μl / well was inoculated in a 96-well plate, and TCR-T cells were added at an effector-target ratio of 10:1. Incubate at 37°C for 18-24h. The secretion levels of IFN-γ and Granzyme B were detected as in Example 4 to evaluate the function of TCR-T in specifically recognizing AML primitive cells. At least 3 replicates were set for each concentration in each group, and each experiment was repeated 3 times.

[0110] The results are as follows Figure 8 Shown: In HLA-A*02:01 + / NPM1c + Under the stimulation of AML primitive cells, TCR-T cells significantly secreted IFN-γ and Granzyme B. This indicates that TCR-T cells specifically recognize AML primitive cells that endogenously present NPM1c.

[0111] Example 9: NPM1c-derived neoantigen-specific TCR-T cells kill AML primitive cells in vitro

[0112] In order to verify the function of TCR-T cells targeting AML primitive cells that endogenously present NPM1c-derived neoantigens, the killing ability of TCR-T cells was measured by LDH release method. The specific steps are as follows:

[0113] The TCR-T cells transfected and amplified in Example 4 were collected as effector cells; HLA-A*02:01 + / NPM1c + Bone marrow primitive cells of AML patients were used as target cells in the experimental group, and HLA-A*02:01 + / NPM1c + Bone marrow primitive cells of AML patients were used as target cells in the experimental group, and HLA-A*02:01 – / NPM1c + 、HLA-A*02:01 + / NPM1c – and HLA-A*02:01 – / NPM1c – Bone marrow primitive cells of AML patients were used as target cells in the control group. TCR-T cells and target cells of each group were added at an effector-target ratio of 10:1 and incubated at 37°C for 4 hours. Supernatant was collected, color developed, and plate read according to the instructions. Cell lysis rate was calculated according to the formula to evaluate the ability of TCR-T cells to specifically kill AML primitive cells. At least 3 replicate wells were set for each concentration in each group above, and each experiment was repeated 3 times.

[0114] The results are as follows Fig. 9 As shown: TCR-T cells significantly kill HLA-A*02:01 + / NPM1c + AML blasts, indicating the targeting effect of TCR-T cells on NPM1c-positive AML blasts.

[0115] In this embodiment, based on the TCR targeting NPM1c-derived neoantigens, there can be provided a nucleic acid molecule comprising a nucleotide sequence encoding the TCR or its complementary sequence, a vector containing the nucleic acid molecule, a cell transducing the nucleic acid molecule or the vector, and a pharmaceutical composition comprising the TCR, nucleic acid molecule, vector or cell as an active ingredient, as well as the use of the TCR, nucleic acid molecule, vector, cell and pharmaceutical composition in the detection, prevention and / or treatment of cancers associated with NPM1c gene mutation-derived neoantigens.

[0116] Although the present invention has been disclosed as above with preferred embodiments, it is not intended to limit the present invention. A person with ordinary knowledge in the technical field to which the present invention belongs may make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention shall be determined by the definition of the claims.

Claims

1. A TCR targeting NPM1c-derived neoantigen, characterized in that: The invention comprises a TCR capable of recognizing an AIQDLCMAV-HLA-A*02:01 complex, wherein the TCR comprises a TCR α chain variable region and / or a TCR β chain variable region: The amino acid sequence of CDR3 in the TCRα chain variable region is: CATAGGYQGAQKLVF (SEQ ID NO:7) The amino acid sequence of CDR3 in the TCRβ chain variable region is: CASSLMGQGTYEQYF (SEQ ID NO: 10).

2. The TCR targeting NPM1c-derived neoantigen according to claim 1, characterized in that: The TCR α chain variable region also includes αCDR1 and / or αCDR2 complementary determining regions, the amino acid sequence of which is: αCDR1: TSINN (SEQ ID NO:5), αCDR2: IRSNERE (SEQ ID NO:6).

3. The TCR targeting NPM1c-derived neoantigen according to claim 1, characterized in that: The TCR β chain variable region also includes _x0016_βCDR1 and / or βCDR2 complementary determining regions, whose amino acid sequences are: βCDR1: SGHDT (SEQ ID NO:8), βCDR2: YYEEEE (SEQ ID NO:9).

4. The TCR targeting NPM1c-derived neoantigen according to claim 1, characterized in that: The amino acid sequence of the TCR α chain variable region is an amino acid sequence having at least 90% sequence identity with SEQ ID NO: 1; and / or the TCR β chain variable region is an amino acid sequence having at least 90% sequence identity with SEQ ID NO:

2.

5. The TCR targeting NPM1c-derived neoantigen according to claim 1, characterized in that: The TCR comprises an α chain amino acid sequence SEQ ID NO:

17.

6. The TCR targeting NPM1c-derived neoantigen according to claim 1, characterized in that: The TCR comprises a β chain amino acid sequence of SEQ ID NO:

18.

7. The TCR targeting NPM1c-derived neoantigen according to claim 1, characterized in that: TCR is an αβ heterodimer with an artificial interchain disulfide bond between the α chain and the β chain.

8. The TCR targeting NPM1c-derived neoantigen according to claim 1, characterized in that: The amino acid sequence of the TCR is shown in SEQ ID NO:

21.

9. A nucleic acid molecule, characterized in that: The nucleic acid molecule comprises a nucleic acid sequence encoding the TCR molecule according to claims 1 to 8 or a complementary sequence thereof.

10. The nucleic acid molecule according to claim 9, characterized in that: It comprises the nucleotide sequence SEQ ID NO: 3 encoding the variable region of the TCR α chain.

11. The nucleic acid molecule according to claim 9, characterized in that: The nucleic acid molecule comprises the nucleotide sequence SEQ ID NO: 19 encoding the TCR α chain.

12. The nucleic acid molecule according to claim 9, characterized in that: The nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:4 encoding the variable region of the TCR β chain.

13. The nucleic acid molecule according to claim 9, characterized in that: The nucleic acid molecule comprises the nucleotide sequence SEQ ID NO: 20 encoding the TCR β chain.

14. The nucleic acid molecule according to claim 9, characterized in that: The nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:

22.

15. A carrier, characterized in that: The vector contains the nucleic acid molecule according to any one of claims 9 to 14.

16. The carrier according to claim 15, characterized in that: The vector is a viral vector.

17. An isolated host cell, characterized in that: The host cell contains the vectors according to claims 15 and 16 or an exogenous nucleic acid molecule according to any one of claims 9 to 14 integrated into its genome.

18. A cell, characterized in that: The cell expresses the TCR or antigen-binding fragment thereof targeting the NPM1c-derived neoantigen as described in claims 1 to 8, or carries the polynucleotide as described in claims 9 to 14, or contains the vector as described in claims 15 and 16.

19. The cell according to claim 18, characterized in that: The cells are T cells, peripheral blood mononuclear cells (PBMC) or stem cells.

20. A drug for treating tumors, comprising the TCR or antigen-binding fragment thereof targeting the NPM1c mutation-derived neoantigen as described in claims 1 to 8, or the polynucleotides of claims 9 to 14, or the vectors of claims 9 to 14, or the cells of claim 17, or the cells of claims 18 and 19.

21. Use of the TCR according to any one of claims 1 to 8, or the polynucleotides according to claims 9 to 14, or the vectors according to claims 9 to 14, or the cells according to claim 17, or the cells according to claims 18 and 19 in a drug for treating leukemia.

Images