Site-specific integration site screening method, carrier particle, site-specific integration method and particle

Abstract

The invention discloses a site-specific integration site screening method, a carrier particle, a site-specific integration method and a particle. The invention provides a site-specific integration site screening method, a carrier particle, a site-specific integration method and a particle, and aims to integrate upstream and downstream marker genes with recognition sequences on the carrier particle, perform protein expression quantity screening while performing monoclonal screening, obtain a monoclonal carrier with good performance through one-step screening, and perform site-specific integration on the carrier particle. The marker gene is replaced when the exogenous target gene is expressed, so that the overall stability of the particle is greatly ensured, the overall expression performance and stability of the expression particle are ensured while the development of the expression particle is shortened, and the technical problem that an expression vector in the prior art is relatively long in development time or poor in performance is solved. The site-specific integration site screening method provided by the invention can effectively shorten the development period of the expression vector with high expression quantity and overall stability. The carrier particle provided by the invention is good in adaptability and good in expression quantity and passage stability.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and more specifically, relates to a method for screening a fixed-site integration site, a carrier particle, a fixed-site integration method and a particle. Background Art

[0002] Since the US FDA approved Genetech's recombinant insulin for marketing in 1982, recombinant proteins have been successfully used in scientific research, diagnosis, treatment and prevention of various diseases. At present, recombinant proteins are mainly produced and expressed using exogenous protein expression systems. The production of recombinant proteins using mammalian cells has become the mainstream technology for the expression and production of biotechnology drugs. Most of the biological drugs currently on the market, undergoing clinical trials and preclinical studies, including but not limited to peptide drugs and protein drugs, can be expressed by mammalian cells, and among them, Chinese Hamster Ovary (CHO) cells are the most widely used host cells in the production of recombinant proteins. CHO cells have multiple strains. The CHO cell lines currently used for industrial production mainly include CHO-K1, CHO-DG44, CHO-DXB11 (also known as CHO-DUKX), CHO-S and CHOZN (CHOZN ZFN-Modified CHO Cell Lines), etc., and CHO-MK is under development.

[0003] A Chinese invention patent (authorization announcement number CN100381573C) discloses a method for constructing a cell line containing an amplifiable high transcriptional activity site in the genome. The marker is inserted into the amplifiable transcriptional activity site of the mammalian genome using an integration marker vector, and then the mammalian cells are co-transfected with a double plasmid of a targeting expression vector and a recombinase expression vector, so that the exogenous target gene is integrated into the marker of the genome under the action of a site-specific recombination system. Through gene amplification, the gene copy number is rapidly increased to achieve high gene expression. In this patent scheme, a recombinase is used to recognize and cut a pair of recombination signal sequences, such as attP and attB, and the cell line selected is CHO-dhfr - .

[0004] The Chinese invention patent (authorization announcement number CN114107380A) discloses a method for constructing a cell line using a bacteriophage Bxb1 specific site recombinase system, which can greatly reduce the time for developing a cell line. First, the site attP of the fixed-site integration is randomly integrated into the CHO-S cell genome by a random integration method, and a CHO-S.attP recombinant cell model is obtained by antibiotic screening. The CHO-S.attp recombinant cell strain is used as a host cell, and the DNA with the attB site and the target protein gene is fixedly integrated into the CHO-S.attp cell strain with the help of Bxb1 recombinase. After antibiotic pressure screening, stable and high expression of the target protein is achieved.

[0005] At present, when constructing a cell line, an exogenous target gene is inserted into a specific site, and the gene copy number is rapidly increased through gene amplification to achieve high gene expression. The existing screening methods for known sites include mother cell line construction, mother cell line stability screening, exogenous target gene site integration screening, and target cell line stability screening. The mother cell line construction is one step. The traditional mother cell line construction uses the two steps of "mother cell line construction + screening" to select the mother cell line that has the marker gene inserted into the site. This method takes a long time and consumes a lot of manpower.

[0006] At the same time, when screening the mother cell line, a marker gene needs to be used. The target cell line finally integrated cannot remove the marker gene from the genome, which affects the overall stability of the target cell line. Summary of the invention

[0007] In view of the above defects or improvement needs of the prior art, the present invention provides a method for screening site-specific integration sites, vector particles, a method for site-specific integration and particles, the purpose of which is to integrate marker genes with recognition sequences upstream and downstream on the vector particles, and perform protein expression screening at the same time as monoclonal screening. After a monoclonal vector with good performance is obtained by one-step screening, the marker gene is replaced when expressing the exogenous target gene, which greatly ensures the overall stability of the particles. While shortening the development of expression particles, the overall expression performance and stability of the expression particles are ensured, thereby solving the technical problems of long development time or poor performance of expression vectors in the prior art.

[0008] To achieve the above object, according to one aspect of the present invention, a method for screening site-specific integration sites is provided, comprising the following steps:

[0009] (1) randomly integrating an exogenous gene containing two recognition sequences and a marker gene between the two recognition sequences into an endogenous gene of a vector particle to obtain a vector particle carrying the marker gene;

[0010] (2) amplifying and culturing the vector particles carrying the marker gene obtained in step (1) to form a vector particle pool to be screened;

[0011] (3) performing monoclonal screening on the vector particle pool to be screened obtained in step (2), and retaining monoclonal vector particles whose expression levels of the corresponding marker genes and / or exogenous target genes are higher than a preset threshold value according to the expression levels of the marker genes and / or exogenous target genes during the monoclonal screening, to obtain monoclonal vector particles with high protein expression;

[0012] (4) Subculturing the high protein expression monoclonal vector particles obtained in step (3), determining the subculture stability of the monoclonal vector particles based on the marker gene expression levels of the vector particles over multiple generations, obtaining high expression monoclonal vector particles with subculture stability, and using the insertion position of the exogenous gene on the endogenous gene as the fixed integration site.

[0013] Preferably, in the method for screening site-specific integration sites, the marker gene is of comparable length to the exogenous target gene to be integrated;

[0014] The marker gene has a plurality of optional lengths, preferably 0.75k, 1k, 3k, and 15k;

[0015] It is preferred to use marker genes of 3k or less and predict the expression levels of exogenous target genes of other lengths through intelligent learning algorithms.

[0016] Preferably, in the method for screening site-directed integration sites, the marker gene is selected from one or more of a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene and a fluorescent protein gene; and / or,

[0017] The carrier particles are used to express one or more of amino acids, polypeptides, proteins, nucleotides, nucleic acids, secretions, and are selected from cells, bacteria, and viruses, and are commonly carrier cells; the carrier cells are eukaryotic cells; optionally, the eukaryotic cells are mammalian cells; optionally, the mammalian cells include Chinese hamster ovary CHO cells and human embryonic kidney HEK293 cells; and / or,

[0018] The recognition sequence is independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, attP sequence, attB sequence, attP-GA sequence and attB-GA sequence.

[0019] Preferably, in the method for screening fixed integration sites, step (3) uses image processing technology to screen monoclonal vector particles, and specific schemes include but are not limited to deep learning target detection model YOLO (You Only Look Once) series and SSD (Single Shot MultiBox Detector) series algorithm models.

[0020] Preferably, the method for screening site-specific integration sites, wherein step (3) predicts the expression level of the marker gene and / or the exogenous target gene by an intelligent algorithm based on the cell image, specifically comprises the following steps:

[0021] (3-1) imaging the vector particle pool to be screened obtained in step (2) to obtain an image of the vector particle to be screened; preferably, high-throughput scanning imaging is used, and when the marker gene is a fluorescent protein, high-throughput fluorescent scanning imaging is preferably used;

[0022] (3-2) performing image processing on the carrier particle images to be screened obtained in step (3-1) to obtain images of each carrier particle, and using an intelligent algorithm to predict the expression level of the marker gene and / or the exogenous target gene of the carrier particle according to the image features; the image features preferably used include: cell morphological features and / or optical features, including but not limited to roundness, size, and grayscale of specific cell sites;

[0023] Preferably, the expression levels of the marker gene and / or the exogenous target gene of the carrier microparticle predicted by the multiple intelligent algorithms are evaluated by using the evaluation standard of the sorting algorithm, Normalized Discounted Cumulative Gain (NDCG), and the sorting accuracy of the protein expression levels predicted by the multiple intelligent algorithms is evaluated. According to the rule that the larger the standard normalized discounted cumulative gain, the better the sorting accuracy of the protein expression level, the intelligent algorithm with the best sorting accuracy of the protein expression level is selected for the prediction;

[0024] For a specific intelligent algorithm for predicting protein expression, the standard normalized loss cumulative gain calculation formula is as follows:

[0025]

[0026]

[0027] Wherein IDCG is the DCG value of the real ranking of the protein expression of the sample monoclonal vector particles, i represents the predicted ranking number of a monoclonal vector particle in the sample monoclonal vector particles according to the predicted protein expression of the intelligent algorithm, rel(i) represents the real protein expression of the i-th monoclonal vector particle; k is the sample size of the sample monoclonal vector particles;

[0028] When the predicted protein is a fluorescent protein, rel(i) indicates the fluorescence value; when the predicted protein is a non-fluorescent protein, rel(i) indicates the value of the protein expression amount tested by Western blot, Elisa, mass spectrometry, electrophoresis, etc.

[0029] (3-3) The carrier particles whose expression levels of the marker gene and / or the exogenous target gene exceed a preset threshold are acquired according to image positioning and moved to a preset position in the culture medium for retention.

[0030] Preferably, in the method for screening site-specific integration sites, step (3) adopts semi-solid culture medium monoclonal vector particle screening.

[0031] Preferably, in the method for screening site-specific integration sites, in step (4), the passage stability of monoclonal vector particles is determined using an intelligent algorithm; the specific steps are as follows:

[0032] (4-1) obtaining the marker gene expression levels of the monoclonal vector particles of multiple generations;

[0033] (4-2) using an intelligent algorithm to evaluate the differences in marker gene expression levels of multiple generations of monoclonal vector particles according to the marker gene expression levels of multiple generations of monoclonal vector particles obtained in step (4-1);

[0034] (4-3) judging whether the monoclonal vector microparticles have generation stability according to the difference in marker gene expression levels of the multiple generations of monoclonal vector microparticles obtained in step (4-2) according to the principle that the smaller the difference in expression level, the greater the probability of having generation stability.

[0035] According to another aspect of the present invention, there is provided a site-specific integration vector particle obtained by screening the site-specific integration site screening method, wherein an exogenous gene is inserted into the endogenous gene of the vector particle; the exogenous gene comprises two first recognition sequences and a marker gene expression fragment for expressing a marker protein integrated between the two first recognition sequences;

[0036] The expression level of the marker gene of the site-specific integration vector particle is higher than the preset threshold value;

[0037] The site-specific integration vector particles have stability in passage.

[0038] According to another aspect of the present invention, there is provided a system for screening for site-specific integration sites, the system being an electronic device and / or a non-transitory computer-readable storage medium;

[0039] The electronic device comprises a memory, a processor and a computer program stored in the memory and executable on the processor, and the processor implements the steps of the method for screening site-specific integration sites provided by the present invention when executing the program;

[0040] The non-transitory computer-readable storage medium stores a computer program, and when the computer program is executed by a processor, the steps of the method for screening site-specific integration sites provided by the present invention are implemented.

[0041] According to another aspect of the present invention, a method for site-directed integration of an exogenous target gene is provided, comprising the following steps:

[0042] Obtain the site-specific integration vector particles provided by the present invention, use the first recognition sequence in the exogenous gene in the site-specific integration vector particles to perform homologous recombination, recombining the exogenous target gene expression fragment into the gene of the site-specific integration vector particles while removing the marker gene expression fragment.

[0043] Preferably, in the method for site-directed integration of the exogenous target gene, the exogenous target gene expression fragment is set in a recombinant vector, and the exogenous target gene is site-directedly integrated into the site of the site-directed integration vector particle through the recombinant vector; the recombinant vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes virus vector, a poxvirus vector, a baculovirus vector, a papillomavirus vector, a papillomatovirus vector, an integrative phage vector, a non-viral vector, a transposon, a transposase, an integrase substrate or a plasmid.

[0044] Preferably, in the method for site-specific integration of exogenous target gene, the length of the marker gene expression segment of the site-specific integration vector particle is comparable to that of the exogenous target gene expression segment.

[0045] Preferably, the method for site-directed integration of the exogenous target gene, wherein the first recognition sequence of the site-directed integration fragment of the site-directed integration vector particle is used to perform homologous recombination, specifically:

[0046] Constructing an exogenous target gene recombinant fragment containing an exogenous target gene; wherein the exogenous gene recombinant fragment contains two second recognition sequences and an exogenous target gene expression fragment; the exogenous target gene expression fragment is between the two second recognition sequences; the exogenous target gene expression fragment includes a promoter for regulating the expression of the exogenous target gene and an exogenous target gene sequence;

[0047] The exogenous gene is integrated into the site of the site-directed integration vector particle, and the two first recognition sequences on both sides of the marker gene are respectively changed into a third recognition sequence and a fourth recognition sequence; the third recognition sequence is formed by the reaction of the first recognition sequence and the second recognition sequence, and the fourth recognition sequence is formed by the reaction of the first recognition sequence and the second recognition sequence, and the third recognition sequence is different from the fourth recognition sequence.

[0048] Preferably, in the method for site-specific integration of the exogenous target gene, the third recognition sequence and the fourth recognition sequence will not become the second recognition sequence or the first recognition sequence in the same reaction system.

[0049] Preferably, in the method for site-directed integration of the exogenous target gene, the third recognition sequence and the fourth recognition sequence are generated by a recombinase, and the recombinase is one of Bxb1 integrase, ΦC31 integrase, Cre recombinase or FLP recombinase; and / or

[0050] The second recognition sequence is independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, attP sequence, attB sequence, attP-GA sequence and attB-GA sequence; and / or,

[0051] The third recognition sequence and the recognition sequence are independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, attL sequence and attR sequence.

[0052] Preferably, the method for site-specific integration of the exogenous target gene comprises the following steps:

[0053] S1. Obtain multiple site-specific integration vector particles provided by the present invention, perform homologous recombination using the first recognition sequence in the exogenous gene in the site-specific integration vector particles, recombining the exogenous target gene expression fragment into the gene of the site-specific integration vector particles while removing the marker gene expression fragment, and obtain multiple candidate exogenous target gene expression vector particles;

[0054] S2, amplifying and subculturing the multiple candidate exogenous target gene expression vectors obtained in step S1;

[0055] S21, retaining the monoclonal exogenous target gene expression vector particles whose expression amount of the corresponding exogenous target gene is higher than a preset threshold value according to the expression amount of the exogenous target gene;

[0056] S22 determines the generation stability of the exogenous target gene expression vector microparticles according to the exogenous target gene expression amount of the multiple generations of monoclonal exogenous target gene expression vector microparticles;

[0057] The exogenous target gene expression vector particles with high protein expression and stable generation are obtained.

[0058] Preferably, in the method for site-directed integration of the exogenous target gene, step S21 predicts the expression level of the exogenous target gene by an intelligent learning algorithm;

[0059] The expression level of the exogenous target gene is retained and predicted by an intelligent algorithm based on the cell image; specifically comprising the following steps:

[0060] S211, imaging the monoclonal exogenous target gene expression vector microparticles obtained in step S21 to obtain an image of a candidate monoclonal exogenous target gene expression vector microparticle; preferably, high-throughput scanning imaging is used;

[0061] S212, predicting the expression level of the exogenous target gene of the monocloned exogenous target gene expression vector microparticles using an intelligent algorithm based on the image features; preferably, the image features used include: cell morphological features and / or optical features, including but not limited to roundness, size, and grayscale of specific cell sites;

[0062] Preferably, the expression levels of the exogenous target gene of the monoclonal exogenous target gene expression vector microparticles predicted by multiple intelligent algorithms are evaluated by using the evaluation standard of the sorting algorithm, Normalized Discounted Cumulative Gain (NDCG), to evaluate the sorting accuracy of the protein expression levels predicted by the multiple intelligent algorithms, and according to the rule that the larger the standard normalized discounted cumulative gain, the better the sorting accuracy of the protein expression level, the intelligent algorithm with the best sorting accuracy of the protein expression level is selected for the prediction;

[0063] For a specific intelligent algorithm for predicting protein expression, the standard normalized loss cumulative gain calculation formula is as follows:

[0064]

[0065]

[0066] Wherein IDCG is the DCG value of the real ranking of the protein expression of the sample monoclonal vector particles, i represents the predicted ranking number of a monoclonal vector particle in the sample monoclonal vector particles according to the predicted protein expression of the intelligent algorithm, rel(i) represents the real protein expression of the i-th monoclonal vector particle; k is the sample size of the sample monoclonal vector particles;

[0067] When the predicted protein is a fluorescent protein, rel(i) indicates the fluorescence value; when the predicted protein is a non-fluorescent protein, rel(i) indicates the value of the protein expression amount tested by Western blot, Elisa, mass spectrometry, electrophoresis, etc.

[0068] Preferably, in the method for site-directed integration of the exogenous target gene, in step S22, the passage stability of the monoclonal exogenous target gene expression vector microparticles is determined using an intelligent algorithm; the specific steps are as follows:

[0069] S221, obtaining the expression levels of the exogenous target gene of multiple generations of the monoclonal exogenous target gene expression vector particles;

[0070] S222, using an intelligent algorithm to evaluate the difference in the expression amount of the exogenous target gene of the multiple generations of monoclonal exogenous target gene expression vector particles according to the expression amount of the exogenous target gene of the multiple generations of monoclonal exogenous target gene expression vector particles obtained in step S221;

[0071] S223 determines whether the monoclonal exogenous target gene expression vector microparticles have generation stability according to the difference in exogenous target gene expression levels of the multiple generations of monoclonal exogenous target gene expression vector microparticles obtained in step S222, based on the principle that the smaller the difference in expression levels, the greater the probability of having generation stability.

[0072] According to another aspect of the present invention, there is provided an exogenous target gene expression vector particle obtained by screening the exogenous target gene site-directed integration method, wherein the exogenous target gene is inserted into the endogenous gene of the vector particle; the exogenous gene comprises a third recognition sequence, a fourth recognition sequence, and an exogenous target gene expression fragment arranged between the third recognition sequence and the fourth recognition sequence for expressing a target protein;

[0073] The target gene expression level of the exogenous target gene expression vector microparticle is higher than the preset threshold value;

[0074] The exogenous target gene expression vector microparticles have passage stability.

[0075] According to another aspect of the present invention, a system for site-specific integration of an exogenous target gene is provided, wherein the system is an electronic device and / or a non-transient computer-readable storage medium;

[0076] The electronic device comprises a memory, a processor, and a computer program stored in the memory and executable on the processor, and when the processor executes the program, the steps of the method for site-directed integration of an exogenous target gene provided by the present invention are implemented;

[0077] The non-transitory computer-readable storage medium stores a computer program, and when the computer program is executed by a processor, the steps of the method for site-specific integration of an exogenous target gene provided by the present invention are implemented.

[0078] In general, the above technical solutions conceived by the present invention can achieve the following beneficial effects compared with the prior art:

[0079] The present invention achieves two effects by constructing an exogenous gene containing two recognition sequences and a marker gene between the two recognition sequences onto the endogenous gene of the vector particle: on the one hand, monoclonal screening and expression level screening are completed simultaneously, so as to obtain a high expression level monoclonal vector in one step; on the other hand, the marker gene is directly replaced when the exogenous target gene is expressed, and there is no need to load the marker gene in the final protein expression vector, thereby improving the overall stability of the cell. Combining the above two effects, the fixed integration site screening method of the present invention can effectively shorten the development cycle of expression vectors with high expression levels and overall stability.

[0080] The carrier microparticles provided by the present invention have good adaptability to different exogenous target genes and good expression amount and passage stability.

[0081] The present invention covers the entire process of cell line selection, from the construction of the plasmid of the target protein to the final determination of the protein stable high-yield cell line. The entire process is standardized, repeatable and highly operable.

[0082] The preferred solution uses artificial intelligence algorithms to evaluate and predict the performance of monoclonal expression vectors, which increases the probability of screening monoclonal expression vectors with good performance in a single culture, and further shortens the development cycle of expression vectors with fixed integration sites overall.

[0083] The preferred solution is to use a microscope to scan cell image data with high throughput to screen monoclonal cell lines with high expression of the target protein, use a robot arm to semi-automatically absorb and transfer the screened target cell lines, and finally use an image recognition algorithm to screen out stable expression cell lines. Compared with other technologies for screening monoclonal cell lines, the present invention has the advantages of higher accuracy and time-saving and labor-saving. BRIEF DESCRIPTION OF THE DRAWINGS

[0084] Figure 1 is a schematic diagram of the structure of the recombinant plasmid containing RMCE constructed in Example 1 of the present invention;

[0085] Figure 2 It is a schematic diagram of the structure of the marker gene expression fragment contained in the recombinant plasmid provided in Example 1 of the present invention;

[0086] Figure 3 This is a flow chart of the method for screening fixed integration sites provided in Example 1 of the present invention.

[0087] Figure 4 This is a detection effect diagram of the target detection algorithm provided by Example 1 of the present invention;

[0088] Figure 5 is an operation flow chart provided by Embodiment 2 of the present invention;

[0089] Figure 6 It is the recombinant plasmid of target genes 1, 2, 4, and 5 provided in Example 2 of the present invention;

[0090] Figure 7 It is the recombinant plasmid of the target gene 3 provided in Example 2 of the present invention;

[0091] Figure 8 This is a graph comparing the expression levels of the expression vectors in Example 2 on the 14th day;

[0092] Fig. 9 This is a graph showing the expression results of the expression vector in Example 2 over 7 days;

[0093] Fig.10 This is the electrophoresis photograph of GBB003-2D8 cells integrated with target gene 1 in Example 2;

[0094] Fig.11 This is the electrophoresis photograph of GBB003-1G2 cells integrated with target gene 2 in Example 2;

[0095] Fig.12 This is the electrophoresis photograph of GBB003-1D6 cells integrated with target gene 3 in Example 2;

[0096] Fig.13 This is a graph showing the results of the cell viability stability test of Y5E6 and Y6F10 in Example 2 as microparticles expressing exogenous target genes;

[0097] Fig.14 This is a graph showing the stability test results of the proliferation rate of microparticle cells using Y5E6 and Y6F10 in Example 2 as exogenous target gene expression vectors;

[0098] Fig.15 This is the result diagram of the glycoforms of the product quality attributes of Y5E6 cells and Y6F10 cells in Example 2;

[0099] Fig.16 is a comparison result of charge heterogeneity of proteins expressed by Y5E6 cells and Y6F10 cells in Example 2;

[0100] Fig.17 This is a graph showing the results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis of Y5E6 cells and Y6F10 cells in Example 2;

[0101] Fig.18 This is a graph showing the concentration of the antibody expressing the target gene 5 in GBB003 cells integrated with the target gene 5 in Example 2;

[0102] Fig.19 This is a graph showing the results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis detection of 5GBB003 cells with the target gene integrated in Example 2;

[0103] Fig. 20 This is a test chart of the 90-day passage growth stability result of GBB-01 cells provided in Example 3;

[0104] Fig.21 This is a schematic diagram of the structure of the target gene 6 fragment cloned into the exogenous target gene 6 expression fragment in Example 3;

[0105] Fig. 22 is a schematic diagram of the Bxb1 integrase plasmid structure provided in Example 3;

[0106] Fig.23 This is a graph showing the expression results of GBB-01-H8 cells containing the integrated exogenous target gene 6 provided in Example 3;

[0107] Fig.24 This is the GBB-01-H8 cell batch expression result diagram provided in Example 3;

[0108] Fig.25 This is a graph showing the batch specific yield of GBB-01-H8 cells provided in Example 3;

[0109] Fig.26 This is a comparison result diagram of the sugar profile of GBB-01-H8 cells provided in Example 3;

[0110] Fig. 27This is a comparison result diagram of GBB-01-H8 cell charge heterogeneity provided in Example 3;

[0111] Fig.28 This is the electrophoresis result of the GBB-01-H8 cell genome provided in Example 3;

[0112] Fig.29 This is a graph showing the comparison of the expression levels of the integrated exogenous target gene 3GBBc001 cells provided in Example 4;

[0113] Fig.30 This is the comparison result of the expression level of the integrated exogenous target gene 1GBBc001 cell provided in Example 4

[0114] Fig.31 This is a graph showing the comparison of the expression levels of the integrated exogenous target gene 3GBBc001-14 cells provided in Example 4;

[0115] Fig.32 This is a graph showing the results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis of GBBc001-14 cells provided in Example 4;

[0116] Fig.33 This is a graph showing the results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis of GBBc001-3 cells provided in Example 4;

[0117] Fig.34 Schematic diagram of the structure of the fixed integration site screening system provided in Example 5. DETAILED DESCRIPTION

[0118] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0119] In this article, the preset threshold refers to: a fixed value, or a ranking range value that is greater than a certain ranking range value in an existing numerical range and sorted from large to small, or a ranking value that is greater than a certain ranking value in an existing numerical range and sorted from large to small.

[0120] Herein, the recognition sequence includes but is not limited to homology arm sequences, other sequences that can be recognized, or other homologous recombination sequences.

[0121] Herein, “monoclonal vector particles whose expression levels of corresponding marker genes and / or exogenous target genes are retained according to the expression levels of the marker genes and / or exogenous target genes while screening for monoclonal antibodies” refers to “monoclonal vector particles whose expression levels of marker genes are retained according to the expression levels of the marker genes while screening for monoclonal antibodies and whose expression levels are higher than a preset threshold value”, or “monoclonal vector particles whose expression levels of exogenous target genes are retained according to the expression levels of the exogenous target genes while screening for monoclonal antibodies and whose expression levels are higher than a preset threshold value”.

[0122] The method for screening site-specific integration sites provided by the present invention comprises the following steps:

[0123] (1) randomly integrating an exogenous gene containing two recognition sequences and a marker gene between the two recognition sequences into an endogenous gene of a vector particle to obtain a vector particle carrying the marker gene;

[0124] The recognition sequence includes but is not limited to homology arm sequences, other sequences that can be recognized or other homologous recombination sequences. In this embodiment, the recognition sequence refers to the homology arm sequence.

[0125] Since the protein expression level and the stability of the vector microparticles integrated with the exogenous target gene are strongly correlated with the size of the exogenous target gene and its integration site, in order to ensure that the expression level and stability of the exogenous target gene of the constructed vector microparticles integrated with the exogenous target gene meet the screening expectations, the marker gene is of the same length as the exogenous target gene to be integrated; in the absence of a clear exogenous target gene, a plurality of marker genes with representative lengths can be selected for screening respectively, and typical marker gene lengths are 0.75k, 1k, 3k, and 15k; in a preferred embodiment, a marker gene with a smaller length (3k or less), such as a marker gene of 0.75k, can be used to predict the expression level of exogenous target genes of other lengths through an intelligent learning algorithm, thereby greatly reducing costs.

[0126] The marker gene is selected from one or more of a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene and a fluorescent protein gene.

[0127] The carrier particles are used to express one or more of amino acids, polypeptides, proteins, nucleotides, nucleic acids, and secretions, and are selected from cells, bacteria, and viruses, and are commonly carrier cells; the carrier cells are eukaryotic cells; optionally, the eukaryotic cells are mammalian cells; optionally, the mammalian cells include Chinese hamster ovary CHO cells and human embryonic kidney HEK293 cells.

[0128] (2) amplifying and culturing the vector particles carrying the marker gene obtained in step (1) to form a vector particle pool to be screened;

[0129] (3) performing monoclonal screening on the vector particle pool to be screened obtained in step (2), and retaining monoclonal vector particles whose expression levels of the corresponding marker genes and / or exogenous target genes are higher than a preset threshold value according to the expression levels of the marker genes and / or exogenous target genes during the monoclonal screening, so as to obtain monoclonal vector particles with high protein expression levels; a preferred solution is to use image processing technology to perform monoclonal vector particles, and specific solutions include but are not limited to deep learning target detection models YOLO (You Only Look Once) series and SSD (Single Shot MultiBox Detector) series algorithm models.

[0130] A preferred solution is to predict the expression level of the marker gene and / or the exogenous target gene by an intelligent algorithm based on the cell image; specifically comprising the following steps:

[0131] (3-1) imaging the vector particle pool to be screened obtained in step (2) to obtain an image of the vector particle to be screened; preferably, high-throughput scanning imaging is used, and when the marker gene is a fluorescent protein, high-throughput fluorescent scanning imaging is preferably used;

[0132] (3-2) performing image processing on the carrier particle images to be screened obtained in step (3-1) to obtain images of each carrier particle, and using an intelligent algorithm to predict the expression level of the marker gene and / or the exogenous target gene of the carrier particle according to the image features; the image features preferably used include: cell morphological features and / or optical features, including but not limited to roundness, size, and grayscale of specific cell sites;

[0133] Preferably, the expression levels of the marker gene and / or the exogenous target gene of the carrier microparticle predicted by the multiple intelligent algorithms are evaluated by using the evaluation standard of the sorting algorithm, Normalized Discounted Cumulative Gain (NDCG), and the sorting accuracy of the protein expression levels predicted by the multiple intelligent algorithms is evaluated. According to the rule that the larger the standard normalized discounted cumulative gain, the better the sorting accuracy of the protein expression level, the intelligent algorithm with the best sorting accuracy of the protein expression level is selected for the prediction;

[0134] For a specific intelligent algorithm for predicting protein expression, the standard normalized loss cumulative gain calculation formula is as follows:

[0135]

[0136]

[0137] Wherein IDCG is the DCG value of the real ranking of the protein expression of the sample monoclonal vector particles, i represents the predicted ranking number of a monoclonal vector particle in the sample monoclonal vector particles according to the predicted protein expression of the intelligent algorithm, rel(i) represents the real protein expression of the i-th monoclonal vector particle; k is the sample size of the sample monoclonal vector particles;

[0138] When the predicted protein is a fluorescent protein, rel(i) indicates the fluorescence value; when the predicted protein is a non-fluorescent protein, rel(i) indicates the value of the protein expression amount tested by Western blot, Elisa, mass spectrometry, electrophoresis, etc.

[0139] (3-3) acquiring the carrier particles whose expression level of the marker gene and / or the exogenous target gene exceeds a preset threshold value according to image positioning and moving them to a preset position in the culture medium for retention;

[0140] Since there are differences in the sequence and other properties of marker genes and exogenous target genes, the expression level of the exogenous target gene is predicted after learning and training the differences between the two using an intelligent algorithm. This can improve the adaptability of the expression of the exogenous target gene at the selected integration site to a certain extent, thereby shortening the overall development cycle and reducing development costs.

[0141] Monoclonal cell vector particle screening generally adopts limiting dilution method, flow cytometry sorting and semi-solid culture medium screening. The limiting dilution method requires a large number of experiments, and the flow cytometry sorting uses pressure to operate the carrier particles with low survival rate and high risk of contamination. The present invention preferably adopts semi-solid culture medium monoclonal vector particle screening to achieve mechanical automation.

[0142] The preset threshold value of the expression level of the marker gene and / or the exogenous target gene can be determined according to the experimental requirements of the protein expression level. For example, if the goal is to require the protein expression level to exceed a certain value, then the certain value can be used as the preset threshold value; or it can be determined according to the relative protein expression level, for example, the expression level of the marker gene and / or the exogenous target gene is in the first fixed proportion or the first fixed ranking in descending order of expression level.

[0143] (4) Subculturing the high protein expression monoclonal vector particles obtained in step (3), determining the subculture stability of the monoclonal vector particles based on the marker gene expression levels of the vector particles over multiple generations, obtaining high expression monoclonal vector particles with subculture stability, and using the insertion position of the exogenous gene on the endogenous gene as the fixed integration site.

[0144] The preferred solution is to use an intelligent algorithm to determine the stability of monoclonal vector particles; the specific steps are as follows:

[0145] (4-1) obtaining the marker gene expression levels of the monoclonal vector particles of multiple generations;

[0146] (4-2) using an intelligent algorithm to evaluate the differences in marker gene expression levels of multiple generations of monoclonal vector particles according to the marker gene expression levels of multiple generations of monoclonal vector particles obtained in step (4-1);

[0147] (4-3) judging whether the monoclonal vector microparticles have generation stability according to the difference in marker gene expression levels of the multiple generations of monoclonal vector microparticles obtained in step (4-2) according to the principle that the smaller the difference in expression level, the greater the probability of having generation stability.

[0148] The site-directed integration vector particles provided by the present invention have exogenous genes inserted into the endogenous genes of the vector particles; the exogenous genes include two first recognition sequences and a marker gene expression fragment for expressing a marker protein, which is arranged between the two first recognition sequences;

[0149] The expression level of the marker gene of the site-specific integration vector particle is higher than the preset threshold value;

[0150] The site-specific integration vector particles have stability in passage.

[0151] In this embodiment, the first recognition sequence refers to the first homology arm sequence.

[0152] The marker gene is selected from one or more of a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene and a fluorescent protein gene.

[0153] The exogenous gene containing two recognition sequences and the marker gene between the two recognition sequences contains a marker gene expression fragment, and the marker gene expression fragment has a promoter, which is a CMV promoter, an SV40 promoter, an RSV promoter, a β-globin promoter, an UBC promoter, an EF1a promoter, an ubiquitin promoter, a β-actin promoter, a PGK1 promoter, a Rosa26 promoter, a HSP70 promoter, a GAPDH promoter, an Eif4A1 promoter, an Egr1 promoter, a FerH promoter, a SM22α promoter or an Endothelin-1 promoter.

[0154] The first recognition sequence is independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, attP sequence, attB sequence, attP-GA sequence and attB-GA sequence.

[0155] The present invention provides a fixed integration site screening system, wherein the system is an electronic device and / or a non-transient computer-readable storage medium;

[0156] The electronic device comprises a memory, a processor and a computer program stored in the memory and executable on the processor, and the processor implements the steps of the method for screening site-specific integration sites as described above when executing the program;

[0157] The non-transitory computer-readable storage medium stores a computer program thereon, and when the computer program is executed by a processor, the steps of the method for screening site-specific integration sites are implemented.

[0158] The method for site-directed integration of an exogenous target gene provided by the present invention comprises the following steps:

[0159] Obtain the site-specific integration vector particles provided by the present invention, use the first recognition sequence in the exogenous gene in the site-specific integration vector particles to perform homologous recombination, recombining the expression fragment into the gene of the site-specific integration vector particles while removing the exogenous target gene fragment of the marker gene.

[0160] The preferred solution is to screen all site-specific integration vectors for exogenous target genes. The specific method is as follows:

[0161] S1. Obtain multiple site-specific integration vector particles provided by the present invention, perform homologous recombination using the first recognition sequence in the exogenous gene in the site-specific integration vector particles, recombining the exogenous target gene expression fragment into the gene of the site-specific integration vector particles while removing the marker gene expression fragment, and obtain multiple candidate exogenous target gene expression vector particles;

[0162] S2, amplifying and subculturing the multiple candidate exogenous target gene expression vectors obtained in step S1;

[0163] S21, retaining the monoclonal exogenous target gene expression vector particles whose expression amount of the corresponding exogenous target gene is higher than a preset threshold according to the expression amount of the exogenous target gene; preferably, the expression amount of the exogenous target gene is retained by performing intelligent algorithm prediction based on the cell image; specifically comprising the following steps:

[0164] S211, imaging the monoclonal exogenous target gene expression vector microparticles obtained in step S21 to obtain an image of a candidate monoclonal exogenous target gene expression vector microparticle; preferably, high-throughput scanning imaging is used;

[0165] S212, predicting the expression level of the exogenous target gene of the monocloned exogenous target gene expression vector microparticles using an intelligent algorithm based on the image features; preferably, the image features used include: cell morphological features and / or optical features, including but not limited to roundness, size, and grayscale of specific cell sites;

[0166] Preferably, the expression levels of the exogenous target gene of the monoclonal exogenous target gene expression vector microparticles predicted by multiple intelligent algorithms are evaluated by using the evaluation standard of the sorting algorithm, Normalized Discounted Cumulative Gain (NDCG), to evaluate the sorting accuracy of the protein expression levels predicted by the multiple intelligent algorithms, and according to the rule that the larger the standard normalized discounted cumulative gain, the better the sorting accuracy of the protein expression level, the intelligent algorithm with the best sorting accuracy of the protein expression level is selected for the prediction;

[0167] For a specific intelligent algorithm for predicting protein expression, the standard normalized loss cumulative gain calculation formula is as follows:

[0168]

[0169]

[0170] Wherein IDCG is the DCG value of the real ranking of the protein expression of the sample monoclonal vector particles, i represents the predicted ranking number of a monoclonal vector particle in the sample monoclonal vector particles according to the predicted protein expression of the intelligent algorithm, rel(i) represents the real protein expression of the i-th monoclonal vector particle; k is the sample size of the sample monoclonal vector particles;

[0171] When the predicted protein is a fluorescent protein, rel(i) indicates the fluorescence value; when the predicted protein is a non-fluorescent protein, rel(i) indicates the value of the protein expression amount tested by Western blot, Elisa, mass spectrometry, electrophoresis, etc.

[0172] S22 determines the passage stability of the exogenous target gene expression vector based on the exogenous target gene expression level of multiple generations of monoclonal exogenous target gene expression vector particles;

[0173] The passage stability of the monoclonal exogenous target gene expression vector microparticles is determined by an intelligent algorithm; the specific steps are as follows:

[0174] S221, obtaining the expression levels of the exogenous target gene of multiple generations of the monoclonal exogenous target gene expression vector particles;

[0175] S222, using an intelligent algorithm to evaluate the difference in the expression amount of the exogenous target gene of the multiple generations of monoclonal exogenous target gene expression vector particles according to the expression amount of the exogenous target gene of the multiple generations of monoclonal exogenous target gene expression vector particles obtained in step S221;

[0176] S223, judging whether the monoclonal exogenous target gene expression vector microparticles have generation stability according to the difference in the expression amount of the exogenous target gene of the multiple generations of monoclonal exogenous target gene expression vector microparticles obtained in step S222, according to the principle that the smaller the difference in the expression amount, the greater the probability of having generation stability.

[0177] The exogenous target gene expression vector particles with high protein expression and stable passage are obtained.

[0178] The exogenous target gene expression fragment is arranged in a recombinant vector, and the exogenous target gene is site-specifically integrated into the site of the site-specific integration vector particle through the recombinant vector; the recombinant vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes virus vector, a poxvirus vector, a baculovirus vector, a papillomavirus vector, a papillomatosis virus vector, an integrating phage vector, a non-viral vector, a transposon, a transposase, an integrase substrate or a plasmid.

[0179] The length of the marker gene expression segment of the site-directed integration vector particle is comparable to that of the exogenous target gene expression segment.

[0180] The method of performing homologous recombination using the first recognition sequence of the site-specific integration fragment of the site-specific integration vector particle is specifically as follows:

[0181] Constructing an exogenous target gene recombinant fragment containing an exogenous target gene; wherein the exogenous gene recombinant fragment contains two second recognition sequences and an exogenous target gene expression fragment; the exogenous target gene expression fragment is between the two second recognition sequences; the exogenous target gene expression fragment includes a promoter for regulating the expression of the exogenous target gene and an exogenous target gene sequence;

[0182] The exogenous gene is integrated into the site of the site-directed integration vector particle, and the two first recognition sequences on both sides of the marker gene are respectively changed into a third recognition sequence and a fourth recognition sequence; the third recognition sequence is formed by the reaction of the first recognition sequence and the second recognition sequence, and the fourth recognition sequence is formed by the reaction of the first recognition sequence and the second recognition sequence, and the third recognition sequence is different from the fourth recognition sequence.

[0183] In a preferred embodiment, the third recognition sequence and the fourth recognition sequence will not become the second recognition sequence or the first recognition sequence in the same reaction system.

[0184] The third recognition sequence and the fourth recognition sequence are generated by a recombinase, and the recombinase is one of Bxb1 integrase, ΦC31 integrase, Cre recombinase or FLP recombinase; and / or

[0185] The second recognition sequence is independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, attP sequence, attB sequence, attP-GA sequence and attB-GA sequence; and / or,

[0186] The third recognition sequence and the recognition sequence are independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, attL and attR sequence.

[0187] In this embodiment, the first recognition sequence refers to the first homologous arm sequence, the second recognition sequence refers to the second homologous arm sequence, the third recognition sequence refers to the third homologous arm sequence, and the fourth recognition sequence refers to the fourth homologous arm sequence; the third recognition sequence is formed by the reaction of the first homologous arm located on the left side of the marker gene in the marker gene expression fragment and the second homologous arm located on the left side of the exogenous target gene in the exogenous target gene expression fragment, and the fourth recognition sequence is formed by the reaction of the first homologous arm located on the right side of the marker gene in the marker gene expression fragment and the second homologous arm located on the right side of the exogenous target gene in the exogenous target gene expression fragment.

[0188] The exogenous target gene expression vector particles obtained by screening according to the above-mentioned exogenous target gene site-specific integration method provided by the present invention have exogenous target genes inserted into endogenous genes of the vector particles; the exogenous gene includes a third recognition sequence, a fourth recognition sequence, and an exogenous target gene expression fragment arranged between the third recognition sequence and the fourth recognition sequence for expressing a target protein;

[0189] The target gene expression level of the exogenous target gene expression vector microparticle is higher than the preset threshold value;

[0190] The exogenous target gene expression vector microparticles have passage stability.

[0191] The exogenous target gene expression fragment has a promoter, and the promoter is CMV promoter, SV40 promoter, RSV promoter, β-globin promoter, UBC promoter, EF1a promoter, ubiquitin promoter, β-actin promoter, PGK1 promoter, Rosa26 promoter, HSP70 promoter, GAPDH promoter, Eif4A1 promoter, Egr1 promoter, FerH promoter, SM22α promoter or Endothelin-1 promoter.

[0192] The third recognition sequence and the fourth recognition sequence are generated by a recombinase, and the recombinase is one of Bxb1 integrase, ΦC31 integrase, Cre recombinase or FLP recombinase.

[0193] The third recognition sequence and the recognition sequence are independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, attL and attR sequence.

[0194] In this embodiment, the first recognition sequence refers to the attP sequence, the second recognition sequence refers to the attB sequence, the third recognition sequence refers to the attL sequence, and the fourth recognition sequence refers to the attR sequence.

[0195] The present invention provides a system for site-specific integration of an exogenous target gene, wherein the system is an electronic device and / or a non-transient computer-readable storage medium;

[0196] The electronic device comprises a memory, a processor and a computer program stored in the memory and executable on the processor, and when the processor executes the program, the steps of the method for site-directed integration of an exogenous target gene as described above are implemented;

[0197] The non-transitory computer-readable storage medium stores a computer program, and when the computer program is executed by the processor, the steps of the method for site-specific integration of the exogenous target gene are implemented as described above.

[0198] The following are examples:

[0199] Example 1: Method for screening site-specific integration sites, preparation of site-specific integration vector microparticles, method for site-specific integration of exogenous target genes, preparation of exogenous target gene expression vector microparticles

[0200] The method for screening site-specific integration sites provided in Example 1 is as follows: Figure 3 As shown, the following steps are included:

[0201] (1) randomly integrating a marker gene with homology arms at both ends into the endogenous gene of the vector particle to obtain a vector particle carrying the marker gene;

[0202] In this Example 1, the green fluorescent protein gene (EGFP) was used as a marker gene for screening, and the attP sequence was used as a homology arm to construct a recombinant plasmid containing RMCE (recombinase-mediated cassette exchange) as follows: Figure 1 The marker gene expression fragment contained in the recombinant plasmid used for random integration is as shown in Figure 2 shown.

[0203] After linearizing the constructed plasmid, purify and recover the linear DNA; take 3×106 CHO-K1 cells into a 1.5mL centrifuge tube, centrifuge at 1000rpm for 5min at room temperature, and discard the supernatant; resuspend the cells with 100μL of R Buffer, a special resuspension buffer for cell electroporation; electroporation conditions: 1575v, 10ms, 3 times, 3×106 cells; plasmid dosage 15ug. Randomly integrate the fluorescent protein gene with attP sequences at both ends into the endogenous gene of the vector particle. The constructed plasmid integrated into the endogenous gene is the exogenous gene, which will be as follows Figure 2 The indicated marker gene expression fragment is integrated into the endogenous gene. The vector particle is a cell.

[0204] After 2 days, the pressurization reagent is G418, the pressurization concentration is 800ug / ml, the density of the 96-well plate is 10,000 cells / well, and the medium in each well is not less than 200ul. Check the plate after 10 days. When a large number of fluorescent cell clusters are observed, they can be enriched. The enrichment method includes but is not limited to manual enrichment. Follow the principle of one well to one well when enriching, and do not enrich cells from multiple wells into one well.

[0205] (2) amplifying and culturing the vector particles carrying the marker gene obtained in step (1) to form a vector particle pool to be screened; specific steps:

[0206] Observe the growth of enriched cells at any time, and expand them after the coverage rate reaches more than 50%. There are two ways to expand: 96-well plate-24-well plate-6-well plate and 96-well plate-6-well plate. After expansion to shake flasks, pass two to three generations to form a stable cell pool, and then perform monoclonal screening.

[0207] (3) performing monoclonal screening on the vector particle pool to be screened obtained in step (2), and retaining monoclonal vector particles whose expression levels of the marker gene and / or the exogenous target gene are higher than a preset threshold value according to the expression levels of the marker gene and / or the exogenous target gene during the monoclonal screening, to obtain monoclonal vector particles with high protein expression;

[0208] The formation of monoclonal cells and the screening of stable fluorescence are achieved through artificial intelligence, as follows Figure 3 As shown:

[0209] The steps are as described by ah:

[0210] (3-1) imaging the vector particle pool to be screened obtained in step (2) to obtain an image of the vector particle to be screened; preferably, high-throughput scanning imaging is used, and when the marker gene is a fluorescent protein, high-throughput fluorescent scanning imaging is preferably used;

[0211] a) The cells in the stable cell pool are diluted to a certain concentration and then inoculated into a culture dish containing a semi-solid culture medium. During the inoculation process, the cells are ensured to be approximately evenly distributed in various positions of the small dish. The cells are left to stand for about half an hour to wait for the cells to settle to the bottom of the culture dish;

[0212] b) The culture dish is transferred to the microscope stage, and the microscope performs high-throughput scanning on the cells in the culture dish;

[0213] (3-2) performing image processing on the image of the carrier particle to be screened obtained in step (3-1) to obtain an image of each carrier particle, and using an intelligent algorithm to predict the expression level of the marker gene and / or the exogenous target gene of the carrier particle according to the image features;

[0214] c) The image scanned by the microscope is uploaded to the server for artificial intelligence image analysis, and the analysis process includes monoclonal cell line detection, protein expression level prediction of monoclonal cell lines, protein expression level ranking, and coding and positioning of screened protein high-expressing cell lines; the protein expression level prediction of the monoclonal cell line can be based on fluorescence or not, and the following step c is the protein expression level prediction not based on fluorescence.

[0215] Step c is based on the monoclonal cell line target detection of image processing technology. In this embodiment, the YOLOv8 target detection algorithm is used, and the actual detection effect reaches mAP 94.2%. Figure 4 shown.

[0216] The target detection model for monoclonal cell lines in step c is consistent with the commonly used deep learning target detection model, so it is not described in detail. Specifically, the cell image needs to be annotated first. In order to improve the prediction accuracy of the algorithm, the bounding boxes of all monoclonal cell lines and adhesion cell lines will be annotated. They are used as the real target bounding boxes (ground truth) for the loss calculation of the model output. After algorithm training, the model learns to extract the border information of monoclonal cell lines. In the actual application scenario step c, the trained model can predict the borders of monoclonal cell lines in the image.

[0217] Since the selected sites will be used to insert exogenous genes of different lengths and to express exogenous genes, and the length of the exogenous gene inserted in the site is strongly correlated with the protein expression, several groups of fluorescent protein marker genes with different deoxyribonucleic acid lengths will be selected here. In this embodiment, four exogenous gene expression fragments of approximate lengths of 0.75k, 1K, 3K, and 15K are used, and the exogenous genes include genes that can express fluorescent proteins and / or genes that can express other proteins. By testing the expression of fluorescent proteins and other proteins, images of cells that can express four exogenous genes of similar lengths of 0.75k, 1K, 3K or 15K are selected for artificial intelligence image learning. The case where the exogenous gene length is 0.75K corresponds to the case where the exogenous gene can express fluorescent protein in a specific site in the target cell line and the length of the inserted exogenous gene expression fragment is about 0.75k. The case where the length of the inserted exogenous gene is 1K corresponds to the case where the target gene is double-stranded DNA in a specific site in the target cell line and the length of the exogenous gene expression fragment is about 1k. The case where the length of the inserted exogenous gene is 3K corresponds to the case where the target gene is a monoclonal antibody in a specific site in the target cell line and the length of the exogenous gene expression fragment is about 3k to 7k. The case where the length of the inserted gene is 15K corresponds to the case where the target gene is used to express a multivalent antibody or a multi-segment insertion structure in a specific site in the target cell line, and the length of the exogenous gene expression fragment is about 15k.

[0218] Step c provides 4 groups of expression prediction models of different lengths, each of which corresponds to a group of fluorescence value labels. Artificial intelligence image learning is performed with historical images of CHO cells with exogenous target genes inserted in 4 different lengths, and 4 prediction models are generated respectively to perform high expression prediction analysis. In the site application process, the exogenous target gene expression fragment is replaced with an exogenous target gene expression fragment of similar length. In the construction process of CHO cells as historical images, exogenous genes of different lengths can be used as marker gene expression fragments to replace the exogenous genes of high expression sites, and then the prediction model is used to determine whether the site is still a high expression site under the protein expression of inserted genes of different lengths. When all inserted genes of different lengths are replaced as marker genes, they can be predicted as sites of high expression, and the site can be judged as a protein expression site suitable for exogenous target gene expression fragments of different lengths. In this process, the marker gene can use other proteins that can produce fluorescence, or other proteins, and the fluorescence value after expression or the protein expression of the real marker gene can be used as a label. In step c, historical images of CHO cells in which the length of the deoxyribonucleotides of the inserted exogenous gene is the same or similar to the length of the DNA sequence of the inserted exogenous gene of the green fluorescent protein gene (EGFP) are used to perform high expression prediction analysis using a prediction model generated by artificial intelligence image learning.

[0219] Step c predicts the fluorescent protein expression level based on the monoclonal cell image. In this embodiment, the deep learning network of SqueezeNet and the MSE Loss loss function are used, and the expression level of the exogenous gene or marker gene in the monoclonal cell image is used as the label of the regression algorithm.

[0220] The expression levels of the exogenous target gene of the monoclonal exogenous target gene expression vector particles predicted by multiple intelligent algorithms are evaluated by using the evaluation standard of the sorting algorithm, Normalized Discounted Cumulative Gain (NDCG), to evaluate the sorting accuracy of the protein expression levels predicted by the multiple intelligent algorithms, and according to the rule that the larger the standard normalized discounted cumulative gain, the better the sorting accuracy of the protein expression level, the intelligent algorithm with the best sorting accuracy of the protein expression level is selected for the prediction;

[0221] For a specific intelligent algorithm for predicting protein expression, the standard normalized loss cumulative gain calculation formula is as follows:

[0222]

[0223]

[0224] Wherein IDCG is the DCG value of the real ranking of the protein expression of the sample monoclonal vector particles, i represents the predicted ranking number of a monoclonal vector particle in the sample monoclonal vector particles according to the predicted protein expression of the intelligent algorithm, rel(i) represents the real protein expression of the i-th monoclonal vector particle; k is the sample size of the sample monoclonal vector particles;

[0225] When the predicted protein is a fluorescent protein, rel(i) indicates the fluorescence value; when the predicted protein is a non-fluorescent protein, rel(i) indicates the value of the protein expression amount tested by Western blot, Elisa, mass spectrometry, electrophoresis, etc.

[0226] Specifically in this embodiment, the cell image predicts the expression level, and the predicted expression level is ranked, and the ranking result is compared with the real fluorescence value, NDCG = 0.89. The expression level prediction model in the present invention can be found in the Chinese patent document: "Cell Screening Method and Device Based on Convolutional Neural Network".

[0227] (3-3) The carrier particles whose expression levels of the marker gene and / or the exogenous target gene exceed a preset threshold are acquired according to image positioning and moved to a preset position in the culture medium for retention; the preset threshold refers to the first fixed proportion of the expression levels of the marker gene and / or the exogenous target gene in descending order of expression levels.

[0228] d) The coding and location information of the screened protein high-expressing cell lines are returned to the robot control software;

[0229] The cell codes and positions returned in step d, in this embodiment, return the top 100 cells in terms of expression level prediction, with the codes ranging from 1 to 100, and the position information includes the coordinates in the plane coordinate system relative to the center of the microscope (the depth of the culture medium is not considered, because all the selected cells are deposited to the bottom of the small dish. In addition, during the photo shooting process, the cells that have not settled to the bottom of the small dish will be out of focus, resulting in blurred cells, and the cells with blurred images will also be excluded as candidate cells).

[0230] e) The robot control software automatically operates (or manually assists) the robot arm to aspirate the screened monoclonal cell lines and transfer them to the designated well plate, and the process is repeated until all high-expressing cell lines are transferred;

[0231] Step e is the process in which the robot arm picks up the target monoclonal cell line and transfers it to the well plate.

[0232] Patents Chinese patent literature: "Robot-based cell manipulation task processing method, device, equipment and medium" with publication number CN113821287B, "Robot-based cell liquid collection control method, device, equipment and storage medium" with publication number CN113821287B, "Cell manipulation robot control method, device, equipment and storage medium" with publication number CN113771030A, "Cell manipulation robot control method, device, equipment and storage medium" with publication number CN113733087B are all described in detail.

[0233] f) After the cell clones in the well plate are cultured to a certain number, they are transferred to a larger well plate for culture, and finally expanded to a shake flask for culture, and the cell expression level is detected to confirm that the cell line selected by artificial intelligence is a high-yield cell line;

[0234] In this embodiment, step f is to transfer to a 96-well plate for amplification culture, and then transfer to a shake flask for culture.

[0235] (4) Subculturing the high protein expression monoclonal vector particles obtained in step (3), determining the subculture stability of the monoclonal vector particles based on the marker gene expression levels of the vector particles over multiple generations, obtaining high expression monoclonal vector particles with subculture stability, and using the insertion position of the exogenous gene on the endogenous gene as the fixed integration site.

[0236] (4-1) obtaining the marker gene expression levels of the monoclonal vector particles of multiple generations;

[0237] g) The selected high-yield cell lines are subcultured. Before each generation of cell lines is subcultured, a portion of the sample is diluted and placed in a culture dish to be imaged using a microscope. Images of the cell lines are continuously taken for several generations. Currently, photography can be used to predict the expression of the selected cells through a model learned from cell morphology, and the expression of the selected cells can also be fluorescently labeled.

[0238] Step g: Photographing Monoclonal Cells In this example, a Thermo Fisher Scientific M7000 microscope was used to photograph the cells.

[0239] (4-2) using an intelligent algorithm to evaluate the differences in marker gene expression levels of multiple generations of monoclonal vector particles according to the marker gene expression levels of multiple generations of monoclonal vector particles obtained in step (4-1);

[0240] (4-3) Determining whether the monoclonal vector microparticles have generation stability based on the difference in marker gene expression levels of the multiple generations of monoclonal vector microparticles obtained in step (4-2).

[0241] h) Input the collected cell line images of several generations into the artificial intelligence algorithm, predict the cell line's stability according to the fluorescence intensity and / or protein expression, and select the cell line with high protein expression characteristics that can be stably propagated as the final candidate cell line; the prediction of the cell line's stability can be based on fluorescence, or based on cell morphology instead of fluorescence. The following h step is the prediction of protein expression based on cell morphology instead of fluorescence. The final candidate cell line is the site-specific integration vector particle.

[0242] Step h predicts the cell line stability, including but not limited to the traditional image recognition algorithm using histogram to extract image features and predict, using deep learning neural network to automatically extract image features and predict, and other image-based technical predictions. In this embodiment, a deep learning-based method is used to automatically extract image features of stable cell lines and unstable cell lines and predict stability, and the accuracy of prediction results for different cell lines reaches 84%. It is described in detail in the Chinese patent document "Cell Line Stability Prediction Method, Device, Computer Equipment and Storage Medium".

[0243] (5) After the stable cell lines screened by AI were expanded and cultured into shake flasks, the growth curve was monitored for 14 days with CHO-K1 cells as the control. The inoculation density was 5×105 / ml, the inoculation system was 30ml, and the cells were counted on the day of inoculation, the 3rd day of culture, the 5th day of culture, the 7th day of culture, the 9th day of culture, the 11th day of culture, the 13th day of culture, and the 14th day of culture. The monoclones with a growth rate lower than that of CHO-K1 were screened and eliminated, and the site-specific integration vectors with high expression and higher stability in passages than the CHO-K1 cell line were obtained.

[0244] (6) The site-specific integration vector with high expression and higher stability than that of CHO-K1 cell line was subjected to stable subculture, subcultured every 3 or 4 days, the cell density of 4-day subculture was 3×105 / ml, and the cell density of 3-day subculture was 5×105 / ml. The fluorescence value of the cell line was regularly monitored during subculture. The above-mentioned high-fluorescence cell line was subjected to a subculture stability study for about 90 days using the subculture medium, and cells with small fluorescence changes and stable cell line growth were confirmed to be stable high-fluorescence cells; the copy number and integration site of the stable high-fluorescence cells were verified. The stable high-fluorescence cells here are site-specific integration vectors with high subculture stability and high expression.

[0245] The above-mentioned site-specific integration vector is used as an example to integrate the exogenous target gene and screen out the exogenous target gene expression vector particles with high target gene expression amount and high passage stability. The method for site-specific integration of the exogenous target gene provided by the present invention comprises the following steps:

[0246] Obtain the site-specific integration vector particles provided by the present invention, use the first homologous arm of the exogenous gene in the site-specific integration vector particles to perform homologous recombination, recombining the exogenous target gene expression fragment into the gene of the site-specific integration vector particles while removing the marker gene expression fragment.

[0247] The specific steps are:

[0248] (7) The stable high fluorescent cells are electroporated using a plasmid carrying an exogenous target gene, and co-transfected with Bxb1 integrase into the stable high fluorescent cells. The plasmid carrying the exogenous target gene is an exogenous gene including two attB sequences and a target gene sequence between the two attB sequences. The exogenous gene includes an exogenous target gene expression fragment that can be replaced with a marker gene expression fragment inserted into an endogenous gene, and the exogenous target gene expression fragment includes two attB sequences and a target gene sequence between the two attB sequences. Under the action of Bxb1 integrase, the attP on the left side of the marker gene EGFP forms attL with the attB on the left side of the target gene, and the attP on the right side of the marker gene EGFP forms attR with the attB on the right side of the target gene, and at the same time, the exogenous target gene expression fragment completes the replacement of the marker gene expression fragment.

[0249] Two days after electroporation, check the plate and record the electroporation effect. At the same time, use hygromycin to pressurize the plate to a concentration of 250ug / ml. Then divide the plate into 96-well plates with 6000-10000 cells in each well.

[0250] The 96-well plate was placed in a carbon dioxide constant temperature incubator (37°C, 80% humidity) for 1-2 weeks, and the proportion of non-fluorescent cells in the minipool was counted, and the non-fluorescent cells were manually enriched and monocloned by limiting dilution.

[0251] (8) The 96-well plate of monoclonal clones was placed in a CO2 constant temperature incubator (37°C, 80% humidity) for 14 days. During this period, monoclonal clones were photographed on the day of inoculation, the first day of culture, the second day of culture, the third day of culture, the seventh day of culture, and the fourteenth day of culture to confirm the monoclonal clones and fluorescence conditions.

[0252] The formation of monoclonal cells and the screening of stable high-expressing cell lines can also be achieved through artificial intelligence. The specific steps of artificial intelligence implementation are as described in the ah process in step 5 above, with the difference that in this step c, historical images of CHO cells containing marker gene expression fragments with a length similar to the DNA sequence length of the exogenous target gene expression fragment inserted in the target cell line are used to perform high expression prediction analysis using the prediction model generated by artificial intelligence image learning, thereby obtaining exogenous target gene expression vector particles.

[0253] (9) After 14 days, the confirmed non-fluorescent and normally growing monoclones were expanded to 24-well plates and cultured in a constant temperature incubator (37°C, 80% humidity) for continued expansion and expansion to the shake flask stage. After about 1 month, the cell line can enter the feeding stage through fed-batch culture (Advance + 1% Glutamax, i.e., fed-batch culture medium, for the first three days). On the 3rd and 5th days of culture, 3% (v / v) Cell Boost 7a and 0.3% (v / v) Cell Boost 7b (cytiva) were added simultaneously. On the 7th, 9th, 11th and 13th days of culture, 5% (v / v) Cell Boost 7a and 0.5% (v / v) Cell Boost 7b (cytiva) were added simultaneously every day. On the 3rd, 5th, 7th, 9th, 11th and 13th days of culture, sugar was supplemented according to the sugar consumption of the cells and the expression level was evaluated.

[0254] (10) The monoclonal cells with higher expression were confirmed to be continuously subcultured for about 90 days. During this period, 5×106 cells were retained to extract the genome for site replacement verification and residual gene detection. Then, the 1st, 13th and 26th generations were batch cultured for 7 days to confirm the stability of expression and QP. "QP stability" refers to the stability of the daily production of a single cell.

[0255] Steps 1-6 in the above process complete the "mother cell line construction + screening", and the mother cell line construction and screening are completed by a one-step method to obtain the site-specific integration vector particles. Steps 7 and 8 in the above process complete the "target cell line construction + first screening", and realize the site-specific integration of the exogenous target gene, and complete the initial screening of the target cell line. The target cell line that has been initially screened is screened for the second and third time through steps 9 and 10 to screen out the exogenous target gene expression vector particles with higher expression amount and better stability. The insertion position of the exogenous gene where the exogenous target gene expression fragment in the exogenous target gene expression vector particle is the same as the insertion position of the exogenous gene where the marker gene expression fragment in the site-specific integration vector particle is located. When the same site-specific integration vector particles are used, the insertion position of the exogenous gene where the exogenous target gene expression fragment in the exogenous target gene expression vector particle obtained by the above exogenous target gene integration method is the same, thereby realizing the site-specific integration of the target gene.

[0256] The two-step screening method of "mother cell line construction + screening" in the prior art takes 12 months. By adopting steps 1-6 in the above process to complete the one-step screening of "mother cell line construction + screening", it only takes 6 months, which shortens the time by 50%, and the mother cell line is highly stable and has a high expression level. The main reason for the significant reduction in time is the use of the one-step method of "mother cell line construction + screening", and the efficient and rapid screening of monoclonal cell lines through artificial intelligence.

[0257] Using the existing technology, it takes 12 months to complete the "construction of the target cell line + screening". By adopting steps 7-10 in the above process to complete the "construction of the target cell line + screening", it only takes 6 months, which shortens the time by 50%, and the target cell line is highly stable, and the expression level of the exogenous target gene is high. The main reason for the significant shortening of the time is that the mother cell line has high stability and high expression level, and the exogenous target gene is inserted into a specific site in the mother cell line by site-directed integration, thereby shortening the "construction of the target cell line + screening" process, and the prepared target cell line has high stability and high expression level of the exogenous target gene.

[0258] Furthermore, when predicting the expression level, the cell images with the exogenous gene inserted inside are used for learning, and when predicting the mother cell, the historical cell images with the exogenous gene inserted into the original cell with a DNA sequence length similar to that of the exogenous gene inserted into the mother cell are used for learning, which is used for the advance prediction of the expression level, and then for the screening of the mother cell line. When predicting the target cell line, the cell images with the exogenous gene inserted into the mother cell with a DNA sequence length similar to that of the exogenous gene inserted into the target cell are used for learning, which is used for the advance prediction of the expression level, and then for the screening of the product cell line, thereby improving the sites that can highly express the exogenous target gene. Such a setting can reduce the occurrence of the inability to highly express the exogenous target gene due to the large difference between the length of the exogenous target gene expression fragment containing the exogenous target gene that needs to be site-specifically integrated into a specific site and the length of the marker gene expression fragment inserted when screening the mother cell.

[0259] Example 2: Screening of S6C7 site and preparation of site-specific integration vector particles and vector particles for expression of exogenous target genes

[0260] The site-specific integration vector particles and exogenous target gene expression vector particles prepared in this example according to the method described in Example 1 are different from those in Example 1 in that:

[0261] The specific steps of differentiation are:

[0262] (1) The operation flow of this embodiment 2 is as follows Figure 5Specific consumables include: Neon Resuspension Buffer R (ThermoFisher), a resuspension buffer for cell electroporation; E1 Buffer (ThermoFisher), a recovery medium consisting of 80% (v / v) EX-CELL CHO Cloning Medium (Sigma-Aldrich) and 20% (v / v) EX-CELL Advanced CHO Fed-batch Medium (Sigma-Aldrich) with 1% GlutaMAX (ThermoFisher); both the expansion medium and the subculture medium are EX-CELL Advanced CHO 1% GlutaMAX (ThermoFisher) was added to Fed-batch Medium; pressurized medium 1 was the passage medium supplemented with G418 at a final concentration of 800 μg / ml; pressurized medium 2 was the passage medium supplemented with hygromycin at a final concentration of 250 μg / ml; the conditioned medium was the supernatant obtained by sterile filtration after culturing CHO-K1 for 1 day after inoculation of the passage medium; the cloning medium was 75% (v / v) EX-CELL CHO Cloning Medium, 20% (v / v) conditioned medium and 5% (v / v) ClonaCell-CHO ACF Supplement supplemented with 1% GlutaMAX; the basal medium in the fed-batch medium was EX-CELL Advanced CHO Fed-batch Medium supplemented with 1% GlutaMAX (ThermoFisher), and the feed medium was CellBoost7a / 7b (HyClone).

[0263] (2) The site-directed integration vector particles obtained in step 6 were named GBB003 mother cells.

[0264] (3) The target genes in step 8 are target gene 1 (monoclonal antibody), target gene 2 (monoclonal antibody), target gene 3 (fusion protein), target gene 4 (bivalent antibody; IgG-SCFV), and target gene 5 (bivalent antibody; KiH-Crossmab). Target genes 1 to 5 are cloned into different plasmids by restriction digestion and ligation to construct recombinant plasmids containing RMCE. The recombinant plasmids of target gene 1, target gene 2, target gene 4, and target gene 5 are as follows: Figure 6 As shown, the recombinant plasmid of target gene 3 is as Figure 7 shown.

[0265] The length of the exogenous fragment inserted into the endogenous gene in GBB003 mother cells is 7545bp, the length of the marker gene expression fragment is 3815bp, and the length of the remaining fragment is 3730bp. Among them, the length of the exogenous target gene expression fragment corresponding to target gene 1 is 6817bp, the length of the exogenous target gene expression fragment corresponding to target gene 2 is 6866bp, the length of the exogenous target gene expression fragment corresponding to target gene 3 is 2548bp, the exogenous target gene expression fragment corresponding to target gene 4 is 7688bp, and the length of the exogenous target gene expression fragment corresponding to target gene 5 is 12256bp. The stability of the site and / or the editable length of the gene fragment are verified by inserting gene fragments of different lengths.

[0266] The exogenous target gene 1 has a light chain sequence shown in SEQ ID No. 2; the exogenous target gene 1 has a heavy chain sequence shown in SEQ ID No. 3;

[0267] The exogenous target gene 2 has a light chain sequence shown in SEQ ID No. 4; the exogenous target gene 2 has a heavy chain sequence shown in SEQ ID No. 5;

[0268] The exogenous target gene 3 has the sequence shown in SEQ ID No. 24;

[0269] The exogenous target gene 4 has a light chain sequence shown in SEQ ID No. 25; the exogenous target gene 4 has a heavy chain sequence shown in SEQ ID No. 26;

[0270] The exogenous target gene 5 has the target gene 5 light chain 1 sequence shown in SEQ ID No.27, the target gene 5 heavy chain 1 sequence shown in SEQ ID No.28, the target gene 5 light chain 2 sequence shown in SEQ ID No.29 and the target gene 5 heavy chain 2 sequence shown in SEQ ID No.30.

[0271] (4) In step 9, the expression levels of the site-specific integrated product minipool cell pool (GBB003-minipool), the exogenous target gene 1 expression vector particles (referred to as GBB003-2D8 cells), the randomly integrated minipool cell pool (random minipool), and the single copy cell line (random monoclonal clone) cultured under the same conditions were compared as shown in the following table. Figure 8 shown.

[0272] (5) In step 10, the 1st, 13th, and 26th generations were batch cultured for 7 days, and sugar was supplemented on the 3rd, 5th, and 7th days according to the sugar consumption of the cells. The expression level was as follows Fig. 9 As shown, the expression level showed that the monoclonal cell line was stable and highly productive.

[0273] The second generation whole genome sequencing of the corresponding mother cell GBB003 of the cell line with high expression of both fluorescent gene and target gene was performed, and the mother cell GBB003 was obtained as a single copy, and the annotation information of the integration site on CHO-K1 was: NW_003616785.1:83044. This integration site is the insertion position of the exogenous gene on the endogenous gene, and this integration site is named S6C7.

[0274] The sequence fragment after integration of the target gene 1 is shown in SEQ ID No.6; the breakpoint upstream primer F1 (SEQ ID No.7): AGACCAGCCTCAGATGTCACAC and the target gene downstream primer R1 (SEQ ID No.8): AGGCACACAACGGAGGCGGT on the plasmid used for integration were used to amplify the GBB003-2D8 cell genome, and the target gene 1 downstream primer R1 was located in the light chain of the target gene 1, and a fragment conforming to the theoretical size of 3403 bp was obtained, as shown in Fig.10 (corresponding bands in the GBB003-2D8 cell lane) are shown.

[0275] The sequence fragment after integrating the target gene 1 contains attL, and the nucleotide sequence of attL is shown in SEQ ID No. 9, SEQ ID No. 9: ATGATCCTGACGACGGAGACCGCGGTGGTTGACCAGACAAACC. In the sequence fragment after integrating the target gene 1, the part before attL is an exogenous sequence, and the part after attL is an endogenous sequence. The exogenous sequence contains a partial sequence of the light chain reading frame of the target gene 1, that is, the sequence amplified and contained in SEQ ID No. 8. The target gene 1 can encode a monoclonal antibody.

[0276] The amplified bands were recovered by gel excision, purified, and multiple pairs of primers were designed for DNA sequencing. The sequence after splicing of the sequencing results was shown in SEQ ID No. 6, which was consistent with the theoretical sequence, thereby confirming that the target gene 1 was correctly integrated into the corresponding position of the marker gene expression fragment.

[0277] It is further explained that the vector particle CHO-K1 cell has a S6C7 site, which is located in the fragment SEQ ID No. 1 shown in SEQ ID No. 1. Specifically, the annotation information of the integration site S6C7 on CHO-K1 is: NW_003616785.1:83044.

[0278] Similarly, the sequence fragment after site-directed integration of the exogenous target gene 2 into GBB003 mother cells is shown as SEQ ID No.10.

[0279] The above-mentioned breakpoint upstream primer F1 (SEQ ID No. 7): AGACCAGCCTCAGATGTCACAC and the target gene 2 downstream primer R2 (SEQ ID No. 11): CCTTAGAATCCTGCTCGGTGA on the exogenous target gene 2 insertion fragment were used to amplify the genome of the cell line of GBB003 mother cell site-specific integration of the exogenous target gene 2 to obtain a fragment that meets the theoretical size (3486 bp), such as Fig.11 (corresponding band of lane GBB003-1G2) as shown.

[0280] The amplified bands were cut and recovered, purified, and multiple pairs of primers were designed for DNA sequencing. The sequence after the sequencing results were spliced ​​was shown in SEQ ID No. 10, which was consistent with the theoretical sequence (sequence SEQ ID No. 10), thereby confirming that the exogenous target gene 2 was correctly integrated into the corresponding position of the marker gene expression fragment. Among them, the sequence fragment after the integration of the exogenous target gene 2 contains attL. In the sequence fragment after the integration of the exogenous target gene 2, the part before attL is the exogenous sequence, and the part after attL is the endogenous sequence. The exogenous sequence contains the target gene 2.

[0281] Similarly, the sequence fragment after the exogenous target gene 3 was site-directedly integrated into the GBB003 mother cell is shown in SEQ ID No.31; the above-mentioned breakpoint upstream primer F1 (SEQ ID No.7): AGACCAGCCTCAGATGTCACAC and the target gene 3 downstream primer R2 (SEQ ID No.32): CTCGACGCCATCCACGTACCAG on the exogenous target gene insertion fragment were used to amplify the genome of the cell line of the GBB003 mother cell site-directed integration of the exogenous target gene 3 to obtain a fragment that meets the theoretical size (2713 bp), as shown in Fig.12 (GBB003-1D6 lane corresponding band). Thus confirming that the exogenous target gene 3 is correctly integrated into the corresponding position of the marker gene expression fragment. Among them, the sequence fragment after the integration of the exogenous target gene 3 contains attL. In the sequence fragment after the integration of the exogenous target gene 3, the part before attL is the exogenous sequence, and the part after attL is the endogenous sequence. The exogenous sequence contains the target gene 3.

[0282] Similarly, after the GBB003 mother cell was integrated with the target gene 4, two cell lines Y5E6 and Y6F10 were selected by AI prediction as the exogenous target gene expression vector particles for 90-day subculture. The cell viability stability of the subcultured cells was as follows: Fig.13 As shown, the stability of cell proliferation rate is Fig.14 shown.

[0283] The glycoform results of the product quality attributes of Y5E6 cells and Y6F10 cells formed after integration are as follows Fig.15As shown in Figure 2, the charge heterogeneity comparison results are shown in Figure 2. Fig.16 As shown, the results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis are as follows Fig.17 The above results indicate that GBB003 mother cells can integrate the exogenous target gene expression fragment with a length of 7688 bp and can stably express the target gene in the exogenous target gene expression fragment with a length of 7688 bp.

[0284] Similarly, the concentration of the antibody expressing target gene 5 in the six-well batch culture of the cell pool after GBB003 mother cells integrated target gene 5 is as follows Fig.18 As shown, the results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis are as follows Fig.19 The above results indicate that the GBB003 mother cell line can integrate the exogenous target gene expression fragment with a length of 12256 bp, and can stably express the target gene in the exogenous target gene expression fragment with a length of 12256 bp.

[0285] Combined with the expression and passage stability of target gene 1, target gene 2, target gene 3, target gene 4, or target gene 5 integrated into the GBB003 mother cell line, it was found that the site-specific integration vector particles screened by the method of this embodiment can be used for the integration of exogenous target gene expression fragments of different lengths.

[0286] Example 3: Screening of S4F6 sites and preparation of site-specific integration vector particles and vector particles expressing exogenous target genes

[0287] This example screens the S4F6 site and prepares site-specific integration vector particles and exogenous target gene expression vector particles according to the scheme of Example 2. The difference from Example 2 is that:

[0288] The specific steps of differentiation are:

[0289] (1) The consumables in the specific embodiments include: Neon Resuspension Buffer R (ThermoFisher), electroporation solution E (ThermoFisher), recovery medium EX-CELL Advanced CHO Fed-batch Medium (Sigma-Aldrich), expansion medium EX-CELL Advanced CHO Fed-batch Medium plus 200 μg / ml hygromycin (ThermoFisher) and 1% GlutaMAX (ThermoFisher), shake flask medium EX-CELL Advanced CHO Fed-batch Medium plus 1% GlutaMAX, basal medium in the fed-batch medium uses 100% EX-CELL Advanced CHO Fed-batch Medium, and feed medium is 4% Cell Boost 7a / 7b (HyClone).

[0290] (2) In step 6, the high fluorescence cell line was subjected to a 90-day stability study, with the cell line being subcultured every 3 or 4 days, the cell density being 3×105 / ml for 4 days, and the cell density being 5×105 / ml for 3 days. The fluorescence value of the cell line was monitored during the subculture, and cells with small fluorescence value changes and stable cell line growth were confirmed to be stable high fluorescence cells. This cell line was named GBB-01 cells, GBB-01 cells were the mother cell line, and GBB-01 cells were the preferred site-specific integration vector particles. Fig.19 It shows that the growth of GBB-01 cells is stable after 90 days of subculture. Table 1 shows that the protein expression of GBB-01 cells is stable.

[0291] Table 1

[0292] Mean fluorescence value Fluorescent cell percentage (%) Generation 3 (Day 10) 25.5 100 Generation 26 (Day 91) 22.3 100

[0293] (3) In step 7, the target gene 6 recombinant plasmid contains an exogenous target gene 6 expression fragment having the target gene 6 between attB. The target gene 6 fragment is cloned into the exogenous target gene 6 expression fragment (such as Fig.21 ) were electroporated and verified with the Bxb1 integrase plasmid (as Fig. 22As shown in the figure, the prokaryotic resistance gene is used for prokaryotic plasmid construction and screening, homology arm 1 (attP in the marker gene expression fragment in the mother cell GBB-01) and homology arm 2 (attB in the exogenous target gene expression fragment) are used to produce recombination replacement with the screened mother cell strain, promoter 1 is used to drive the expression of hygromycin gene after recombination with the mother cell, promoter 3 is used to drive the expression of the target gene, and BamH I and Xho I are used to cut and insert. The Bxb1 integrase plasmid structure is shown in the figure. Fig. 22 As shown, the prokaryotic resistance gene is used for prokaryotic plasmid construction and screening, promoter 1 is used to drive the expression of Bxb1 recombinase gene, and promoter 2 is used to drive the expression of prokaryotic resistance gene.

[0294] The length of the exogenous gene fragment inserted into the endogenous gene in GBB-01 mother cells is 7545 bp, the length of the marker gene expression fragment in the exogenous gene is 3815 bp, the length of the remaining exogenous gene fragment is 3730 bp. The length of the exogenous target gene expression fragment containing target gene 6 is 2227 bp.

[0295] The target gene 6 fragment has the sequence shown in SEQ ID No.13.

[0296] (4) In step 9, the non-fluorescent cells in the monoclonal cells (i.e., the expression vector particles of the exogenous target gene 6) are further amplified (using amplification medium), expanded to the shake flask stage culture (using shake flask medium), and the expression level is evaluated by fed-batch culture (using fed-batch medium). The expression level of the expression vector particles of the exogenous target gene 6 with fixed integration (referred to as GBB-01-H8 cells) and the cell line with three copies of the randomly integrated target gene 6 cultured under the same conditions are compared as follows: Fig.23 As shown, "targeted integration single copy" refers to GBB-01-H8 cells.

[0297] (5) In step 10, GBB-01-H8 cells were continuously passaged for about 90 days for stability assessment, and batch culture (only basal medium culture) for 7 days. The results showed that GBB-01-H8 cells had no significant difference in expression level ( Fig.24 ) and specific yield ( Fig.25 ) showed stability in passage and high expression level.

[0298] The quality attributes of GBB-01-H8 cells were studied and compared with the cell line expression products obtained by random integration method in the following aspects:

[0299] according to Fig.26 Sugar profile comparison results and Fig. 27The charge heterogeneity comparison results showed that the quality attributes of the targeted integration cell product (i.e., GBB-01-H8 cells) and the control cell product (i.e., the cell line expression product obtained by the random integration method) were similar, with no significant differences.

[0300] The GBB-01 cells corresponding to the GBB-01-H8 cells that highly expressed the fluorescent protein EGFP and the target gene 6 were sequenced by the second generation whole genome, and the annotation information of the integration site on CHO-K1 was obtained as follows: NC_048596:34375010 is located in the intergenic region. This integration site is the insertion position of the exogenous gene on the endogenous gene, and this integration site is named S4F6.

[0301] The sequence fragment of NC_048596 after integration of the target gene 6 is shown as SEQ ID No.14.

[0302] The GBB-01-H8 cell genome was amplified using the above-mentioned breakpoint upstream primer F (SEQ ID No. 15): tgcagccacactaagatgg and the target gene 6 downstream primer R (SEQ ID No. 16): ccagagacaggctcaaggac on the exogenous target gene 6 expression fragment to obtain a fragment that meets the theoretical size (2876 bp), such as Fig.28 (corresponding band of lane GBB-01-H8) is shown.

[0303] The amplified bands were recovered by gel excision, purified, and multiple pairs of primers were designed for DNA sequencing. The sequence after splicing of the sequencing results was shown in SEQ ID No. 14, which was consistent with the theoretical sequence, thereby confirming that the target gene 6 was correctly integrated into the corresponding position of the marker gene expression fragment.

[0304] Comparative Example 1. Performance comparison of the exogenous target gene expression vector microparticles prepared by the present application method and the exogenous target gene expression vector microparticles constructed by CRISPR / Cas9

[0305] (1) Construction of Cas9 editing plasmid:

[0306] Design a sequence with high shearing efficiency such as sgRNA shown in SEQ ID No.17 that can target the 1678-1744 base interval of the nucleic acid fragment shown in SEQ ID No.12 (SEQ ID No.17: gatgtcacccacaccagaggttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc; GC=55%, no secondary), and merge and anneal the double strands. The reaction system is 5μL of each forward and reverse oligo, 5μL of 10×NEB buffer 2, and water is added to 50μL. The system is incubated at 95℃ (must be measured with a thermometer) for 5min, and then naturally cooled to 25℃. The resulting plasmid is connected to the pDonor CRISPR / Cas9 vector cut with PvuI. The ligation product is transformed into DH5α competent medium, coated on ampicillin-resistant LB solid plate, single clones are picked the next day, and plasmids are extracted. Finally, the correct Cas9 encoding plasmid was verified by first-generation sequencing.

[0307] (2) Construction of donor plasmid:

[0308] The donor plasmid is composed of a 5' homology arm, an anti-PD1 monoclonal antibody encoding gene, a hygromycin encoding gene and a 3' homology arm connected in series on a pUC19 plasmid.

[0309] (3) Electroporation transfection of Cas9 encoding plasmid and anti-PD1 donor plasmid:

[0310] Suspended Chinese hamster ovarian cancer cells, namely CHO-K1 cell line, were used. The cell density was adjusted to 5×105 / mL the day before transfection. The next day, electroporation was used for transfection, with the conditions of voltage 1575V, pulse duration 10ms, and 3 pulses. A 6-well plate for cell culture was used for transfection, 3×106 cells, a culture medium volume of 2mL, and 15μg of plasmid required. After transfection, the cells were placed in an incubator at 37°C and 5% CO2 for culture. Among them, adding Cas9 encoding plasmid and anti-PD1 donor plasmid for co-transfection can obtain a fixed-site integrated cell pool, and adding only anti-PD1 donor plasmid for transfection can obtain a random integrated cell pool expressing anti-PD1.

[0311] (4) Pressure screening and enrichment of site-specific integrated cell pools.

[0312] (5) Preliminary identification of the site-specific integrated cell pool by 5' / 3' junction PCR, sequencing of the amplified target fragment, and collection of the supernatant after confirmation of the site-specific integrated cell pool.

[0313] (6) Western blot was used to detect the expression of anti-PD1 antibodies in the site-specific integrated cell pool, confirming that the site-specific integrated cell pool was obtained. After 3 weeks of drug addition screening, the expression of anti-PD1 antibodies in the random integrated cell pool was basically undetectable by Western blot, while the expression of anti-PD1 antibodies in the site-specific integrated cell pool was higher.

[0314] (7) Obtaining monoclonal cell lines by limiting dilution method: Obtain monoclonal cell lines by limiting dilution method from the previously site-directed integration cell pool. That is, the cell pool is plated on a 96-well plate with a cell density of 0.8 cells / well. Check the plate on the same day to determine the monoclonality. When the cells have grown for about 5 weeks, aspirate 1×106 monoclonal cells and extract genomic DNA, and perform 5' / 3' junction PCR detection again, using the same method as step (5). The positive cell lines obtained by junction PCR detection are further subjected to Western blot detection to determine whether the anti-PD1 antibody is correctly expressed.

[0315] (8) Evaluation of the expression of anti-PD1 antibodies in site-specific integrated cell lines: The expression of anti-PD1 antibodies in site-specific integrated cell lines is approximately 2.3 times that of random integrated cell lines. Site-specific integrated cell lines can also be understood as targeted integrated cell lines, where the target is a fixed site.

[0316] Table 2

[0317] Integration site Anti-PD1 antibody expression level of targeted integrated cell lines (mg / L) NC_048596:34375010 705 Single copy random integration cell line 285mg / L

[0318] According to the steps of Example 3, exogenous target gene expression vector particles of GBB-01 cells with anti-PD1 antibody editing gene as the target gene and S4F6 site (NC_048596:34375010) as the fixed integration site were constructed, and the cell line with single copy random integration of anti-PD1 antibody editing gene was used as the control. The expression level of 6-well plate batch culture in the basal medium is shown in Table 2, wherein the expression level of anti-PD1 antibody of the cell line with single copy random integration in 6-well plate batch culture is 285 mg / L, while the expression level of exogenous target gene expression vector particles of GBB-01 cells with anti-PD1 antibody editing gene as the target gene and S4F6 site as the fixed integration site is 705 mg / L, which is 2.47 times the expression level of the cell line with single copy random integration, which is better than the exogenous target gene expression vector particles constructed by CRISPR / Cas9.

[0319] Example 4: Screening of S2C4 site and preparation of site-specific integration vector particles and vector particles expressing exogenous target genes

[0320] This example screens the S2C4 site and prepares site-specific integration vector particles and exogenous target gene expression vector particles according to the scheme of Example 2. The difference from Example 2 is that:

[0321] The specific steps of differentiation are:

[0322] (1) The consumables in the specific embodiments include: Neon Resuspension Buffer R (ThermoFisher), electroporation solution E (ThermoFisher), recovery medium EX-CELL Advanced CHO Fed-batch Medium (Sigma-Aldrich), expansion medium EX-CELL Advanced CHO Fed-batch Medium plus 200 μg / ml hygromycin (ThermoFisher) and 1% GlutaMAX (ThermoFisher), shake flask medium EX-CELL Advanced CHO Fed-batch Medium plus 1% GlutaMAX, basal medium in the feed medium uses 100% EX-CELL Advanced CHO Fed-batch Medium plus 1% GlutaMAX, and feed medium is 4% Cell Boost 7a / 7b (HyClone).

[0323] (2) In step 1, the cells in the stable cell pool are screened for high fluorescence cells to obtain the 1% cells with the highest fluorescence.

[0324] (3) In step 2, the growth of the enriched cells is observed at any time. When the coverage rate reaches more than 50%, the cells are expanded in the manner of 96-well plate to 6-well plate.

[0325] (4) In step 6, the monoclonal fluorescent site-specific integration vector particles inserted into the endogenous gene expression fragment are amplified and cultured, and stable subculture is performed, and the subculture is performed every 3 or 4 days. The cell density of the 4-day subculture is 3x105 / ml, and the cell density of the 3-day subculture is 5x105 / ml. The fluorescence value of the cell line is monitored during the subculture, and the total subculture is 90 days. The high-fluorescence cell line is retained as the preferred site-specific integration vector particle, recorded as GBBc001 cells, and used as the mother cell for subsequent site-specific integration of the exogenous target gene.

[0326] (5) In step 7, a target gene 3 (fusion protein) or target gene 1 (monoclonal antibody) fragment is cloned into a plasmid to construct a target gene 3 recombinant plasmid containing RMCE (e.g. Figure 7 ) and a target gene 1 recombinant plasmid containing RMCE (as Figure 6 ). The target gene 3 recombinant plasmid contains an exogenous target gene 3 expression fragment having the target gene 3 between attB. The target gene 1 recombinant plasmid contains an exogenous target gene 1 expression fragment having the target gene 1 between attB.

[0327] (6) In step 8, the proportion of non-fluorescent cells in the cell pool is counted, and the cells are enriched and expanded after the viability is restored to more than 90%. After the viability is restored to 90%, the cell pool is plated by limiting dilution method to monoclonize the cell pool.

[0328] (7) In step 9, 14 days later, the confirmed non-fluorescent and normally growing monoclonal exogenous target gene expression vector particles (i.e., monoclonal cells) were expanded to a 24-well plate for further amplification (Advanced+1% Glutamax), and then expanded to the shake flask stage culture (Advanced+1% Glutamax). After about 1 month, the cell line can enter the feeding stage, through fed-batch culture (Advanced+1% Glutamax for the first three days, 3% 7a and 0.3% 7b (cytiva) on the 3rd and 5th days, 5% 7a and 0.5% 7b (cytiva) were added every day on the 7th, 9th, 11th and 13th days of culture, and sugar was supplemented according to the sugar consumption of the cells on the 3rd, 5th, 7th, 9th, 11th and 13th days of culture, and the expression level was evaluated. The expression level of the exogenous target gene 3 expression vector particles with a single copy of the target gene 3 integrated at the site was compared with the randomly integrated cell line cultured under the same conditions. Fig.29 As shown in the figure (GBBc001 in this figure represents the exogenous target gene 3 expression vector microparticle). The expression level of the exogenous target gene 1 expression vector microparticle with a single copy of the target gene 1 integrated at the fixed site and the cell line with random integration of the target gene 1 cultured under the same conditions is compared as shown in the figure below. Fig.29 As shown (in this figure, GBBc001 represents the exogenous target gene 1 expression vector microparticle).

[0329] (13) In step 10, in order to investigate the stability of the cell product clones corresponding to the exogenous target gene 3 expression vector microparticles, the product clones were continuously subcultured for about 90 days for stability assessment. During the continuous subculture process, the exogenous target gene 3 expression vector microparticles of the 1st, 13th and 26th generations were batch cultured for 7 days (Advanced+1% GlutaMAX), and sugar was supplemented on the 3rd, 5th and 7th day of culture according to the sugar consumption of the cells, as shown in FIG. Fig.31As shown, the results show that the exogenous target gene 3 expression vector particles show the stability of passage and high expression level from the expression level of target gene 3. At this time, the exogenous target gene 3 expression vector particles are called GBBc001-14 cells. The exogenous target gene 1 expression vector particles are called GBBc001-3 cells.

[0330] The second generation whole genome sequencing was performed on the mother cell GBBc001 corresponding to the GBBc001-14 cells which highly expressed the fluorescent gene EGFP and the target gene 3, and the annotation information of the integration site on CHO-K1 was obtained as follows: NC_048595:28250698, located at intron 3of11 of Mtf1. The insertion position of the exogenous gene on the endogenous gene in the mother cell GBBc001 is NC_048595:28250698, and this insertion position is named S2C4 site, which is within the nucleic acid fragment shown in SEQ ID No.18 or SEQ ID No.33.

[0331] The sequence fragment after integration of target gene 3 is shown as SEQ ID No.19.

[0332] The GBBc001-14 cell genome was amplified using the breakpoint upstream primer F1 (SEQ ID No. 20: gtctgggcatggtggttgca, 131 bp upstream of the breakpoint in the genome) and the target gene 3 downstream primer R1 (SEQ ID No. 21: gaggacactccacgcaaca, about 600 bp downstream of the translation start site of the target gene 3) in the exogenous target gene expression fragment to obtain a fragment that met the theoretical size (2113 bp) (131 bp in the genome, 696 bp in the original vector integrated into the genome, and 1286 bp in the product sequence after site replacement), as shown in FIG. Fig.32 (corresponding band of lane GBBc001-14) is shown.

[0333] The amplified bands were recovered by gel excision, purified, and multiple pairs of primers were designed for DNA sequencing. The sequence after splicing of the sequencing results was shown in SEQ ID No. 19, which was consistent with the theoretical sequence, thereby confirming that the target gene 3 was correctly integrated into the corresponding position of the marker gene expression fragment.

[0334] Similarly, the sequence fragment of the cell line GBBc001-3 which highly expresses both the fluorescent gene EGFP and the target gene 1 after the target gene 1 is integrated is shown in SEQ ID No.22.

[0335] The GBBc001-3 cell genome was amplified using the breakpoint upstream primer F3 (SEQ ID No. 20): gtctgggcatggtggttgca and the target gene 1 downstream primer R3 (SEQ ID No. 23): actcgcctctattgaagct on the exogenous target gene 1 expression fragment to obtain a fragment that met the theoretical size (3198 bp), such as Fig.33 (corresponding band of lane GBBc001-3) is shown.

[0336] The amplified bands were recovered by gel excision, purified, and multiple pairs of primers were designed for DNA sequencing. The sequence after splicing of the sequencing results was shown in SEQ ID No. 22, which was consistent with the theoretical sequence, thereby confirming that the target gene 1 was correctly integrated into the corresponding position of the marker gene expression fragment.

[0337] Example 5: Site-specific integration site screening system

[0338] like Fig.34 The site-specific integration site screening system shown is an electronic device and / or a non-transitory computer-readable storage medium;

[0339] The electronic device includes a display, a microscope, a robotic arm, a stage, a memory, a processor, and a computer program stored in the memory and executable on the processor. When the processor executes the program, the steps of the method for screening site-specific integration sites as described in Examples 1 to 4 are implemented.

[0340] The non-transitory computer-readable storage medium stores a computer program thereon, and when the computer program is executed by the processor, the steps of the method for screening site-specific integration sites as described in Examples 1 to 4 are implemented.

[0341] Example 6: Site-directed integration system of exogenous target gene

[0342] like Fig.33 The exogenous target gene site-specific integration system shown is an electronic device and / or a non-transitory computer-readable storage medium;

[0343] The electronic device includes a display, a microscope, a robotic arm, a stage, a memory, a processor, and a computer program stored in the memory and executable on the processor. When the processor executes the program, the steps of the method for site-specific integration of exogenous target genes as described in Examples 1 to 4 are implemented.

[0344] The non-transitory computer-readable storage medium stores a computer program, and when the computer program is executed by the processor, the steps of the method for site-specific integration of exogenous target genes as described in Examples 1 to 4 are implemented.

[0345] It will be easily understood by those skilled in the art that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for screening site-specific integration sites, characterized in that: The following steps are involved: (1) randomly integrating an exogenous gene containing two recognition sequences and a marker gene between the two recognition sequences into an endogenous gene of a vector particle to obtain a vector particle carrying the marker gene; (2) amplifying and culturing the vector particles carrying the marker gene obtained in step (1) to form a vector particle pool to be screened; (3) performing monoclonal screening on the vector particle pool to be screened obtained in step (2), and retaining monoclonal vector particles whose expression levels of the corresponding marker genes and / or exogenous target genes are higher than a preset threshold value according to the expression levels of the marker genes and / or exogenous target genes during the monoclonal screening, to obtain monoclonal vector particles with high protein expression; (4) Subculturing the high protein expression monoclonal vector particles obtained in step (3), determining the subculture stability of the monoclonal vector particles based on the marker gene expression levels of the vector particles over multiple generations, obtaining high expression monoclonal vector particles with subculture stability, and using the insertion position of the exogenous gene on the endogenous gene as the fixed integration site.

2. The method for screening site-specific integration sites according to claim 1, characterized in that: The length of the marker gene is comparable to that of the exogenous target gene to be integrated; The marker gene has a plurality of optional lengths, preferably 0.75k, 1k, 3k, and 15k; It is preferred to use marker genes of 3k or less and predict the expression levels of exogenous target genes of other lengths through intelligent learning algorithms.

3. The method for screening site-specific integration sites according to claim 1, characterized in that: The marker gene is selected from one or more of a neomycin resistance gene, a thymidine kinase gene, a hygromycin phosphotransferase gene, a dihydrofolate reductase gene, a thymidine kinase gene, a glutamine synthetase gene, an asparagine synthetase gene, a tryptophan synthetase gene, a histidinol dehydrogenase gene, an aminoglycoside phosphotransferase gene, a tryptophan synthetase gene and a fluorescent protein gene; and / or, The carrier particles are used to express one or more of amino acids, polypeptides, proteins, nucleotides, nucleic acids, secretions, and are selected from cells, bacteria, and viruses, and are commonly carrier cells; the carrier cells are eukaryotic cells; optionally, the eukaryotic cells are mammalian cells; optionally, the mammalian cells include Chinese hamster ovary CHO cells and human embryonic kidney HEK293 cells; and / or, The recognition sequence is independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, attP sequence, attB sequence, attP-GA sequence and attB-GA sequence.

4. The method for screening site-specific integration sites according to claim 1, characterized in that: Step (3) uses image processing technology to screen monoclonal vector particles, and specific schemes include but are not limited to deep learning target detection model YOLO series and SSD series algorithm models.

5. The method for screening site-specific integration sites according to claim 4, characterized in that: Step (3) predicts the expression level of the marker gene and / or the exogenous target gene by an intelligent algorithm based on the cell image; specifically comprises the following steps: (3-1) imaging the vector particle pool to be screened obtained in step (2) to obtain an image of the vector particle to be screened; preferably, high-throughput scanning imaging is used, and when the marker gene is a fluorescent protein, high-throughput fluorescent scanning imaging is preferably used; (3-2) performing image processing on the carrier particle images to be screened obtained in step (3-1) to obtain images of each carrier particle, and using an intelligent algorithm to predict the expression level of the marker gene and / or the exogenous target gene of the carrier particle according to the image features; the image features preferably used include: cell morphological features and / or optical features, including but not limited to roundness, size, and grayscale of specific cell sites; Preferably, the expression levels of the marker gene and / or the exogenous target gene of the carrier microparticle predicted by the multiple intelligent algorithms are evaluated by using the evaluation standard normalized cumulative loss gain of the ranking algorithm to evaluate the ranking accuracy of the protein expression levels predicted by the multiple intelligent algorithms, and according to the rule that the larger the standard normalized cumulative loss gain, the better the ranking accuracy of the protein expression level, the intelligent algorithm with the best ranking accuracy of the protein expression level prediction is selected; For a specific intelligent algorithm for predicting protein expression, the standard normalized loss cumulative gain calculation formula is as follows: Wherein IDCG is the DCG value of the real ranking of the protein expression of the sample monoclonal vector particles, i represents the predicted ranking number of a monoclonal vector particle in the sample monoclonal vector particles according to the predicted protein expression of the intelligent algorithm, rel(i) represents the real protein expression of the i-th monoclonal vector particle; k is the sample size of the sample monoclonal vector particles; When the predicted protein is a fluorescent protein, rel(i) indicates the fluorescence value; when the predicted protein is a non-fluorescent protein, rel(i) It indicates the value of protein expression tested by Western blot, Elisa, mass spectrometry, electrophoresis, etc. (3-3) The carrier particles whose expression levels of the marker gene and / or the exogenous target gene exceed a preset threshold are acquired according to image positioning and moved to a preset position in the culture medium for retention.

6. The method for screening site-specific integration sites according to claim 1, characterized in that: Step (3) uses semi-solid culture medium to screen monoclonal vector particles.

7. The method for screening site-specific integration sites according to claim 1, characterized in that: Step (4) The passage stability of the monoclonal vector particles is determined by an intelligent algorithm; the specific steps are as follows: (4-1) obtaining the marker gene expression levels of the monoclonal vector particles of multiple generations; (4-2) using an intelligent algorithm to evaluate the differences in marker gene expression levels of multiple generations of monoclonal vector particles according to the marker gene expression levels of multiple generations of monoclonal vector particles obtained in step (4-1); (4-3) judging whether the monoclonal vector microparticles have generation stability according to the difference in marker gene expression levels of the multiple generations of monoclonal vector microparticles obtained in step (4-2) according to the principle that the smaller the difference in expression level, the greater the probability of having generation stability.

8. The site-specific integration vector particles obtained by screening the site-specific integration site screening method according to any one of claims 1 to 7, characterized in that: An exogenous gene is inserted into the endogenous gene of the vector particle; the exogenous gene includes two first recognition sequences and a marker gene expression segment for expressing a marker protein and arranged between the two first recognition sequences; The expression level of the marker gene of the site-specific integration vector particle is higher than the preset threshold value; The site-specific integration vector particles have stability in passage.

9. A fixed integration site screening system, characterized in that: The system is an electronic device and / or a non-transitory computer-readable storage medium; The electronic device comprises a memory, a processor, and a computer program stored in the memory and executable on the processor, wherein when the processor executes the program, the steps of the method for screening site-specific integration sites according to any one of claims 1 to 7 are implemented; The non-transitory computer-readable storage medium stores a computer program thereon, and when the computer program is executed by a processor, the steps of the method for screening site-specific integration sites according to any one of claims 1 to 7 are implemented.

10. A method for site-specific integration of an exogenous target gene, characterized in that: The following steps are involved: Obtain the site-specific integration vector particle as described in claim 8, and use the first recognition sequence in the exogenous gene in the site-specific integration vector particle to perform homologous recombination, recombining the exogenous target gene expression fragment into the gene of the site-specific integration vector particle while removing the marker gene expression fragment.

11. The method for site-specific integration of an exogenous target gene according to claim 10, characterized in that: The exogenous target gene expression fragment is arranged in a recombinant vector, and the exogenous target gene is site-specifically integrated into the site of the site-specific integration vector particle through the recombinant vector; the recombinant vector is a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, a herpes virus vector, a poxvirus vector, a baculovirus vector, a papillomavirus vector, a papillomatosis virus vector, an integrating phage vector, a non-viral vector, a transposon, a transposase, an integrase substrate or a plasmid.

12. The method for site-specific integration of an exogenous target gene according to claim 10, characterized in that: The length of the marker gene expression segment of the site-directed integration vector particle is comparable to that of the exogenous target gene expression segment.

13. The method for site-specific integration of an exogenous target gene according to claim 10, characterized in that: The method of performing homologous recombination using the first recognition sequence of the site-specific integration fragment of the site-specific integration vector particle is specifically as follows: Constructing an exogenous target gene recombinant fragment containing an exogenous target gene; wherein the exogenous gene recombinant fragment contains two second recognition sequences and an exogenous target gene expression fragment; the exogenous target gene expression fragment is between the two second recognition sequences; the exogenous target gene expression fragment includes a promoter for regulating the expression of the exogenous target gene and an exogenous target gene sequence; The exogenous gene is integrated into the site of the site-directed integration vector particle, and the two first recognition sequences on both sides of the marker gene are respectively changed into a third recognition sequence and a fourth recognition sequence; the third recognition sequence is formed by the reaction of the first recognition sequence and the second recognition sequence, and the fourth recognition sequence is formed by the reaction of the first recognition sequence and the second recognition sequence, and the third recognition sequence is different from the fourth recognition sequence.

14. The method for site-specific integration of an exogenous target gene according to claim 13, characterized in that: The third recognition sequence and the fourth recognition sequence will not become the second recognition sequence or the first recognition sequence in the same reaction system.

15. The method for site-specific integration of an exogenous target gene according to claim 13, characterized in that: The third recognition sequence and the fourth recognition sequence are generated by a recombinase, and the recombinase is one of Bxb1 integrase, ΦC31 integrase, Cre recombinase or FLP recombinase; and / or The second recognition sequence is independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, Bxb1 attP sequence, Bxb1 attB sequence, attP sequence, attB sequence, attP-GA sequence and attB-GA sequence; and / or, The third recognition sequence and the recognition sequence are independently selected from one or more of the following sequences: LoxP sequence, LoxPL3 sequence, LoxP 2L sequence, LoxFas sequence, Lox511 sequence, Lox2272 sequence, Lox2372 sequence, Lox5171 sequence, Loxm2 sequence, Lox71 sequence, Lox66 sequence, FRT sequence, attL sequence and attR sequence.

16. The method for site-specific integration of an exogenous target gene according to claim 10, characterized in that: The following steps are involved: S1. Obtain a plurality of site-directed integration vector particles as described in claim 8, and use the first recognition sequence in the exogenous gene in the site-directed integration vector particle to perform homologous recombination, so as to recombinantly transfer the exogenous target gene expression fragment to the gene of the site-directed integration vector particle and remove the marker gene expression fragment, thereby obtaining a plurality of candidate exogenous target gene expression vector particles; S2, amplifying and subculturing the multiple candidate exogenous target gene expression vectors obtained in step S1; S21, retaining the monoclonal exogenous target gene expression vector particles whose expression amount of the corresponding exogenous target gene is higher than a preset threshold according to the expression amount of the exogenous target gene; S22 determines the passage stability of the exogenous target gene expression vector particles based on the exogenous target gene expression amount of multiple generations of monoclonal exogenous target gene expression vector particles; The exogenous target gene expression vector particles with high protein expression and stable generation are obtained.

17. The method for site-specific integration of an exogenous target gene according to claim 16, wherein: Step S21 predicts the expression level of the exogenous target gene through an intelligent learning algorithm; The expression level of the exogenous target gene is retained and predicted by an intelligent algorithm based on the cell image; specifically comprising the following steps: S211, imaging the monoclonal exogenous target gene expression vector microparticles obtained in step S21 to obtain an image of a candidate monoclonal exogenous target gene expression vector microparticle; preferably, high-throughput scanning imaging is used; S212, predicting the expression level of the exogenous target gene of the monocloned exogenous target gene expression vector microparticles using an intelligent algorithm according to the image features; preferably, the image features used include: cell morphological features and / or optical features, including but not limited to roundness, size, and grayscale of specific cell sites; Preferably, the expression levels of the exogenous target gene of the monoclonal exogenous target gene expression vector particles predicted by multiple intelligent algorithms are evaluated by using the evaluation standard normalized cumulative loss gain of the ranking algorithm to evaluate the ranking accuracy of the protein expression levels predicted by the multiple intelligent algorithms, and according to the rule that the larger the standard normalized cumulative loss gain, the better the ranking accuracy of the protein expression level, the intelligent algorithm with the best ranking accuracy of the protein expression level is selected for the prediction; For a specific intelligent algorithm for predicting protein expression, the standard normalized loss cumulative gain calculation formula is as follows: Wherein IDCG is the DCG value of the real ranking of the protein expression of the sample monoclonal vector particles, i represents the predicted ranking number of a monoclonal vector particle in the sample monoclonal vector particles according to the predicted protein expression of the intelligent algorithm, rel(i) represents the real protein expression of the i-th monoclonal vector particle; k is the sample size of the sample monoclonal vector particles; When the predicted protein is a fluorescent protein, rel(i) indicates the fluorescence value; when the predicted protein is a non-fluorescent protein, rel(i) It indicates the value of protein expression tested by Western blot, Elisa, mass spectrometry, electrophoresis, etc.

18. The method for site-specific integration of an exogenous target gene according to claim 16, wherein: In step S22, the passage stability of the monoclonal exogenous target gene expression vector microparticles is determined by using an intelligent algorithm; the specific steps are as follows: S221, obtaining the expression levels of the exogenous target gene of multiple generations of the monoclonal exogenous target gene expression vector particles; S222, using an intelligent algorithm to evaluate the difference in the expression amount of the exogenous target gene of the multiple generations of monoclonal exogenous target gene expression vector particles according to the expression amount of the exogenous target gene of the multiple generations of monoclonal exogenous target gene expression vector particles obtained in step S221; S223, judging whether the monoclonal exogenous target gene expression vector microparticles have generation stability according to the difference in the expression amount of the exogenous target gene of the multiple generations of monoclonal exogenous target gene expression vector microparticles obtained in step S222, according to the principle that the smaller the difference in the expression amount, the greater the probability of having generation stability.

19. The exogenous target gene expression vector microparticle obtained by screening the method for site-directed integration of the exogenous target gene according to any one of claims 10 to 18, characterized in that: An exogenous target gene is inserted into the endogenous gene of the vector particle; the exogenous gene includes a third recognition sequence, a fourth recognition sequence, and an exogenous target gene expression segment arranged between the third recognition sequence and the fourth recognition sequence for expressing a target protein; The target gene expression level of the exogenous target gene expression vector microparticle is higher than the preset threshold value; The exogenous target gene expression vector microparticles have passage stability.

20. A site-specific integration system for an exogenous target gene, characterized in that: The system is an electronic device and / or a non-transitory computer-readable storage medium; The electronic device comprises a memory, a processor, and a computer program stored in the memory and executable on the processor, wherein when the processor executes the program, the steps of the method for site-directed integration of an exogenous target gene according to any one of claims 10 to 18 are implemented; The non-transitory computer-readable storage medium stores a computer program thereon, and when the computer program is executed by a processor, the steps of the method for site-specific integration of an exogenous target gene as claimed in any one of claims 10 to 18 are implemented.

Images