Targeted FLT3 D835H mutation derived new antigen TCR and application thereof

Abstract

The invention provides a TCR (T cell receptor) targeting FLT3D835H mutation derived new antigen, a nucleic acid molecule containing a nucleotide sequence for coding the TCR or a complementary sequence of the nucleotide sequence, a carrier containing the nucleic acid molecule, and a cell transduction the nucleic acid molecule or the carrier. The invention also relates to a pharmaceutical composition containing the TCR, the nucleic acid molecule, the carrier or the cell as active ingredients, and application of the TCR, the nucleic acid molecule, the carrier, the cell and the pharmaceutical composition in detection, prevention and / or treatment of FLT3D835H gene mutation derived neoantigen related cancers.

Description

Technical Field

[0001] The present invention belongs to the field of polypeptide drugs and polypeptide vaccines, and specifically relates to a specific TCR targeting a FLT3 D835H-derived neoantigen and its application in tumor immunotherapy. Background Art

[0002] Acute myeloid leukemia (AML) is a highly heterogeneous and aggressive malignant disease originating from myeloid precursor cells, accounting for 70% of adult leukemia. At present, the overall clinical treatment effect of AML is poor, with a 5-year survival rate of 35%-50%, and even lower to 5%-10% for elderly patients. The continuous accumulation of gene mutations gives leukemia cells extremely complex survival capabilities, leading to their continued clonal proliferation, which is the key to the poor prognosis of AML. Targeting gene mutations to specifically eliminate leukemia cell clones and promote immune balance are of great scientific significance for prolonging the disease-free survival of AML patients and reducing the relapse rate.

[0003] The FMS-like tyrosine kinase 3 (FLT3) gene is located on chromosome 13q12 and encodes a protein containing 993 amino acids. The transmembrane region is located between amino acids 542 and 564, and the kinase domain is located between amino acids 610 and 944, including a kinase insert of approximately 50 amino acids. FLT3 mutation is the most common genetic abnormality in acute myeloid leukemia (AML), occurring in approximately 30% of patients. FLT3 mutation leads to enhanced FLT3 kinase activity, thereby promoting the proliferation and growth of leukemia cells, and is closely related to the poor prognosis of AML patients.

[0004] FLT3 gene mutations mainly occur in internal tandem duplications (ITD) of the juxtamembrane domain and single nucleotide mutations of the tyrosine kinase domain (TKD). Studies have found that AML cell clones with FLT3 mutations have a survival advantage during standard treatments such as chemotherapy, and will expand to drive relapse unless effectively eradicated. However, most of the current tyrosine kinase inhibitors target FLT3-ITD mutations and have limited effects on FLT3-TKD. In addition, FLT3-TKD mutations are an important factor in primary or secondary resistance to first- and second-generation tyrosine kinase inhibitors. Therefore, the development of targeted elimination of leukemia subclones for FLT3-TKD mutations is crucial to overcome resistance to targeted inhibitors and prolong disease-free survival in AML patients.

[0005] T cells play a vital role in anti-leukemia immunity, and T cell-based immunotherapy strategies have been a hot topic and focus in the field of anti-tumor immunotherapy in recent years. The initiation of T cell immune response depends on the recognition of antigens by TCR. The engineered TCR-T cells constructed by artificially transducing antigen-specific TCR into T cells can target and kill tumor cells, change the body's immunosuppressive state, induce specific immune responses, and promote a virtuous cycle of immune protection. At present, TCR-T cells targeting tumor-associated antigens such as WT1, HA-1, and PRAME have achieved encouraging anti-tumor effects in clinical trials. However, these antigens are also expressed in normal cells, and TCR-T cell therapy targeting them has the risk of damaging normal tissues and increasing toxic side effects. Therefore, selecting a suitable target is a key entry point for optimizing TCR-T cell therapy.

[0006] Neoantigens are derived from somatic gene mutations, are specifically expressed in cancer cells, do not induce central immune tolerance, have the advantages of strong immunogenicity and good safety, and are ideal targets for immune cell therapy. Among the many FLT3-TKD mutations, the most common is the 835th aspartic acid (D835) mutation, which leads to constitutive activation of FLT3 and induces cell malignant transformation. Currently, the D835 point mutations identified from AML patients include: alanine (A), glutamic acid (E), phenylalanine (F), glycine (G), histidine (H), isoleucine (I), aspartic acid (N), valine (V), and tyrosine (Y). Among them, D835F, D835H, D835I, D835V, and D835Y are the most common. In our previous studies, we have found that the new antigen (peptide sequence: HIMSDSNYV) derived from the FLT3 D835H mutation is highly immunogenic. After being presented to the cell surface by the HLA-A*02:01 molecule to form a pHLA complex, it is recognized by T cells, induces T cell activation and has a significant anti-leukemia effect (National Invention Patent Application No.: CN202210968824.2), and is an important target for anti-leukemia immunotherapy.

[0007] Based on T cell recognition of the FLT3 D835H mutation, alternative approaches targeting FLT3 D835H mutation-derived neoantigens include T cell-mediated immunotherapy using TCRs to specifically recognize and eliminate leukemic cells. Because wild-type TCRs typically have low affinity for their peptide / HLA (pHLA) ligands, there is a need to develop TCR mutants with enhanced affinity. Summary of the invention

[0008] The present invention aims to address the deficiencies of the prior art and provides a specific TCR targeting a FLT3 D835H mutation-derived neoantigen and its application in tumor immunotherapy.

[0009] According to a first aspect of the present invention, a specific TCR targeting a FLT3 D835H mutation-derived neoantigen is provided.

[0010] The new antigen derived from the FLT3 D835 mutation (polypeptide sequence: HIMSDSNYV, national invention patent application number: CN202210968824.2) binds to the HLA-A*02:01 molecule and is presented to the surface of the target cell to form a HIMSDSNYV-HLA-A*02:01 complex.

[0011] The HIMDSNYV-HLA-A*02:01 complex is recognized by the specific TCR on the surface of T cells, inducing and initiating a specific immune response.

[0012] The TCR has the property of binding to the HIMSDSNYV-HLA-A*02:01 complex, and the TCR comprises a TCR α chain variable region and a TCR β chain variable region;

[0013] The CDR3 amino acid sequence of the TCR α chain variable region is CAASAGGDNTDKLIF (SEQ ID NO: 7).

[0014] And / or the CDR3 amino acid sequence of the TCRβ chain variable region is CASSLSPTTYNEQFF (SEQ ID NO: 10).

[0015] Preferably, the amino acid sequences of the three complementary determining regions of the TCR α chain variable region are:

[0016] αCDR1: SEQ ID NO:5.

[0017] αCDR2: SEQ ID NO:6.

[0018] αCDR3: SEQ ID NO:7.

[0019] Preferably, the amino acid sequences of the three complementary determining regions of the TCRβ chain variable region are:

[0020] βCDR1: SEQ ID NO:8.

[0021] βCDR2: SEQ ID NO:9.

[0022] βCDR3: SEQ ID NO:10.

[0023] Preferably, in the TCR targeting FLT3 D835H mutation-derived neoantigen described above, the amino acid sequence of the TCR α chain variable region is an amino acid sequence having at least 90% sequence identity with SEQ ID NO. 1; and / or the TCR β chain variable region is an amino acid sequence having at least 90% sequence identity with SEQ ID NO. 2.

[0024] Preferably, the TCR comprises the α chain amino acid sequence SEQ ID NO:17.

[0025] Preferably, the TCR comprises the β chain amino acid sequence SEQ ID NO:18.

[0026] Preferably, the TCR is an αβ heterodimer.

[0027] Preferably, the α chain and β chain of the TCR contain an artificial interchain disulfide bond.

[0028] Preferably, the amino acid sequence of the TCR is as shown in SEQ ID NO:21.

[0029] The second aspect of the present invention provides a nucleic acid molecule, which comprises a nucleic acid sequence encoding the TCR molecule described in the first aspect of the present invention or a complementary sequence thereof.

[0030] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO: 3 encoding the variable region of the TCR α chain.

[0031] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:4 encoding the variable region of the TCR β chain.

[0032] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:19 encoding the TCR α chain.

[0033] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:20 encoding the TCRβ chain.

[0034] Preferably, the nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:22.

[0035] The third aspect of the present invention provides a vector, wherein the vector contains the nucleic acid molecule described in the second aspect of the present invention.

[0036] Preferably, the vector is a viral vector.

[0037] More preferably, the viral vector is a lentiviral vector or a retroviral vector.

[0038] The fourth aspect of the present invention provides an isolated host cell, wherein the host cell contains the vector described in the third aspect of the present invention or an exogenous nucleic acid molecule described in the third aspect of the present invention integrated into its genome.

[0039] The fifth aspect of the present invention provides a cell, which expresses the TCR or its antigen-binding fragment targeting the FLT3D835H mutation-derived neoantigen described in the first aspect of the present invention, or carries the polynucleotide described in the second aspect of the present invention, or contains the vector described in the third aspect of the present invention.

[0040] Preferably, the cell is a T cell, a peripheral blood mononuclear cell (PBMC) or a stem cell.

[0041] The sixth aspect of the present invention further provides a method for preparing the TCR or antigen-binding fragment thereof targeting the FLT3 D835H mutation-derived neoantigen, the preparation method comprising culturing the cell of the fifth aspect.

[0042] In the seventh aspect, the present invention further provides the use of the TCR or antigen-binding fragment thereof targeting the FLT3 D835H mutation-derived neoantigen of the first aspect of the present invention, or the polynucleotide of the second aspect of the present invention, or the vector of the third aspect of the present invention, or the cell of the fourth aspect of the present invention, or the cell of the fifth aspect of the present invention, or the preparation method of the sixth aspect of the present invention in the preparation of a drug for treating leukemia.

[0043] In an eighth aspect, the present invention further provides a drug for treating leukemia, the drug comprising the TCR or its antigen-binding fragment targeting the FLT3 D835H mutation-derived neoantigen according to the first aspect of the present invention, or the polynucleotide according to the second aspect, or the vector according to the third aspect, or the cell according to the fourth aspect, or the cell according to the fifth aspect.

[0044] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here.

[0045] Compared with the prior art, the present invention has the following beneficial effects:

[0046] Through extensive and in-depth research, the present invention obtains a high-affinity TCR or its antigen-binding fragment targeting the FLT3 D835H mutation-derived neoantigen, as well as a nucleic acid molecule comprising a nucleotide sequence encoding the TCR or its complementary sequence, and a vector containing the nucleic acid molecule, and a cell transducing the nucleic acid molecule or the vector, and a pharmaceutical composition comprising the TCR, nucleic acid molecule, vector or cell as an active ingredient, and the use of the TCR, nucleic acid molecule, vector, cell, and pharmaceutical composition for preparing drugs for detecting and preventing / treating leukemia.

[0047] Compared with the prior art, the present invention has the following beneficial effects:

[0048] (1) The TCR of the present invention can directly eliminate leukemia cells by precisely targeting the FLT3 D835H mutation;

[0049] (2) The TCR protein of the present invention is highly expressed in vivo and has no mismatch with endogenous TCR chains;

[0050] (3) T cells expressing the TCR of the present invention have strong killing ability and specificity, and can be effectively used to treat leukemia or other cancers containing the FLT3 D835H mutation. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 :Detection and isolation of FLT3 D835H mutation-derived neoantigen-specific T cells;

[0052] Figure 2 :Schematic diagram of the original sequence of new antigen-specific TCR derived from FLT3 D835H mutation;

[0053] Figure 3 : Transduction efficiency of FLT3 D835H mutation-derived neoantigen-specific TCR gene-modified T cells;

[0054] Figure 4 :Verification of in vitro activation of FLT3 D835H mutation-derived neoantigen-specific TCR-T cells;

[0055] Figure 5 :In vitro killing activity of FLT3 D835H mutation-derived neoantigen-specific TCR-T cells;

[0056] Figure 6 :FLT3 D835H mutation-derived neoantigen-specific TCR-T cells recognize AML cell lines in vitro;

[0057] Figure 7 :FLT3 D835H mutation-derived neoantigen-specific TCR-T cells kill AML cell lines in vitro;

[0058] Figure 8 :FLT3 D835H mutation-derived neoantigen-specific TCR-T cells recognize AML primitive cells in vitro;

[0059] Fig. 9 :FLT3 D835H mutation-derived neoantigen-specific TCR-T cells kill AML primitive cells in vitro. DETAILED DESCRIPTION

[0060] In order to better understand the technical content of the present invention, specific embodiments are given and described as follows in conjunction with the accompanying drawings.

[0061] Various aspects of the present invention are described in this disclosure with reference to the accompanying drawings, in which many illustrative embodiments are shown. The embodiments of the present disclosure are not necessarily intended to include all aspects of the present invention. It should be understood that the various concepts and embodiments introduced above, as well as those described in more detail below, can be implemented in any of many ways.

[0062] Example 1. In vitro induction of FLT3 D835H mutation to derive new antigen-specific T cells

[0063] Take HLA-A * 02:01 PBMCs were isolated and purified from the venous blood of healthy volunteers with positive results by Ficoll density gradient centrifugation. Dynabeads magnetic beads were used to separate CD8 + Cells and CD14 + Resuspend CD14 cells in RPMI-1640 medium containing 10% FBS, 1000U / mL IL-4 and 1000U / mL GM-CSF. + Cells were placed in an incubator for 3 days to induce dendritic cells (DCs). DCs were reselected with fresh culture medium containing 800 IU / mL GM-CSF, 1000 IU / mL IL-4, 10 ng / mL TNF-α, 10 ng / mL IL-1β, 1000 IU / mL IL-6, and 1 μg / mL PGE2 to induce DCs maturation. Mature DCs were recovered, resuspended in serum-free RPMI-1640 medium, and FLT3 D835H mutation-derived neoantigen peptide (HIMSDSNYV; 10 μg / mL) was added and incubated at 37°C for 2-4 hours. DCs pulsed with neoantigen peptides were collected, inactivated with 30 μg / mL mitomycin C at 37°C for 30 min, resuspended in RPMI-1640 medium (containing IL-2 50 U / mL, IL-7 5 ng / mL, IL-15 5 ng / mL) containing 10% FBS, and incubated with CD8 +The cells were co-cultured, and half of the medium was replaced every 2-3 days for 10-20 days. The cells were collected and labeled with PE-HLA-A * 02:01-Tetramer and APC-labeled CD8 antibody staining, followed by flow cytometry analysis.

[0064] Results: After stimulation with FLT3 D835H mutation-derived neoantigens, healthy donor CD8 + / Tetramer + The proportion of T cells increased from 0.088% to 0.37% ( Figure 1 ), indicating that FLT3 D835H mutation-derived neoantigens induced T cell-specific expansion in vitro.

[0065] Example 2. TCR sequencing to obtain HLA-A*02:01 restricted FLT3 D835H mutation derived new antigen-specific TCR

[0066] Tetramer Sorting by Flow Cytometry + CD8 + Total RNA was extracted from cells using RNeasy Plus Mini Kit (Qiagen). The TCR Analysis System synthesizes cDNA with a 5' Race adapter from total RNA and introduces a unique molecular identifier (UMI) to control bottleneck effects and eliminate PCR and sequencing errors. Sequencing is done on Illumina The system was operated in PE150 mode. Tetramer was obtained separately + CD8 + The TCRα and TCRβ chain sequences of cells. The sequencing results were analyzed by our independently established method (National Invention Patent Application No.: CN202210939709.2). The TCRα and TCRβ sequences with the highest frequency were considered to be the main clone sequences of T cells, that is, the specific TCR sequences. Among them,

[0067] The amino acid sequence of the TCR α chain variable region is SEQ ID NO: 1.

[0068] The amino acid sequences of the three complementary determining regions of the TCRα chain variable region are:

[0069] αCDR1: NSMFDY (SEQ ID NO:5),

[0070] αCDR2: ISSIKDK (SEQ ID NO: 6),

[0071] αCDR3: CAASAGGDNTDKLIF (SEQ ID NO:7).

[0072] The nucleotide sequence of the TCR α chain variable region is SEQ ID NO.3.

[0073] The nucleotide sequences of the three complementary determining regions of the TCRα chain variable region are:

[0074] αCDR1: AACAGCATGTTTGATTAT (SEQ ID NO: 11),

[0075] αCDR2: ATAAGTTCCATAAGGATAAA (SEQ ID NO: 12),

[0076] αCDR3: TGTGCAGCAAGCGCAGGAGGGGATAACACCGACAAGCTCATCTTT (SEQ ID NO: 13).

[0077] The amino acid sequence of the TCRβ chain variable region is SEQ ID NO:2.

[0078] The amino acid sequences of the three complementary determining regions of the TCRβ chain variable region are:

[0079] βCDR1: MNHEY (SEQ ID NO:8),

[0080] βCDR2: SMNVEV (SEQ ID NO:9),

[0081] βCDR3: CASSLSPTTYNEQFF (SEQ ID NO: 10).

[0082] The nucleotide sequence of the TCRβ chain variable region is SEQ ID NO:4.

[0083] The nucleotide sequences of the three complementary determining regions of the variable region of the TCRβ chain are:

[0084] βCDR1: ATGAACCATGAGTAT (SEQ ID NO:14),

[0085] βCDR2: TCAATGAATGTTGAGGTG (SEQ ID NO: 15),

[0086] βCDR3: TGTGCCAGCAGTTTAAGCCCGACCACCTACAATGAGCAGTTCTTC (SEQ ID NO: 16).

[0087] The TCR sequences obtained by sequencing were optimized for the most frequently occurring TCRα and TCRβ sequences, and their constant regions were modified and replaced with optimized mouse constant regions to avoid mismatching between exogenous TCR and endogenous TCR of T cells; the expression sequence was codon optimized to increase protein expression; P2A and Furin-cleavage were used to enable TCRα and TCRβ to be expressed simultaneously in one expression vector.

[0088] Construct a lentiviral expression vector, insert the above TCRα and TCRβ sequences into the same lentiviral expression vector, and the TCR sequence original is as follows Figure 2 As shown. Virus packaging was performed in 293T cells to produce lentiviral particles specific for FLT3 D835H mutation-derived neoantigen-specific TCR.

[0089] Example 3. Construction of specific TCR-T cells targeting FLT3 D835H mutation

[0090] Peripheral blood was collected from healthy volunteers, and PBMCs were separated and purified by Ficoll density gradient centrifugation. The cells were resuspended in AIM-V medium containing 5% FBS, and anti-CD3 antibody (OTK3, 50 ng / mL), IL-2 (300 IU / mL), IL-7 (30 ng / mL), IL-12 (15 ng / mL) and TGF-β (5 ng / mL) were added, and the cells were activated at 37°C for 48 h. TCR lentiviral particles were used to infect activated T cells, and IL-2 (300 IU / mL) and protamine sulfate (8 μg / mL) were added, and the cells were centrifuged at 800 × g for 90 min. TCR-transfected T cells were cultured for 72 h in AIM-V medium containing 10% FBS, IL-7 (5 ng / mL), IL-15 (5 ng / mL) and IL-2 (1000 IU / mL).

[0091] TCR-T cells were collected, washed twice with FACS buffer, and then PE-mTCRβ flow cytometry antibody and PE neoantigen peptide-HLA-A were added. * 02:01-Tetramer and APC-CD3 flow antibody staining, flow cytometry detection.

[0092] The results are as follows Figure 3 Shown: TCR transduction efficiency (CD3 + / mTCRβ + ) was 23.4%, of which the efficiency of expressing heterodimeric TCR (CD3 + / Tetramer + ) was 15.4%, indicating that TCR-T cells were successfully constructed.

[0093] Example 4. Verification of the in vitro activation function of FLT3 D835H mutation-derived neoantigen-specific TCR-T cells

[0094] In order to detect the ability of TCR-T cells to target FLT3 D835H mutation, the activation level of TCR-T cells was measured by enzyme-linked immunosorbent assay (ELISA) with IFN-γ and Granzyme B. The specific steps are as follows:

[0095] TCR-T cells transfected with lentivirus were counted at 1×10 6 / mL were inoculated in 24-well plates, and IL-7 was added on Day 1.

[0096] (10 ng / mL), IL-15 (10 ng / mL); Day 2 T2 cells loaded with neoantigen peptides were co-incubated with TCR-T cells at a ratio of 1:10 to achieve secondary antigen stimulation, and IL-21 (30 ng / mL) was added; Day 3 IL-7

[0097] (10 ng / mL), IL-15 (10 ng / mL) and continued to culture. TCR-T cells were collected as effector cells.

[0098] Loading different concentrations (10 1 , 10 0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 T2 cells loaded with FLT3 D835H mutation-derived neoantigen peptides at 1×10 5 / 100 μl / well were inoculated in 96-well plates, and TCR-T cells (2×10 5 / 100μl / well), co-culture at 37℃ for 18-24h. Centrifuge the plate, take 100μl supernatant from each well and add it to the ELISA strips pre-coated with IFN-γ or Granzyme B antibody, develop the color according to the instructions, and read the plate with an enzyme reader. Calculate the standard curve based on the absorbance value of the standard, and calculate the IFN-γ or Granzyme B secretion level of each well of the sample accordingly. Set at least 3 replicates for each concentration in each group above, and repeat each experiment 3 times.

[0099] The results are as follows Figure 4 As shown: Under the stimulation of T2 cells loaded with FLT3 D835H mutation-derived neoantigens, TCR-T cells significantly secreted IFN-γ and Granzyme B, while T2 cells loaded with wild-type antigen peptides had no effect. This indicates that the activation of TCR-T cells is FLT3 D835H specific.

[0100] Example 5. Verification of the in vitro killing function of FLT3 D835H mutation-derived neoantigen-specific TCR-T cells

[0101] In order to verify the ability of TCR-T cells to target FLT3 D835H mutation, the killing ability of TCR-T cells was evaluated by quantitative detection of lactate dehydrogenase (LDH) released during cell lysis. The specific steps are as follows:

[0102] The transfected and amplified TCR-T cells in Example 4 were collected as effector cells; T2 cells loaded with FLT3 D835 mutation-derived neoantigen peptides (10 μg / mL) were used as target cells in the experimental group, and T2 cells loaded with corresponding concentrations of FLT3 wild-type antigen peptides (10 μg / mL) were used as target cells in the control group. TCR-T cells and target cells were inoculated in 96-well plates at effector-target ratios of 40:1, 20:1, 10:1, and 5:1, respectively. Promega CytoTox Instructions for the Non-Radioactive Cytotoxicity Assay Kit In addition, target cell spontaneous release wells, target cell maximum release wells, culture base control wells, and volume correction control wells were set up. The 96-well plate was placed at 37°C for 4 hours, the plate was centrifuged, 50 μl of supernatant was aspirated from each well and added to a new 96-well plate, color was developed according to the instructions, the plate was read with an ELISA reader, and the cytotoxicity% at different effect-target ratios was calculated to evaluate the ability of TCR-T cells to specifically kill T2 cells loaded with FLT3 D835H mutation-derived neoantigens. Each well was set up with 3 replicates, and the experiment was repeated 3 times.

[0103] The results are as follows Figure 5 As shown: TCR-T cells significantly killed T2 cells loaded with FLT3 D835H mutation-derived neoantigens, but had no effect on T2 cells loaded with FLT3 wild-type antigen peptides, indicating that TCR-T cells have targeted killing function.

[0104] Example 6. FLT3 D835H mutation-derived neoantigen-specific TCR-T cells recognize AML cell lines in vitro

[0105] In order to verify the function of TCR-T cells in recognizing AML cell lines that endogenously present FLT3 D835H mutation-derived neoantigens, the activation capacity of TCR-T cells was determined by IFN-γ- and Granzyme B-ELISA. The specific steps are as follows:

[0106] The TCR-T cells transfected and amplified in Example 4 were collected as effector cells; * 02:01 Positive and transfected with FLT3 D835H mutation OCI-AML3 D835HCells were used as target cells, and original OCI-AML3 cells were used as control target cells. Target cells were 2×10 4 / 100μl / well was inoculated in a 96-well plate, and TCR-T cells were added at effector-target ratios of 20:1, 10:1, 5:1 and 2.5:1. Incubate at 37°C for 18-24h. The secretion levels of IFN-γ and Granzyme B were detected as in Example 4 to evaluate the function of TCR-T cells in specifically recognizing AML cell lines. At least 3 replicate wells were set for each concentration in each group above, and each experiment was repeated 3 times.

[0107] The results are as follows Figure 6 Shown: In OCI-AML3 D835H Under the stimulation of cells, TCR-T cells significantly secreted IFN-γ and Granzyme B, but had no effect on OCI-AML3 cells. This indicates that TCR-T specifically recognizes HLA-A endogenously presenting FLT3D835H mutation-derived neoantigens. * 02:01 + AML cell lines.

[0108] Example 7: FLT3 D835H mutation-derived neoantigen-specific TCR-T cells kill AML cell lines in vitro

[0109] In order to verify the ability of TCR-T cells to target AML cell lines that endogenously present FLT3 D835H mutation-derived neoantigens, the killing ability of TCR-T cells was determined by LDH release assay. The specific steps are as follows:

[0110] The TCR-T cells transfected and amplified in Example 4 were collected as effector cells; OCI-AML3 cells transfected and amplified in Example 6 were collected D835H and OCI-AML3 cells were used as target cells in the experimental and control groups, respectively. TCR-T cells and target cells in each group were added at an effector-target ratio of 40:1, 20:1, 10:1, and 5:1, respectively, and incubated at 37°C for 4 hours. Supernatant was collected, color developed, and plates were read according to the instructions. The cell lysis rate was calculated according to the formula to evaluate the ability of TCR-T cells to specifically kill AML cell lines. At least 3 replicates were set for each concentration in each group above, and each experiment was repeated 3 times.

[0111] The results are as follows Figure 7 As shown: TCR-T cells significantly kill OCI-AML3 D835H cells, but had no effect on OCI-AML3 cells expressing wild-type FLT3. This indicates that TCR-T cells specifically kill HLA-A endogenous antigens that present FLT3 D835H mutation-derived neoantigens. * 02:01 + AML cell lines.

[0112] Example 8: FLT3 D835H mutation-derived neoantigen-specific TCR-T cells recognize AML primitive cells in vitro

[0113] In order to verify the function of TCR-T cells in recognizing AML primitive cells that endogenously present FLT3 D835H mutation-derived neoantigens, the activation ability of TCR-T cells was determined by IFN-γ- and Granzyme B-ELISA. The specific steps are as follows:

[0114] The TCR-T cells transfected and amplified in Example 4 were collected as effector cells; HLA-A * 02:01 + / FLT3 D385H+ Bone marrow primitive cells of AML patients were used as target cells in the experimental group, and HLA-A * 02:01 – / FLT3 D385H+ , HLA-A * 02:01 + / FLT3 D385H– and HLA-A * 02:01 – / FLT3 D385H– AML patients' bone marrow primitive cells were used as the control group target cells. 2×10 4 / 100μl / well was inoculated in a 96-well plate, and TCR-T cells were added at effector-target ratios of 20:1, 10:1, 5:1 and 2.5:1. Incubate at 37°C for 18-24h. The secretion levels of IFN-γ and Granzyme B were detected as in Example 4 to evaluate the function of TCR-T in specifically recognizing AML primitive cells. At least 3 replicate wells were set for each concentration in each group above, and each experiment was repeated 3 times.

[0115] The results are as follows Figure 8 Shown: In HLA-A * 02:01 + / FLT3 D385H+ Under the stimulation of AML primitive cells, TCR-T cells significantly secreted IFN-γ and Granzyme B. This indicates that TCR-T cells specifically recognize AML primitive cells that endogenously present FLT3 D835H.

[0116] Example 9: FLT3 D835H mutation-derived neoantigen-specific TCR-T cells kill AML primitive cells in vitro

[0117] In order to verify the function of TCR-T cells targeting AML primitive cells that endogenously present FLT3 D835H mutation-derived neoantigens, the killing ability of TCR-T cells was determined by LDH release method. The specific steps are as follows:

[0118] The TCR-T cells transfected and amplified in Example 4 were collected as effector cells; HLA-A * 02:01 + / FLT3 D385H+ Bone marrow primitive cells of AML patients were used as target cells in the experimental group, and HLA-A * 02:01 – / FLT3 D385H+ , HLA-A * 02:01 + / FLT3 D385H– and HLA-A * 02:01 – / FLT3 D385H– Bone marrow primitive cells of AML patients were used as target cells in the control group. TCR-T cells and target cells of each group were added at an effector-target ratio of 20:1, 10:1, and 5:1, respectively, and incubated at 37°C for 4 hours. The supernatant was collected, the color was developed, and the plate was read according to the instructions. The cell lysis rate was calculated according to the formula to evaluate the ability of TCR-T cells to specifically kill AML primitive cells. At least 3 replicates were set for each concentration in each group above, and each experiment was repeated 3 times.

[0119] The results are as follows Fig. 9 As shown: TCR-T cells significantly kill HLA-A*02:01 + / FLT3 D385H+ AML blasts, demonstrating the targeting effect of TCR-T cells on FLT3 D835H mutation-positive AML blasts.

[0120] Although the present invention has been disclosed as above with preferred embodiments, it is not intended to limit the present invention. A person with ordinary knowledge in the technical field to which the present invention belongs may make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention shall be determined by the definition of the claims.

Claims

1. A TCR targeting a FLT3 D835H mutation-derived neoantigen, characterized in that: The invention comprises a TCR capable of recognizing a HIMSDSNYV-HLA-A*02:01 complex, wherein the TCR comprises a TCR α chain variable region and / or a TCR β chain variable region: The amino acid sequence of CDR3 in the TCRα chain variable region is: CAASAGGDNTDKLIF (SEQ ID NO:7) The amino acid sequence of CDR3 in the TCRβ chain variable region is: CASSLSPTTYNEQFF (SEQ ID NO:10).

2. The TCR targeting FLT3 D835H mutation-derived neoantigen according to claim 1, characterized in that: The TCR α chain variable region also includes αCDR1 and / or αCDR2 complementary determining regions, the amino acid sequence of which is: αCDR1: NSMFDY (SEQ ID NO:5), αCDR2: ISSIKDK (SEQ ID NO:6).

3. The TCR targeting FLT3 D835H mutation-derived neoantigen according to claim 1, characterized in that: The TCR β chain variable region also includes _x0016_βCDR1 and / or βCDR2 complementary determining regions, whose amino acid sequences are: βCDR1: MNHEY (SEQ ID NO:8), βCDR2: SMNVEV (SEQ ID NO:9).

4. The TCR targeting FLT3 D835H mutation-derived neoantigen according to claim 1, characterized in that: The amino acid sequence of the TCR α chain variable region is an amino acid sequence having at least 90% sequence identity with SEQ ID NO: 1; and / or the TCR β chain variable region is an amino acid sequence having at least 90% sequence identity with SEQ ID NO:

2.

5. The TCR targeting FLT3 D835H mutation-derived neoantigen according to claim 1, characterized in that: The TCR comprises an α chain amino acid sequence of SEQ ID NO:

17.

6. The TCR targeting FLT3 D835H mutation-derived neoantigen according to claim 1, characterized in that: The TCR comprises a β chain amino acid sequence of SEQ ID NO:

18.

7. The TCR targeting FLT3 D835H mutation-derived neoantigen according to claim 1, characterized in that: TCR is an αβ heterodimer with an artificial interchain disulfide bond between the α chain and the β chain.

8. The TCR targeting FLT3 D835H mutation-derived neoantigen according to claim 1, characterized in that: The amino acid sequence of the TCR is shown in SEQ ID NO:

21.

9. A nucleic acid molecule, characterized in that: The nucleic acid molecule comprises a nucleic acid sequence encoding the TCR molecule according to claims 1 to 8 or a complementary sequence thereof.

10. The nucleic acid molecule according to claim 9, characterized in that: It comprises the nucleotide sequence SEQ ID NO: 3 encoding the variable region of the TCR α chain.

11. The nucleic acid molecule according to claim 9, characterized in that: The nucleic acid molecule comprises the nucleotide sequence SEQ ID NO: 19 encoding the TCR α chain.

12. The nucleic acid molecule according to claim 9, characterized in that: The nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:4 encoding the variable region of the TCR β chain.

13. The nucleic acid molecule according to claim 9, characterized in that: The nucleic acid molecule comprises the nucleotide sequence SEQ ID NO: 20 encoding the TCR β chain.

14. The nucleic acid molecule according to claim 9, characterized in that: The nucleic acid molecule comprises the nucleotide sequence SEQ ID NO:

22.

15. A carrier, characterized in that: The vector contains the nucleic acid molecule according to any one of claims 9 to 14.

16. The carrier according to claim 15, characterized in that: The vector is a lentiviral vector or a retroviral vector.

17. An isolated host cell, characterized in that: The host cell contains the vectors according to claims 15 and 16 or an exogenous nucleic acid molecule according to any one of claims 9 to 14 integrated into its genome.

18. A cell, characterized in that: The cell expresses the TCR or antigen-binding fragment thereof targeting the FLT3 D835H mutation-derived neoantigen as described in claims 1 to 8, or carries the polynucleotide as described in claims 9 to 14, or contains the vector as described in claims 15 and 16.

19. The cell according to claim 18, characterized in that: The cells are T cells, peripheral blood mononuclear cells (PBMC) or stem cells.

20. A drug for treating a tumor, the drug comprising the TCR or antigen-binding fragment thereof targeting a new antigen derived from the FLT3 D835H mutation as described in claims 1 to 8, or the polynucleotides of claims 9 to 14, or the vectors of claims 9 to 14, or the cells of claim 17, or the cells of claims 18 and 19.

21. Use of the TCR according to any one of claims 1 to 8, or the polynucleotides according to claims 9 to 14, or the vectors according to claims 9 to 14, or the cells according to claim 17, or the cells according to claims 18 and 19 in a drug for treating leukemia.

Images